ID: 1145897834

View in Genome Browser
Species Human (GRCh38)
Location 17:28470834-28470856
Sequence CTGGAGATAGAGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 0, 2: 4, 3: 88, 4: 696}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145897834_1145897842 10 Left 1145897834 17:28470834-28470856 CCCAGCCCCAGCTCTATCTCCAG 0: 1
1: 0
2: 4
3: 88
4: 696
Right 1145897842 17:28470867-28470889 ACCTGCTTCTGAGGACAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 183
1145897834_1145897840 1 Left 1145897834 17:28470834-28470856 CCCAGCCCCAGCTCTATCTCCAG 0: 1
1: 0
2: 4
3: 88
4: 696
Right 1145897840 17:28470858-28470880 TTATCAGCCACCTGCTTCTGAGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145897834 Original CRISPR CTGGAGATAGAGCTGGGGCT GGG (reversed) Intronic
900117197 1:1033809-1033831 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900628110 1:3618756-3618778 ATGGAGCCAGGGCTGGGGCTTGG - Intergenic
901284207 1:8063742-8063764 CGGGAGTTACAGCTTGGGCTAGG + Intergenic
901405211 1:9040519-9040541 CTGGGCATAGAGCTGGGAGTGGG - Intronic
901423753 1:9168003-9168025 CTAGAGACAGGGCTGGAGCTGGG + Intergenic
901626997 1:10630189-10630211 CTGGGGCTGGGGCTGGGGCTGGG - Exonic
901632946 1:10656783-10656805 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
901632949 1:10656789-10656811 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
901648071 1:10727284-10727306 CTGGAGTGGGGGCTGGGGCTGGG - Intronic
901875316 1:12164109-12164131 TGGGAGATAGAGCCAGGGCTGGG + Intergenic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
902614239 1:17615243-17615265 CGGGTGCTAGGGCTGGGGCTTGG + Intronic
902618045 1:17634630-17634652 CTGGATATGGGGCTGGGGCCTGG + Intronic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
902785301 1:18729251-18729273 CTGGAGGTGGACCTGAGGCTTGG + Intronic
902876296 1:19342774-19342796 CTGGATGTAGATCTGGCGCTGGG + Exonic
903177545 1:21590011-21590033 CTGTAGATGGACCTGGGGCCTGG + Intergenic
903375492 1:22863227-22863249 CTGCAGGTAGACCTGGGACTCGG - Intronic
903850070 1:26300706-26300728 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
903994391 1:27296757-27296779 CTGGGGCTAGGGCTGGGGCTGGG - Intronic
903994399 1:27296775-27296797 CTGGGGCTAGGGTTGGGGCTGGG - Intronic
903994407 1:27296793-27296815 CTGGGGCTAGGGCTGGGGCTGGG - Intronic
903994413 1:27296805-27296827 CTGGGGCTGGGGCTGGGGCTAGG - Intronic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
904421822 1:30399006-30399028 CTGCAGAGAGAGATGGGGGTGGG + Intergenic
904684126 1:32248494-32248516 CTGGAGCTGGAGCTGGAGCCCGG + Exonic
904848459 1:33438782-33438804 CTGGAGATGGTGCTGGGCCCCGG - Intergenic
905017316 1:34786506-34786528 CTGGGGCTTGAGCTGGAGCTCGG + Intronic
905018416 1:34792892-34792914 CTGGAGAGAGGGCGGGGGCGGGG - Intronic
905205955 1:36342941-36342963 CTGGAGAAAGTGTTGGGCCTAGG - Intronic
905461715 1:38126577-38126599 AGGGAAGTAGAGCTGGGGCTGGG + Intergenic
905535232 1:38715941-38715963 CTGGAGAGACCACTGGGGCTTGG - Intergenic
906372178 1:45263488-45263510 ATAGAGATAGAGATGGGGATGGG + Intronic
906922205 1:50076650-50076672 CATGAGATAGACCTGGGCCTGGG + Intronic
907283805 1:53367818-53367840 GGGGAGATAGCCCTGGGGCTTGG - Intergenic
907654346 1:56327310-56327332 CTGAAGATGGAGATGGGGATGGG + Intergenic
907673562 1:56498442-56498464 GTGGAGCTGGGGCTGGGGCTGGG - Intronic
908233356 1:62127508-62127530 TAAGAGCTAGAGCTGGGGCTGGG + Intronic
908808133 1:67951889-67951911 CTAGATATGGAGCTGGGGATGGG - Intergenic
910374343 1:86552671-86552693 TTGCAGATGGAGCTGGGGCACGG + Intronic
910864712 1:91777570-91777592 CTGGGGTTGGGGCTGGGGCTGGG - Intronic
910864718 1:91777582-91777604 CTGGGGCTAGAGCTGGGGTTGGG - Intronic
911180354 1:94854880-94854902 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
913063902 1:115232231-115232253 ATGGAAATAGAGATGGGGATGGG + Intergenic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
914963093 1:152224294-152224316 GTGGAGATAGAGGTGGAGATGGG - Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915348953 1:155212834-155212856 CTGGAGCTGGGGCTGGGGCTGGG + Intronic
915352140 1:155233460-155233482 CTGGAGCTGGGGCTGGGGCTGGG + Intergenic
915437292 1:155917589-155917611 CTGGGGCTGGGGCTGGGGCTGGG + Exonic
915893054 1:159789164-159789186 CCTGAGATCTAGCTGGGGCTGGG + Intergenic
917135475 1:171784550-171784572 CTGGGGCTTGGGCTGGGGCTGGG + Intronic
917724247 1:177814046-177814068 TTGGAGGTAGAGCTTGGCCTGGG - Intergenic
917974308 1:180229563-180229585 GGGGAGAGAGAGCAGGGGCTGGG + Intergenic
919842317 1:201618501-201618523 CCAGAGATAGAGTTGGGGGTGGG - Intergenic
919971629 1:202584044-202584066 CTAGAGATTGGGATGGGGCTGGG - Exonic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920404251 1:205697215-205697237 CTGGAGCCAGAGATGTGGCTGGG - Intergenic
920504682 1:206507658-206507680 CTGTAGATAGCGCGGCGGCTCGG - Exonic
921601035 1:217106731-217106753 CTGGAGATAGGGTTGAGGGTTGG - Intronic
921888520 1:220330416-220330438 CTGGAGGGAGAGAGGGGGCTGGG - Intergenic
921929820 1:220746107-220746129 CTGGAGATAGACATGTGGTTAGG - Intergenic
922366108 1:224865225-224865247 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
922366111 1:224865231-224865253 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
922854831 1:228765907-228765929 CAGGAGATAGAGATGAGGCTGGG + Intergenic
922973067 1:229759409-229759431 CTGGGGATAGAGCTCAGGGTGGG + Intergenic
923291566 1:232551289-232551311 ATGGAGAAAGAGCTGGTTCTGGG - Intronic
1062795305 10:340871-340893 CTGGCGATGGTGCTGGGCCTGGG - Intronic
1063068385 10:2633997-2634019 CTGGAAATGGACCTGCGGCTGGG - Intergenic
1063219698 10:3955699-3955721 CTGGAGATTGTGCTGAGGCCTGG - Intergenic
1065822922 10:29542962-29542984 CCAGAGACAGAGCTGGAGCTTGG - Intronic
1066431620 10:35357190-35357212 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1067317241 10:45180322-45180344 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1067317244 10:45180328-45180350 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1067409927 10:46055377-46055399 CTGTAAAGAGAGCAGGGGCTTGG - Intergenic
1067538038 10:47130762-47130784 CTTGAGATAGGGCAGGGGCTAGG + Intergenic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1067839749 10:49666231-49666253 CTGGAGCTGGGGCTGGGGCTGGG - Intergenic
1067839752 10:49666237-49666259 CTGGAGCTGGAGCTGGGGCTGGG - Intergenic
1067839755 10:49666243-49666265 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1067839760 10:49666261-49666283 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1068006313 10:51395472-51395494 CCAGAGGTAAAGCTGGGGCTGGG + Intronic
1068892788 10:62165131-62165153 GTGGAGATGGAGCTTGGGCTGGG - Intergenic
1069855677 10:71439721-71439743 CTCCAGAGAGAACTGGGGCTGGG - Intronic
1070383849 10:75906044-75906066 CTGGGGTGAGAGCTGGGACTGGG - Intronic
1070769711 10:79075097-79075119 CTAGGGGTGGAGCTGGGGCTGGG - Intronic
1070969611 10:80552596-80552618 CTGGAGTGAGAGCTGGGATTGGG - Intronic
1072811173 10:98463264-98463286 CTGGAGAGGTAGCTGGAGCTGGG - Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073314336 10:102567859-102567881 CTGGAGCTAGGCCTGGGGCTAGG - Intronic
1074340769 10:112627080-112627102 CTTGAGATAGAGCTGAGACAGGG - Intronic
1074814586 10:117134680-117134702 CTGCGGATAGGGCTGGGACTTGG - Intronic
1074922089 10:118024915-118024937 CTGCAGAGATGGCTGGGGCTAGG - Intronic
1075515451 10:123104556-123104578 CTGGAGATGGAGTTGGGGCCTGG + Intergenic
1075595654 10:123727294-123727316 CTGGAGGGAGAGATGAGGCTGGG - Intronic
1076275016 10:129191463-129191485 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1076275019 10:129191469-129191491 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1076330068 10:129657625-129657647 CTGGAGGAGGAGCTGGAGCTGGG + Intronic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076639615 10:131905387-131905409 CAGGAGAGGGAGCAGGGGCTGGG - Intronic
1076913134 10:133402257-133402279 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1077097180 11:803994-804016 CTGGAGCTGGGGCTGGGACTGGG + Intronic
1077360577 11:2138765-2138787 CGGGAGAAAGAGCGGGGGCCGGG + Intronic
1077633146 11:3824501-3824523 CTGGGGTTGGGGCTGGGGCTTGG + Intronic
1079201887 11:18383639-18383661 CTGGAGAGGAAGCTGAGGCTGGG + Intergenic
1079334083 11:19555840-19555862 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1079334086 11:19555846-19555868 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1080485617 11:32704181-32704203 CTGGGTTTAGAGCTGTGGCTGGG - Intronic
1081103049 11:39028958-39028980 CTGGAGCTTGAGCTGGTGCAGGG + Intergenic
1081616465 11:44594394-44594416 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1081755640 11:45542391-45542413 CTGGAGAGGGAGCTGGGTGTGGG - Intergenic
1081847703 11:46252597-46252619 CTGGATCCTGAGCTGGGGCTGGG + Intergenic
1082722904 11:56700764-56700786 CTGGGCATAAAGCAGGGGCTTGG - Exonic
1082771806 11:57213591-57213613 CTTGAGAGAGAGGAGGGGCTGGG - Intergenic
1082922666 11:58512418-58512440 CTGTAGACAGAGCTGGGTTTGGG - Intergenic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083281365 11:61629114-61629136 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1083339880 11:61952101-61952123 CTGGAGCTGAGGCTGGGGCTGGG + Intronic
1083578178 11:63807574-63807596 CAGGGGATAGAGCTAGGGTTGGG + Intergenic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1083675054 11:64320590-64320612 CTGGAGATAAAGGGTGGGCTGGG + Intronic
1084032427 11:66488758-66488780 GTGGAGATGAAGCAGGGGCTGGG - Intronic
1084055252 11:66627774-66627796 CTGGAATGAGTGCTGGGGCTGGG + Intronic
1084195660 11:67522652-67522674 TTGGGGCTGGAGCTGGGGCTGGG + Exonic
1084576745 11:69993554-69993576 CTGAAGACCGAGCTGGGACTAGG - Intergenic
1084801699 11:71548275-71548297 CAGGAGAAGAAGCTGGGGCTCGG + Intronic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1089317380 11:117601162-117601184 TTGGAGCTAGAGGTGGGGGTGGG - Intronic
1089363734 11:117908556-117908578 CTGCAGAGGGTGCTGGGGCTGGG + Intronic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1089698663 11:120231042-120231064 CTGGAGCAATGGCTGGGGCTTGG - Intergenic
1090256781 11:125290052-125290074 CAGGAGGTGGGGCTGGGGCTGGG - Intronic
1090349080 11:126095741-126095763 CTGGAGACAGATCTGGGGTGAGG + Intergenic
1091436934 12:480658-480680 CCGGAGATAAGGCTGGGCCTGGG - Intronic
1091614599 12:2039918-2039940 CTGGAGATGGGGATGGGGGTAGG + Intronic
1091801628 12:3328201-3328223 CTGCAGGTAGAGCAGGAGCTGGG - Intergenic
1092068465 12:5612839-5612861 CTGGAGATAAGAATGGGGCTGGG + Intronic
1092091288 12:5805656-5805678 CAGGAAACAGAGATGGGGCTCGG - Intronic
1094366320 12:29686526-29686548 CTGTAGATGGAGCTGATGCTGGG + Intronic
1095038623 12:37420014-37420036 CTGGGGCTGGAGCTGGCGCTGGG - Intergenic
1095741470 12:45611253-45611275 CTGGGGCTGGCGCTGGGGCTGGG + Intergenic
1095741473 12:45611259-45611281 CTGGCGCTGGGGCTGGGGCTGGG + Intergenic
1095741476 12:45611265-45611287 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1095741479 12:45611271-45611293 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1095741482 12:45611277-45611299 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1095741485 12:45611283-45611305 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1095988195 12:48014806-48014828 CAGGAGGCAGAGCTGGGACTGGG - Intergenic
1096183668 12:49564998-49565020 CTGGAGTTGGTGCTGAGGCTGGG - Intronic
1096216872 12:49802792-49802814 CTAGAGACAGAGGTGGGACTAGG - Intronic
1096257626 12:50072879-50072901 CCTGAAATAGAGCTGGGGCCAGG + Intronic
1096257977 12:50074315-50074337 CTGGGGTTGGGGCTGGGGCTGGG + Intronic
1096750256 12:53754093-53754115 GAGGAGATAGAGGTGGGGATGGG + Intergenic
1096809226 12:54159153-54159175 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097189584 12:57213055-57213077 CTGGAGTTGGGGCTGGGGTTTGG - Exonic
1099439884 12:82686971-82686993 CTGGGGCTGGGGCTGGGGCTGGG + Exonic
1099439887 12:82686977-82686999 CTGGGGCTGGGGCTGGGGCTGGG + Exonic
1100272689 12:93041498-93041520 CTGGAGATAAAGCAGTGCCTGGG - Intergenic
1100475361 12:94930606-94930628 CAGGAGATTGAGCTGCTGCTTGG + Intronic
1100719540 12:97343205-97343227 CTTGGGATAAAGCAGGGGCTGGG + Intergenic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1102199656 12:111048561-111048583 CTGGACATAGAGCTGGTGCAAGG + Intronic
1103447546 12:121004057-121004079 TTGGAGAGGGAGGTGGGGCTTGG + Exonic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1104748621 12:131224643-131224665 GTGGAGATAGGGGTGGGGCCAGG + Intergenic
1104784501 12:131440921-131440943 GTGGAGATAGGGGTGGGGCCAGG - Intergenic
1104989631 12:132618553-132618575 CTGGACCAAGAGCTGGGGCTGGG + Intergenic
1105209397 13:18249024-18249046 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1105281367 13:18964618-18964640 CTGGAGCTGGAGCTGGAGCTGGG - Intergenic
1105290578 13:19050626-19050648 CTGGAGCTGGAGCTGGGGGCGGG - Intergenic
1106340087 13:28819737-28819759 CTGGGGCTGGAGCTGGGGCTGGG + Intergenic
1106340113 13:28819791-28819813 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1106340116 13:28819797-28819819 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1106340119 13:28819803-28819825 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1106340122 13:28819809-28819831 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1107086310 13:36431475-36431497 CGGGCGACAGAGCTGGGGCTTGG - Intergenic
1108065694 13:46575395-46575417 CTGGTGATAGAACTGGGCGTGGG + Intronic
1109940092 13:69350440-69350462 CTGGAGAGAAATCTGGAGCTGGG + Intergenic
1113565133 13:111315363-111315385 CTGGAGACTGGGCTGAGGCTTGG + Intergenic
1113884599 13:113651986-113652008 CAGGAGGCAGAGCTGGGGCGGGG + Intronic
1114280747 14:21191061-21191083 CTGGAGAAAGAATTGGGGCTTGG - Intergenic
1114424052 14:22607714-22607736 CTGGGGAAAGGGCTAGGGCTGGG - Intronic
1114535024 14:23417350-23417372 CTGGACATGGGGCTGAGGCTGGG - Intronic
1115664774 14:35534562-35534584 CTGGGGCTGGGGCTGGGGCTGGG - Exonic
1116895677 14:50312631-50312653 CTGGAGCTGGAGCGGGGGCGGGG - Exonic
1118323285 14:64765630-64765652 CTGGATATGGAGCTGGTTCTGGG - Intronic
1118765195 14:68904842-68904864 CTGAGGATCGAGCTGGGGCTGGG - Intronic
1119190574 14:72679450-72679472 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1119398882 14:74348854-74348876 CTGGAGGTGGAGGTGGGGGTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119583819 14:75812859-75812881 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1120032057 14:79653020-79653042 CTGGAGATAGTGCTGCAGTTAGG - Intronic
1120275362 14:82366899-82366921 ATTGAGACAGAGCTGGGGGTAGG - Intergenic
1120405619 14:84090808-84090830 CCTGAGATGGAGCTGGGCCTGGG + Intergenic
1120851670 14:89177539-89177561 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1120851673 14:89177545-89177567 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1121085382 14:91142176-91142198 CAGGTGGTAGAGCTGGAGCTTGG + Intronic
1121422360 14:93824617-93824639 GGGGAGAGGGAGCTGGGGCTTGG + Intergenic
1122038512 14:98965322-98965344 ATGCAGAGAGAGCTGGGGATGGG - Intergenic
1122068209 14:99188538-99188560 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1122068212 14:99188544-99188566 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1122068215 14:99188550-99188572 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1122068218 14:99188556-99188578 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1122068221 14:99188562-99188584 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1122068223 14:99188568-99188590 CTGGGGCTGGGGCTGGGGCTAGG + Intronic
1122315296 14:100822661-100822683 CTGGCACTAGAGCTGGGGATTGG + Intergenic
1122853423 14:104548642-104548664 CTGGGGAGAACGCTGGGGCTGGG - Intronic
1122853452 14:104548714-104548736 CTGGGGAGAATGCTGGGGCTGGG - Intronic
1122902921 14:104789189-104789211 CTCGAGAAAGGGCTGGGCCTAGG - Intronic
1124648316 15:31456335-31456357 ATGGATATTGAGCTGGGGGTGGG + Intergenic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1125433549 15:39623029-39623051 CTGGGAATGGAGCTGTGGCTGGG - Intronic
1126418048 15:48439715-48439737 GGGGAGATAGAGCTGGGGTCTGG - Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127727891 15:61768279-61768301 CTGGTGTCAGAGCTGGGGCAGGG - Intergenic
1128160778 15:65421903-65421925 CTGGAGAAAGGGCTGGGGAGGGG - Intronic
1128218753 15:65952921-65952943 ATGGAGATAGAGATGGGGGTGGG - Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128237374 15:66077518-66077540 CTGGAGGTGGAGGTGGGACTAGG - Intronic
1128395242 15:67218329-67218351 CAGGTGATAAAGCTGGGGCAGGG + Intronic
1128609562 15:69063058-69063080 CTAGAGCTAGAGCTGGGGGGAGG - Intergenic
1128657087 15:69470248-69470270 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1128657090 15:69470254-69470276 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1128657093 15:69470260-69470282 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1128944307 15:71810874-71810896 CTGGAGGTAGGGTTGGGTCTGGG + Intronic
1129144026 15:73632261-73632283 CTGGGTATAGAGATGGGGGTGGG - Intronic
1129159873 15:73741248-73741270 CGGGAGATGGAGATGGGGGTGGG - Intronic
1129676817 15:77636214-77636236 CAGGAGGTGGAGCTGGGGCAAGG + Intronic
1129899295 15:79133737-79133759 CTGGGGATTGGGCTAGGGCTGGG - Intergenic
1131403294 15:92143745-92143767 TTGGAGCTGGAGCTGGGGCTGGG + Intronic
1131828991 15:96342447-96342469 ATGGAGATAGAGGTGGGGTGGGG - Intergenic
1132208901 15:100005955-100005977 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1132507822 16:321107-321129 CTGGAGGTAGATCTGGCCCTGGG + Intronic
1132600055 16:769238-769260 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1132600058 16:769244-769266 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133387988 16:5386263-5386285 GGGTAGATAGAGCTGGGACTGGG + Intergenic
1133855782 16:9547956-9547978 CTGCAGCTAGGTCTGGGGCTGGG + Intergenic
1134322237 16:13174515-13174537 CTGGAGACAGAACTGGGGGCAGG + Intronic
1135424361 16:22324969-22324991 CAGGAGCAAGAGCTGGGGCCTGG + Intronic
1135574893 16:23577907-23577929 CTGGAGACAGGACTGGGACTGGG + Intergenic
1135917797 16:26621674-26621696 CTGGGGTTAGAGCCAGGGCTAGG + Intergenic
1136144321 16:28307040-28307062 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1136144324 16:28307046-28307068 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1136317549 16:29463306-29463328 GTGGTGATGGTGCTGGGGCTGGG + Intronic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1136432124 16:30202651-30202673 GTGGTGATGGTGCTGGGGCTGGG + Intronic
1136540678 16:30926193-30926215 GGGGTGATAGAGCAGGGGCTGGG - Intronic
1136554821 16:31001487-31001509 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1136569150 16:31086492-31086514 CTGGTGAAAGAGACGGGGCTGGG + Intronic
1137404572 16:48179415-48179437 CTGGAGGCAGAGCTGGGCTTGGG + Intronic
1137627640 16:49919756-49919778 CTTGGGATAGGCCTGGGGCTGGG + Intergenic
1137801670 16:51267138-51267160 CTGAAGCTGGAGCAGGGGCTGGG + Intergenic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138446332 16:57066545-57066567 CTGGACACAGAGCTGCTGCTGGG - Exonic
1138519626 16:57563585-57563607 CTGGGGCTGGTGCTGGGGCTGGG + Intronic
1138817563 16:60220601-60220623 CAGGAGGTAGAGCTGGGCCAGGG + Intergenic
1139751921 16:69114141-69114163 AGGGAGGTAGAGCTGGTGCTGGG + Intronic
1140523527 16:75602844-75602866 CTAAGGATAGAACTGGGGCTTGG - Intronic
1141294172 16:82751350-82751372 ATGGAGCATGAGCTGGGGCTTGG + Intronic
1141620909 16:85236026-85236048 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1141674058 16:85508394-85508416 GTGGAAACAGAGCAGGGGCTAGG - Intergenic
1141805682 16:86340058-86340080 CTGGAGAGGGAGGTGGGGCCAGG - Intergenic
1141851625 16:86650079-86650101 CTGGACATGGAGCTGGTGCCGGG + Intergenic
1141954354 16:87360461-87360483 CTGGAGATGGGGCTGAGGCTAGG - Intronic
1142125655 16:88409035-88409057 GGGGAGATGGGGCTGGGGCTGGG + Intergenic
1142147087 16:88497260-88497282 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1142967022 17:3588107-3588129 CTGGAGCTGGACCAGGGGCTGGG + Intronic
1143235333 17:5394652-5394674 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143462673 17:7114254-7114276 CTGGAGCTGGAGCTGGAGCTGGG + Exonic
1143471121 17:7176938-7176960 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1143830372 17:9645880-9645902 GGGGAGCTGGAGCTGGGGCTGGG - Exonic
1143866073 17:9925156-9925178 CTGGTCAGAGATCTGGGGCTTGG + Intronic
1144357466 17:14459815-14459837 CAAGAGTTAGGGCTGGGGCTGGG - Intergenic
1144599483 17:16599760-16599782 TTGGAGACAGCCCTGGGGCTGGG + Intergenic
1144825048 17:18101030-18101052 CTGGGGATAGGGCAGGGCCTTGG + Intronic
1145306315 17:21677238-21677260 CTGGTGCTGGGGCTGGGGCTTGG - Intergenic
1145866943 17:28247713-28247735 CTGGAGATGGGGCTTGGGCTGGG - Intergenic
1145866946 17:28247719-28247741 CTGGGGCTGGAGATGGGGCTTGG - Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146065315 17:29630444-29630466 GTGGAGATAAAGCTGGGGATTGG - Exonic
1146095863 17:29929951-29929973 CTGGAGGTGGTGCTGGGGGTAGG + Exonic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1146400228 17:32495620-32495642 CTGGAGGAAGGGCTCGGGCTCGG - Intronic
1146845195 17:36178073-36178095 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1146880770 17:36441004-36441026 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1147065976 17:37922951-37922973 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1147110233 17:38256701-38256723 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1147110236 17:38256707-38256729 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1147110239 17:38256713-38256735 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147746614 17:42698823-42698845 CTGGAGTTGGGGCTGGGGCTGGG - Exonic
1147746617 17:42698829-42698851 CTGGGGCTGGAGTTGGGGCTGGG - Exonic
1148380638 17:47194317-47194339 CCAGAGACAGAGCTGAGGCTGGG - Intergenic
1148419273 17:47531718-47531740 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1148623933 17:49054677-49054699 CTGGAGTGAGACCTGGGGCTTGG + Exonic
1148630772 17:49106661-49106683 CAGGGGCTAGGGCTGGGGCTGGG - Intergenic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1148863654 17:50617711-50617733 CTGGAGACAGGGCTGAGGATGGG + Intronic
1149330492 17:55576341-55576363 GTGGAGTTAGGGGTGGGGCTCGG - Intergenic
1149557612 17:57585306-57585328 GTGGAGATAGAGATTGGGCTAGG + Intronic
1149932418 17:60769499-60769521 CTGGGGCTGGAGGTGGGGCTAGG - Intronic
1150009817 17:61493239-61493261 CTGAAGCAAGAGCTGGGTCTGGG + Intergenic
1150454349 17:65294707-65294729 CTGGAGGAAGGGCTGGGGCTGGG + Intergenic
1150496406 17:65611228-65611250 CTGCAGCTAGAACAGGGGCTAGG + Intronic
1150913246 17:69410860-69410882 CTGGAGATAAAGCAGGGCCCAGG + Intergenic
1151073253 17:71241568-71241590 CTGGAAATAAAGCTTGGACTTGG + Intergenic
1151566109 17:74899343-74899365 CCGGAGATGGAGCTGGTACTTGG - Intergenic
1151724310 17:75875680-75875702 CTGGAGCTAGAGGGTGGGCTAGG + Intronic
1151932034 17:77238557-77238579 CCTGGGATGGAGCTGGGGCTGGG + Intergenic
1152430575 17:80246359-80246381 CAGGAGACTGAGCAGGGGCTGGG + Intronic
1152687227 17:81700639-81700661 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1152839299 17:82556560-82556582 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1152839302 17:82556566-82556588 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1152839305 17:82556572-82556594 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1152884274 17:82840191-82840213 CTGGAGACAGCGCTGGGAGTCGG - Exonic
1155087225 18:22470528-22470550 ATGGAGATGGGGCTGAGGCTGGG + Intergenic
1155414384 18:25581627-25581649 AGGGAGATAGAGCTTTGGCTGGG - Intergenic
1156439589 18:37170884-37170906 ATAGAGATAGAGAGGGGGCTAGG + Intronic
1156527384 18:37779352-37779374 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1157555555 18:48610782-48610804 ATGGAAACAGAGCTGGGGCTTGG - Intronic
1157568941 18:48699398-48699420 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1157568944 18:48699404-48699426 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1157568947 18:48699410-48699432 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1160034170 18:75285930-75285952 CTGGAGCTGCAGCTGGTGCTGGG - Exonic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160572398 18:79827182-79827204 ATGGTCATGGAGCTGGGGCTCGG + Intergenic
1160575319 18:79849683-79849705 CTGGAGGCAGAGCGGAGGCTGGG + Intergenic
1160723731 19:608570-608592 CTGGAGATGGACGTGGGGCGGGG + Intronic
1160780896 19:877641-877663 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1160780938 19:877771-877793 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1160781368 19:879123-879145 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1161054206 19:2181769-2181791 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1161054209 19:2181775-2181797 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1161230427 19:3172319-3172341 CTGGAGAGGGATGTGGGGCTCGG - Intergenic
1161680358 19:5676991-5677013 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1161778946 19:6279101-6279123 GTGGAGATAAAGCTTAGGCTGGG + Intronic
1161981837 19:7633977-7633999 AAGGAGACAGAGCTGGAGCTAGG - Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162204763 19:9047382-9047404 TGGGTGATAGAGGTGGGGCTTGG - Intergenic
1162344539 19:10111622-10111644 CTGGGGATGGGGCTGGGGCAGGG + Exonic
1162559947 19:11411298-11411320 CAGGCGATAGAGCTGGGGGAAGG - Intronic
1163019478 19:14474794-14474816 GTGGTGGTAGAGATGGGGCTGGG - Intronic
1163161087 19:15464446-15464468 CTGGAGGCAGAGCTGAGGGTGGG - Intronic
1163176580 19:15568295-15568317 CAGGTGATAGAGCAGGGGATAGG - Intergenic
1163369092 19:16892156-16892178 ATGGGGCTGGAGCTGGGGCTGGG + Exonic
1163631885 19:18421685-18421707 CAGGAAAAGGAGCTGGGGCTGGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163702617 19:18793756-18793778 CTGGTCACAGTGCTGGGGCTTGG + Intergenic
1163711582 19:18850320-18850342 CTGGAGTTAGAGCCACGGCTGGG - Intronic
1163733188 19:18961943-18961965 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1163823107 19:19507573-19507595 CAGGAGCTGGAGCTGGGGCTGGG - Exonic
1164700063 19:30278737-30278759 CTGGAGAGAGAGCAGTGGCAGGG - Intronic
1164984344 19:32637689-32637711 CTGGATCCAGAGCTGCGGCTGGG - Intronic
1165059448 19:33197970-33197992 CAGCAGACAGGGCTGGGGCTAGG - Intronic
1165093798 19:33399967-33399989 CAGGCGGCAGAGCTGGGGCTGGG + Intronic
1165496106 19:36152535-36152557 CTGGGGCTGGGGCTGGGGCTGGG + Exonic
1165699848 19:37929180-37929202 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1165927481 19:39335916-39335938 CTGGGGTTGGGGCTGGGGCTTGG - Intronic
1165943750 19:39428884-39428906 AAGGCGACAGAGCTGGGGCTGGG - Intergenic
1166141287 19:40806705-40806727 CTGGGGCTAGGGCTGGGGCGGGG + Intronic
1166531484 19:43546035-43546057 GAGGAGGTAGGGCTGGGGCTGGG - Exonic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166764842 19:45246547-45246569 CTGGGGCTGGAGCTGGTGCTGGG + Intronic
1167283997 19:48588680-48588702 CTGGAGATAGAGTTAGAGGTGGG + Intronic
1167388420 19:49178415-49178437 CTTGAGCTATAGCTGGGGCCAGG + Intronic
1167558645 19:50211684-50211706 CTTAAGATTGAGATGGGGCTGGG + Intronic
1168071872 19:53958129-53958151 CCCGAGATGGGGCTGGGGCTGGG - Intergenic
1168240421 19:55086418-55086440 CTGGAGGTGGGGCCGGGGCTGGG - Exonic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
1168327092 19:55544023-55544045 TTGGAGACAGAGACGGGGCTTGG + Intronic
1168365258 19:55781148-55781170 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1168708422 19:58482741-58482763 TTGGAGATGGAGCTGGGGGTGGG + Intronic
924963593 2:56837-56859 CTCGAGGCAGAGCTGGGCCTGGG + Intergenic
924963611 2:56899-56921 GGGGAGGTGGAGCTGGGGCTGGG + Intergenic
926104481 2:10141778-10141800 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
926245665 2:11121023-11121045 TTTGAGAGTGAGCTGGGGCTGGG - Intergenic
927712525 2:25334493-25334515 CTGGAGGTATAACTGGGGCCCGG - Intronic
927873691 2:26640391-26640413 CTGGAGATGGGGCTGGGACACGG - Intronic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
928658682 2:33479216-33479238 CTATAGAGAGAGCTTGGGCTTGG - Intronic
929004844 2:37384503-37384525 CTGGAGATGTGGCTGGGGTTTGG + Intergenic
931175070 2:59846234-59846256 CTGGAAGTGGGGCTGGGGCTGGG - Intergenic
931474237 2:62571341-62571363 CTGGAGATGGAGTTGGAGGTGGG - Intergenic
931789213 2:65648482-65648504 CTGGGGACAGAGCTCAGGCTGGG + Intergenic
932589893 2:73059026-73059048 CTGGAGGCAGAGCTGGACCTTGG - Intronic
936082804 2:109446490-109446512 CTGGAGCTAGAGCAGGAGCAGGG + Intronic
937737708 2:125312575-125312597 CTGGGTCTAGAGCTGTGGCTGGG - Intergenic
939090106 2:137770307-137770329 CTGTTGATAGTGCTGGGGCCAGG - Intergenic
941047730 2:160695459-160695481 ATGGAGATGGAGATGGGGATGGG + Intergenic
941846572 2:170140314-170140336 CTGAACATGGAGCAGGGGCTGGG - Intergenic
942299335 2:174547017-174547039 CTAGAGAAAGAGATGGGCCTGGG + Intergenic
942383277 2:175415799-175415821 TTAGAAATAAAGCTGGGGCTGGG - Intergenic
945097026 2:206229914-206229936 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
946142343 2:217702473-217702495 CTAGACATAGAGCTGAGGCCAGG + Intronic
946165108 2:217858959-217858981 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
946239176 2:218343541-218343563 CTGGACACTGTGCTGGGGCTAGG + Exonic
946308225 2:218868211-218868233 CAGGAGGTAGGGCTGGGGCTGGG - Intronic
946323981 2:218973475-218973497 CTTGAGGTTGAGCTGGGGTTTGG + Intergenic
946371859 2:219285964-219285986 CTGGGGAGAGAGCAGGGGCGGGG - Exonic
946372761 2:219290612-219290634 CTGGAGATGGAGGTGGGGATGGG + Intronic
947626533 2:231622668-231622690 CTGGGCCTGGAGCTGGGGCTGGG - Intergenic
947963571 2:234260090-234260112 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948301336 2:236909485-236909507 CTGGAGAGAGAGCAGGGCATCGG + Intergenic
948579469 2:238974608-238974630 CTGGAGAGAGGGGTTGGGCTAGG - Intergenic
948605142 2:239130221-239130243 CTGGGGATGGAGCTGAGGCCAGG + Intronic
948696943 2:239737452-239737474 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697072 2:239737735-239737757 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697084 2:239737758-239737780 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697096 2:239737781-239737803 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697114 2:239737820-239737842 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697132 2:239737859-239737881 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697144 2:239737882-239737904 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697196 2:239737989-239738011 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697206 2:239738007-239738029 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697228 2:239738048-239738070 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697240 2:239738071-239738093 CTGGGGATGGGGCCGGGGCTGGG - Intergenic
948697336 2:239738251-239738273 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
948708526 2:239810757-239810779 TTGGAGCTAGAGCTGGGACCAGG - Intergenic
948887845 2:240892878-240892900 ATGGGGCTGGAGCTGGGGCTGGG + Intronic
948950299 2:241246255-241246277 CTGGGGATAGAAGTGGGGGTGGG + Intronic
949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG + Intergenic
949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG + Intergenic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1168955657 20:1832584-1832606 CCGGAGAGGGAGCTGGGGCTCGG + Intergenic
1169771615 20:9207489-9207511 CTGGAGGTAGAGCTGGGGTGGGG - Intronic
1169802588 20:9525867-9525889 ATGGAGAAAGAGCTGTGTCTGGG - Intronic
1169826714 20:9776746-9776768 CTGAAGATTTAACTGGGGCTTGG - Intronic
1171363971 20:24611151-24611173 CTGGAGAATGTGGTGGGGCTAGG - Intronic
1171518295 20:25756994-25757016 CTGGAGATAGCGCTAATGCTGGG + Intergenic
1171531553 20:25856699-25856721 CTGGTGTTGGGGCTGGGGCTTGG - Intronic
1171532967 20:25864198-25864220 CTGGTGCTGGGGCTGGGGCTTGG - Intronic
1171558562 20:26099212-26099234 CTGGAGATAGCGCTAATGCTGGG - Intergenic
1172100158 20:32480486-32480508 TTTGGGATAGAGCTGGTGCTGGG - Intronic
1172327287 20:34046230-34046252 TTGGAGATAAGACTGGGGCTGGG - Intronic
1172428724 20:34873360-34873382 CTGGAGATGAAGCATGGGCTGGG - Intronic
1172482207 20:35277783-35277805 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1172482210 20:35277789-35277811 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1172482213 20:35277795-35277817 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1172482239 20:35277858-35277880 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1173061560 20:39666696-39666718 CTGGAGATGGGGCTGAGGCTGGG - Intergenic
1173107552 20:40152024-40152046 CAGGACATGGAGCAGGGGCTGGG - Intergenic
1173503048 20:43567244-43567266 TGGGAGATAGAGCTGGGGAAAGG - Intronic
1173569851 20:44068984-44069006 CTGGGGCTGGAGCTGGGGCCGGG - Exonic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1173851773 20:46222968-46222990 GGGGAACTAGAGCTGGGGCTGGG + Intronic
1174386303 20:50190342-50190364 CTGGAGCTAGAGCTGCGGGCTGG + Intergenic
1174411314 20:50338540-50338562 CTGGAGCTACAGGTGGGGTTGGG - Intergenic
1174421151 20:50399925-50399947 CAGGTGAGAGAGGTGGGGCTGGG - Intergenic
1174504555 20:51008823-51008845 CTGGACTTAGACCTGGGGTTGGG + Intronic
1175504428 20:59471415-59471437 CTTGAGCTGGAGATGGGGCTGGG + Intergenic
1175518990 20:59587740-59587762 CTGGGGCTGGAGCCGGGGCTGGG + Intronic
1175518993 20:59587746-59587768 CTGGAGCCGGGGCTGGGGCTGGG + Intronic
1175994338 20:62805393-62805415 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1175994341 20:62805399-62805421 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1175994344 20:62805405-62805427 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1176064465 20:63187511-63187533 CGGGAGAGAGAGCAGAGGCTGGG - Intergenic
1176277300 20:64279657-64279679 CTGGGGATGGGGCTGGTGCTGGG + Intronic
1176707915 21:10128722-10128744 CTGGATATCCACCTGGGGCTTGG + Intergenic
1179039702 21:37791410-37791432 CTGCACATTGAGCTGGGGCCAGG + Intronic
1179876696 21:44272403-44272425 CTGGAGGAAGAGCAGGTGCTGGG + Intergenic
1180109483 21:45641523-45641545 CTGGAGCTGGAGCTGGCGCGAGG - Intergenic
1180143775 21:45908757-45908779 CAGGAGACAGAGCTGGGCTTTGG - Intronic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1180867108 22:19126026-19126048 CTGGGGCTTGGGCTGGGGCTGGG + Intergenic
1180955818 22:19740782-19740804 CTGGAGCCCGAGCTGGGCCTCGG + Intergenic
1181511915 22:23393106-23393128 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1181727874 22:24824198-24824220 CTGGAGACAGAGCTAGGAATGGG + Intronic
1181776044 22:25160825-25160847 CCTGACATAGAGCTGGGGATGGG + Intronic
1181911421 22:26241329-26241351 CTGGAGGCAGAGCTGAGGGTAGG - Intronic
1182416037 22:30222072-30222094 CAGGAGATAAAACTGAGGCTTGG + Intergenic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183096610 22:35555808-35555830 GTGGGGCTAGAGCTGGGGCTGGG - Intergenic
1183271610 22:36865787-36865809 CTGGAGATGGGGTTGGAGCTTGG - Intronic
1183349961 22:37329556-37329578 ATGGAGATGGGGCTGGGGCAGGG + Intergenic
1183436361 22:37797873-37797895 CTTGAGATAGAGGCGGGGGTGGG - Intergenic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1183602187 22:38846225-38846247 CTGGGGATAGAGATGGGCCAAGG - Intergenic
1183667671 22:39254794-39254816 CTGGAGAGAAAGCTGGGCCAAGG - Intergenic
1183942679 22:41304838-41304860 CTGCAGATTGACCTTGGGCTGGG - Intronic
1184147033 22:42617776-42617798 CTGGAGAGGGAGGCGGGGCTAGG - Intergenic
1184602836 22:45553650-45553672 CTGGACAAAGAGCAGGGCCTGGG - Intronic
1184627950 22:45752571-45752593 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1185062865 22:48616098-48616120 CTGGAGCTGGGCCTGGGGCTGGG + Intronic
1185101205 22:48841811-48841833 CTGCAGATGGAGCTGGGGGATGG + Intronic
1185241280 22:49748954-49748976 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1185241283 22:49748960-49748982 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1185241286 22:49748966-49748988 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1185271055 22:49929467-49929489 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
1185388652 22:50547758-50547780 CTGAGGTTGGAGCTGGGGCTGGG - Intergenic
1185388661 22:50547794-50547816 CTGGACTTGGGGCTGGGGCTGGG - Intergenic
1185388686 22:50547869-50547891 CTGGGGTTAGGGCTGGGGATGGG - Intergenic
1185388702 22:50547905-50547927 CTGGAGTTGGAGCTGGGCTTAGG - Intergenic
1185388727 22:50547977-50547999 CTGGAGTTGGAGCTGGGCTTAGG - Intergenic
949499886 3:4669603-4669625 CTGTAGATAGAGCAGAGGTTAGG - Intronic
949953505 3:9248688-9248710 CTGCAGATAGCGCTGGGGCTGGG - Intronic
950525322 3:13519608-13519630 TTGGAGAGACTGCTGGGGCTGGG + Intergenic
952860351 3:37807584-37807606 CGAGAGAGAGATCTGGGGCTGGG + Intronic
952952102 3:38533489-38533511 CGGGAGATAGGGCTGGGACAGGG - Intronic
952962970 3:38604339-38604361 TTGGAGTTAGAGCTCAGGCTGGG + Intronic
953202676 3:40791364-40791386 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
953202679 3:40791370-40791392 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
953202682 3:40791376-40791398 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
953448354 3:42986611-42986633 CTGGAGATGGGGCTGGGGCCAGG + Intronic
953690534 3:45114137-45114159 CTGCTGACAGAGCTGAGGCTGGG - Intronic
953908108 3:46878470-46878492 ATGGAGATAGAGCTCAGTCTGGG + Intronic
953980447 3:47410656-47410678 CTGAGGATGGGGCTGGGGCTGGG - Exonic
954224590 3:49173782-49173804 CTGGAGTTGGAGATGGGGCTGGG - Intronic
954353484 3:50065147-50065169 CTGGACCTAGGGCTGGGGCTGGG + Intronic
954434636 3:50489617-50489639 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
954434639 3:50489623-50489645 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
954434642 3:50489629-50489651 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
954660475 3:52224342-52224364 GTGGAGGTAGAGCTGGGGGCCGG - Intronic
954675260 3:52311994-52312016 CTGGGGAGGGAGCTTGGGCTGGG - Intergenic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
954980622 3:54742121-54742143 CTTCAAATAGTGCTGGGGCTGGG + Intronic
956669288 3:71671332-71671354 CTGCAGAGAGACCAGGGGCTTGG + Intergenic
960047273 3:113210903-113210925 GGGGAGGGAGAGCTGGGGCTGGG - Intergenic
961451213 3:127003139-127003161 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
961451216 3:127003145-127003167 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
961451219 3:127003151-127003173 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
961509473 3:127392111-127392133 CTGGAGCTGGGGCTGGGGCTGGG + Intergenic
961509476 3:127392117-127392139 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
961650014 3:128412647-128412669 CTGGAGGTGCAGCAGGGGCTGGG - Intergenic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
961831557 3:129625573-129625595 CGTGGGGTAGAGCTGGGGCTGGG + Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962993399 3:140601106-140601128 CTGGAGATGCAGCTAGTGCTGGG - Intergenic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
963810463 3:149771824-149771846 CTGGAGCTGGAGCAGAGGCTGGG - Intronic
964010678 3:151887881-151887903 CTGAAGCTGGAGCTGGGGCTGGG + Intergenic
964011579 3:151898490-151898512 CTGAAGCTGGAGCTGGGGCTGGG - Intergenic
964620676 3:158717532-158717554 CTGGAGCTGGAGCTGGGACCCGG + Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
967428168 3:189351280-189351302 CAGGGGTTAGAGATGGGGCTAGG + Intergenic
968676244 4:1882086-1882108 CTGTAGATTGAGTTGGTGCTGGG + Intronic
969236242 4:5866875-5866897 CTGGTGATGGATCTGGGGCGGGG - Intronic
969712513 4:8852080-8852102 TTGGAGCCAGAGCCGGGGCTTGG - Intronic
972553927 4:40162204-40162226 TTAGAAGTAGAGCTGGGGCTGGG + Intergenic
972569015 4:40294187-40294209 ATGGAGATGGAGGTGGGGGTGGG - Intergenic
972654421 4:41051026-41051048 CTGGAGATAGAGGAGGTCCTTGG - Intronic
972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG + Intronic
972764650 4:42141277-42141299 CTCCAAATAGAGCTGAGGCTTGG - Intronic
974297966 4:60028094-60028116 CTAGTGATGGAGATGGGGCTTGG - Intergenic
975021890 4:69501125-69501147 CCGGGGATGGAGCTGGGGGTTGG + Intronic
975217298 4:71770308-71770330 TTGGGGGTAGAGCTGGGACTGGG - Intronic
976647273 4:87399638-87399660 CTTGTGACAGCGCTGGGGCTGGG - Intergenic
976796249 4:88936561-88936583 CTGGTGTTGGAGCTGGGGCCTGG - Intronic
978536780 4:109771009-109771031 CTGGAGAGAGAGTTAGGGGTGGG + Intronic
979552774 4:122009737-122009759 CTGGAGAGAGAGCTGGCCTTCGG + Intergenic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
980158293 4:129132602-129132624 CTGGGGATCAACCTGGGGCTTGG - Intergenic
981548496 4:145918707-145918729 CTGGGGTGAGAGCTGGGGGTGGG - Intronic
982652607 4:158105398-158105420 CTGGAAATAGCCATGGGGCTTGG + Intergenic
983504086 4:168533684-168533706 CTGGAGAGATAGCTGGGCCATGG + Intronic
983528334 4:168783737-168783759 CTGGAGGTAGAGGTGGGGATTGG + Intronic
983567688 4:169171866-169171888 CTGGATCTAGAGGTGGGGCAGGG + Intronic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
984035947 4:174667935-174667957 CTGGTGTTGGAGGTGGGGCTTGG + Intronic
985130634 4:186735100-186735122 CTGAAGGTACAGCTAGGGCTGGG - Intergenic
985664827 5:1176684-1176706 CTGGGGCCAGAGCCGGGGCTGGG - Intergenic
985940418 5:3131395-3131417 ATGGACATAGAGCTGGGAATTGG - Intergenic
986299722 5:6468319-6468341 CTGGAGCTGGAGCAGGGGCGCGG + Intronic
987037578 5:14033452-14033474 CTGTAGATACAGCTGGTCCTGGG - Intergenic
987282881 5:16428141-16428163 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
988738346 5:34044943-34044965 CTGGAGCTGGAGCTGGGGAAAGG + Intronic
991291041 5:65034400-65034422 ACGGAGATAGAGCTGGAGTTTGG - Intergenic
991548225 5:67807292-67807314 CTGGAGATAAAACTGTGGTTTGG + Intergenic
991667575 5:69014519-69014541 TTGAAGACAGAGGTGGGGCTGGG - Intergenic
991946624 5:71904021-71904043 GTGGAGATGGAGGTGGGGGTGGG + Intergenic
993852008 5:93022221-93022243 CTGGAGACAGATGAGGGGCTGGG + Intergenic
994490343 5:100434928-100434950 CTCTAAATAGAGATGGGGCTGGG - Intergenic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
995221381 5:109652604-109652626 TTGGACAGAGAGCAGGGGCTGGG - Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
998137603 5:139682326-139682348 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
998137606 5:139682332-139682354 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
998165226 5:139838842-139838864 CTAGAGACAGAGCTGGGGTGGGG - Intronic
998605618 5:143631809-143631831 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
999317598 5:150594284-150594306 CTTGGGTCAGAGCTGGGGCTTGG + Intergenic
999661132 5:153863857-153863879 CAGGGGCTTGAGCTGGGGCTGGG - Intergenic
1000018758 5:157301067-157301089 CAGGGCATAGAGCTGGGCCTTGG + Intronic
1000358270 5:160421966-160421988 CTGGGGCTGAAGCTGGGGCTGGG + Exonic
1001293967 5:170485790-170485812 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1001477337 5:172059919-172059941 TGGGTGATAGAGCTGGGCCTTGG - Intronic
1002418724 5:179134722-179134744 CTGGAGCTGGAGCTGGAGCCGGG - Intronic
1002614009 5:180439192-180439214 ATGGAGATGGGGCTGGGGCCAGG - Intergenic
1002791704 6:441926-441948 GTGGAGGTTGACCTGGGGCTGGG - Intergenic
1002841655 6:911753-911775 CTGGACCTGCAGCTGGGGCTTGG + Intergenic
1003706337 6:8535487-8535509 CTGGAGATAAACCTTGGGCTAGG - Intergenic
1004370673 6:15049537-15049559 CTGGAGACAGACCAGGGGTTAGG + Intergenic
1004424421 6:15497751-15497773 CTGGAGTTAAAGCAGGGGCCGGG + Intronic
1005367872 6:25097678-25097700 CTGGGTGGAGAGCTGGGGCTGGG - Intergenic
1005452936 6:25991915-25991937 CTGGAGAGGGAGGTGGGGGTGGG - Intergenic
1005670280 6:28098914-28098936 CAGGAGATACAGCTGGGCCAGGG - Intergenic
1006011783 6:31048377-31048399 CAGCAGAGGGAGCTGGGGCTGGG + Intergenic
1006088794 6:31615758-31615780 GTGGAGACAGGGCTGGGGGTAGG + Intronic
1006338029 6:33431229-33431251 CTGGAGCTGGAGCCGGAGCTTGG + Intronic
1006387495 6:33739453-33739475 CTGGAGCTTCAGCTGGGGCTGGG + Intronic
1006445407 6:34077013-34077035 CTGGAGCTGGAGCTGGGGGAGGG + Intronic
1007091211 6:39185934-39185956 CTGAAGAGAGAGGTGGGGCGGGG + Intergenic
1007370852 6:41426511-41426533 CTAGAGCTAGAGCTAGGGCTAGG - Intergenic
1007370854 6:41426517-41426539 CTAGAGCTAGAGCTAGAGCTAGG - Intergenic
1007401690 6:41606143-41606165 CTGGGGACCAAGCTGGGGCTTGG + Intergenic
1007598347 6:43065816-43065838 CTGGAGACAGGGCAGGGGCTGGG + Intronic
1007650467 6:43417267-43417289 GTGTAGCTAGAGCTGGGGCTGGG - Intergenic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1010083056 6:71886607-71886629 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1010309771 6:74371316-74371338 CTGGAGAAAGAGCTAGGACTGGG + Intergenic
1010873742 6:81074824-81074846 CTTGAGAGAGAGCTGGGACTGGG + Intergenic
1011594140 6:88999942-88999964 CAGGAGATACAGCTGGGTCAGGG - Intergenic
1011649430 6:89492180-89492202 CTGGAGAGAGCGCCGGGGCTGGG + Intronic
1012030682 6:94057944-94057966 CAGGAGATAGAGATGAGCCTTGG + Intergenic
1014061596 6:117078228-117078250 CTGGAGGTGAAGGTGGGGCTTGG - Intergenic
1015408893 6:132869689-132869711 CAGGAGTTTGAGATGGGGCTGGG - Intergenic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1015919751 6:138254941-138254963 GTTGAGATGGAGCTAGGGCTAGG - Intronic
1016012234 6:139149331-139149353 CTGCAGATAAAACTTGGGCTTGG - Intronic
1016775071 6:147896349-147896371 CTGGACTCTGAGCTGGGGCTGGG + Intergenic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1017608437 6:156158162-156158184 CAGGAGGGAGGGCTGGGGCTTGG + Intergenic
1018740539 6:166725473-166725495 CTGGAGAAAGAGGCTGGGCTGGG - Intronic
1019386135 7:757244-757266 CTGCAGCTGGGGCTGGGGCTGGG - Intronic
1019404764 7:877527-877549 CTGGGGAGAGAGCCGGGGTTGGG - Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1019780108 7:2934648-2934670 CTGGCGTTAGTGGTGGGGCTTGG + Intronic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1022244645 7:28546883-28546905 GTGTGGATAGAGCTGGGGTTGGG + Intronic
1022536796 7:31103334-31103356 CTCGTGTTTGAGCTGGGGCTGGG + Exonic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023818914 7:43969634-43969656 CAGGAGGTAGAGGTGGGGCGAGG + Intergenic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024202209 7:47118970-47118992 CTGGGGTTGGGGCTGGGGCTGGG - Intergenic
1025284262 7:57649672-57649694 CTGGGGCTGGGGCTGGGGCTTGG - Intergenic
1026045227 7:66902286-66902308 CTGAAGCAAGAGCTGGGTCTGGG - Intergenic
1026078267 7:67193408-67193430 CTGATGACAGAGCTGGGACTTGG - Intronic
1026170500 7:67949758-67949780 CTGGAGTGAGAACTGAGGCTGGG - Intergenic
1026451323 7:70532031-70532053 CTGGGGATGGTGCTGGGACTTGG + Intronic
1026698553 7:72618563-72618585 CTGATGACAGAGCTGGGACTTGG + Intronic
1027532480 7:79353623-79353645 CTGGAGATACAGCTGAGATTGGG + Intronic
1029459027 7:100684961-100684983 ATGGAGCTTGAGCTGGGGCCGGG + Intronic
1029604257 7:101589159-101589181 CTGGAGAGAGAGCATGGGCTGGG + Intergenic
1029728970 7:102426829-102426851 CTGGGGAGGGTGCTGGGGCTTGG + Intergenic
1029743964 7:102506597-102506619 CAGGAGGTAGAGGTGGGGCGAGG + Intronic
1029761953 7:102605760-102605782 CAGGAGGTAGAGGTGGGGCGAGG + Intronic
1030106132 7:105989098-105989120 ATGCAGGTAGAGCCGGGGCTTGG + Intronic
1030138757 7:106284722-106284744 CTGGGGTTGGGGCTGGGGCTGGG - Intronic
1031010916 7:116525179-116525201 GTGGAGAGAGGGCTGGGGCCAGG - Intronic
1032076580 7:128838864-128838886 CAGGAGGAAGAGCTGGGGCGGGG + Intronic
1032165441 7:129541348-129541370 CTGGAGAAAGGGCTGTGGCCTGG + Intergenic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1032542503 7:132715036-132715058 CAGGAGAAAGGGCTGGGGGTGGG - Intronic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1033194080 7:139311902-139311924 GTGGAGACAGAGCTGGATCTTGG - Intergenic
1034163915 7:149011687-149011709 CTGGGGTTGGAGTTGGGGCTGGG - Intronic
1034257023 7:149730248-149730270 CTGGAGCCGGGGCTGGGGCTGGG - Exonic
1034257026 7:149730254-149730276 CTCGAGCTGGAGCCGGGGCTGGG - Exonic
1034424457 7:151007287-151007309 CAGGAGTCAGAGCAGGGGCTGGG - Intronic
1034561263 7:151880827-151880849 CTGGAGCTGGGGCTGGGGCTGGG + Intergenic
1034561266 7:151880833-151880855 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1034561284 7:151880875-151880897 CTGGGGCTGGATCTGGGGCTGGG + Intergenic
1034830646 7:154305020-154305042 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1034830649 7:154305026-154305048 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1034830652 7:154305032-154305054 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1034830655 7:154305038-154305060 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1034830658 7:154305044-154305066 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1034830661 7:154305050-154305072 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1034830664 7:154305056-154305078 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1034830667 7:154305062-154305084 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1034918858 7:155062369-155062391 CTGGAGAAAGAGCTAGGGAAGGG + Intergenic
1034979653 7:155467839-155467861 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1035291842 7:157844319-157844341 CTGGGGATGGGGCTGGGGCCTGG - Intronic
1036413724 8:8527333-8527355 CTGGGGTTAGAGGTGGGGGTGGG - Intergenic
1036643402 8:10597923-10597945 CCGGAGGTAGGGCTTGGGCTAGG - Intergenic
1037803051 8:22045403-22045425 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1037803054 8:22045409-22045431 CTGGAGCTGGGGCTGGGGCTGGG - Intronic
1038598223 8:28910051-28910073 CTGGAGCTGGGGTTGGGGCTAGG - Intronic
1038713138 8:29967189-29967211 CAGGAGGAAGAGCTGGGGCGTGG + Intergenic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1039976785 8:42373429-42373451 TTGGAGAGAGAGATGTGGCTCGG + Intergenic
1040081489 8:43290579-43290601 CTGGGGTTGGAGCTGTGGCTGGG + Intergenic
1041502480 8:58553559-58553581 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1041502483 8:58553565-58553587 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1042210902 8:66379277-66379299 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1043075821 8:75698229-75698251 CTGGAGACTTGGCTGGGGCTGGG + Intergenic
1043251766 8:78083777-78083799 CTGGAGTTAAAGCAGTGGCTGGG + Intergenic
1043348846 8:79334497-79334519 CTGGAGCAAGAGCTGTGGCTGGG + Intergenic
1043577813 8:81678191-81678213 ATGGGGATGGGGCTGGGGCTGGG - Intronic
1044241430 8:89892966-89892988 CTGGAGCTAGAGCTTGGAATGGG - Intergenic
1044341497 8:91050992-91051014 CTGGACATAGATCTTGGGCTTGG + Intergenic
1045363523 8:101454500-101454522 CTGGAGTTGGAGGTGGGGATGGG - Intergenic
1047820172 8:128510704-128510726 CTGGAGATGAAGCAGGGGCCTGG - Intergenic
1048637472 8:136313012-136313034 CTAGTGATAGAGCTGGCCCTAGG - Intergenic
1049164099 8:141116137-141116159 CTGGGGATGGAGCTGGGGGCTGG - Intergenic
1049532062 8:143159824-143159846 CTGGAGAAGGGGCTGGGGGTGGG - Intronic
1051326748 9:15980381-15980403 CTGGAGAGATCACTGGGGCTAGG - Intronic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1053310597 9:37016225-37016247 CTGGAGATTGTGCTAGGGCTTGG - Intronic
1053410233 9:37911588-37911610 CAGGGGCTGGAGCTGGGGCTGGG - Intronic
1053760872 9:41349394-41349416 CTGGATATCCACCTGGGGCTTGG - Intergenic
1053785034 9:41647263-41647285 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1053785037 9:41647269-41647291 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1054160357 9:61668666-61668688 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1054161548 9:61674955-61674977 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1054172637 9:61855675-61855697 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054173764 9:61861220-61861242 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1054447488 9:65384686-65384708 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054448615 9:65390273-65390295 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1054448618 9:65390279-65390301 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1054448621 9:65390285-65390307 CTGGGGCTGGGGCTGGGGCTGGG - Intergenic
1054663776 9:67719561-67719583 CTGGGGCTGGGGCTGGGGCTGGG + Intergenic
1054664903 9:67725126-67725148 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
1055385159 9:75753676-75753698 CTGGGTTTAGAGCTGGGGCTGGG + Intergenic
1056455757 9:86757684-86757706 CTGGAGAAAGACCTGGGGAGGGG + Intergenic
1057165431 9:92921598-92921620 CTGGGGGTAGAACTGTGGCTTGG - Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1057480531 9:95441853-95441875 CTGGTGATTGAACTGGGGTTTGG + Intergenic
1057687672 9:97250353-97250375 TTGAAGAGTGAGCTGGGGCTGGG + Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059269127 9:113061204-113061226 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059270263 9:113066653-113066675 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059271399 9:113072103-113072125 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059272530 9:113077547-113077569 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059273665 9:113082989-113083011 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059274801 9:113088435-113088457 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059335157 9:113564534-113564556 CTGGAGCTGGAACTGGAGCTGGG + Intronic
1060214687 9:121731671-121731693 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1061007185 9:127934960-127934982 CTGGGGATAAAGCAGGGACTGGG - Intergenic
1061222327 9:129259309-129259331 CTGGCGATGGGGATGGGGCTGGG - Intergenic
1061252014 9:129431999-129432021 CTGGGCCTGGAGCTGGGGCTAGG + Intergenic
1061320124 9:129823492-129823514 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1061320264 9:129823861-129823883 CTGGGGCTGGGGCTGGGGCTGGG - Intronic
1061589802 9:131591005-131591027 ATGGTCATAGAGCTAGGGCTAGG + Intronic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1061725160 9:132578576-132578598 GTGGAGAAGGAGGTGGGGCTAGG + Intergenic
1062522532 9:136964172-136964194 CTGGAGGTGGTTCTGGGGCTTGG + Intergenic
1062686664 9:137817150-137817172 ATGGGGACAGAGCTGGGCCTGGG - Intronic
1062694282 9:137865211-137865233 CTGGACACAGAGAGGGGGCTGGG + Intronic
1202792660 9_KI270719v1_random:97602-97624 CTGGATATCCACCTGGGGCTTGG + Intergenic
1185527915 X:793922-793944 ATGGAGATTTAGCTGGGGGTGGG - Intergenic
1185765932 X:2725906-2725928 ATGGAAAGAGAGCTGGGGCTGGG - Intronic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187413368 X:19070399-19070421 CTGGAGGTGGGGCAGGGGCTAGG + Intronic
1187433547 X:19246772-19246794 GTGGAGAAAGAGCTGGGTCAGGG - Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189474061 X:41335121-41335143 CTGGAGATAGAGGTTGGACGTGG + Intronic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1190304113 X:49072770-49072792 CTGGAGATAGGGCTGGTGGGAGG - Intronic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1190938278 X:55015780-55015802 TTGGAGATGGAGCTGGGGAAGGG - Intronic
1191659594 X:63635979-63636001 CTGGGGAGAGGGCCGGGGCTCGG - Exonic
1192144929 X:68675687-68675709 GTGGAGGTGGAGCTGGAGCTAGG - Intronic
1192203665 X:69082575-69082597 CTGGGGCTGGGGCTGGGGCTTGG - Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1194128616 X:90051175-90051197 CAGGAGATAGAGCTGGGCCAGGG - Intergenic
1195094694 X:101492419-101492441 CTTGGGCTGGAGCTGGGGCTGGG + Exonic
1195095116 X:101494093-101494115 CTGGGGCTGGGGCTGGGGCTGGG + Exonic
1195621980 X:106966203-106966225 CTAGAGAAAAAGCTGAGGCTGGG + Intronic
1195668918 X:107452903-107452925 CTGGAGATGGGGGTGGGGGTGGG + Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1198107850 X:133477918-133477940 CTGGGAATTGAGCTGGGCCTGGG + Intergenic
1198411320 X:136372353-136372375 CTGGTGAGAGAAATGGGGCTAGG - Intronic
1199855140 X:151753603-151753625 GTGGAGATTGAGCAAGGGCTTGG - Intergenic
1200141585 X:153905329-153905351 CTGGGGCTGGGGCTGGGGCTGGG + Intronic
1200182076 X:154156687-154156709 CTGGAGCTCTGGCTGGGGCTGGG - Intronic
1200219246 X:154382954-154382976 GTGGAGGCAGGGCTGGGGCTGGG + Intergenic
1200274295 X:154717368-154717390 CTGGAGATGGAGTGGGGGGTGGG + Intronic
1200972466 Y:9167909-9167931 CTGGTGAGAGAGCTTGGGCTTGG + Intergenic
1202138551 Y:21696341-21696363 CTGGTGGAAGAGCTTGGGCTTGG - Intergenic