ID: 1145899570

View in Genome Browser
Species Human (GRCh38)
Location 17:28481505-28481527
Sequence CTAACTAGAAGCAGCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145899564_1145899570 15 Left 1145899564 17:28481467-28481489 CCAGTGCATGCTGTTGGGCACAG 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1145899570 17:28481505-28481527 CTAACTAGAAGCAGCACCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145899570 Original CRISPR CTAACTAGAAGCAGCACCCC AGG Intronic
902354414 1:15886784-15886806 CTAACTAAAAGCAACGCTCCTGG - Intronic
909925211 1:81430422-81430444 CTAACTGGAAACAGATCCCCTGG - Intronic
917621434 1:176800687-176800709 CTGAGTAGCAGCTGCACCCCAGG + Intronic
1068876145 10:61998926-61998948 TTAACATGAAGCAGAACCCCTGG - Intronic
1073025064 10:100481837-100481859 CCAATTAGAAACAGCAGCCCAGG + Intronic
1073364304 10:102925426-102925448 CTAACCATAAGAAGTACCCCAGG - Intronic
1074426622 10:113357132-113357154 CTAACTTGCAACAGCTCCCCTGG + Intergenic
1074599617 10:114900475-114900497 CCAAGTTGAAGCACCACCCCAGG - Intergenic
1079374904 11:19883167-19883189 CTATCTAGGTTCAGCACCCCTGG + Intronic
1080692129 11:34566959-34566981 CTAACTAGAAGCGTCACACTGGG - Intergenic
1082987592 11:59181874-59181896 CCTATGAGAAGCAGCACCCCTGG + Exonic
1086375554 11:86196411-86196433 CTGAGTAGCAGCAGCACCCAAGG - Intergenic
1086948527 11:92867685-92867707 CTTACTAGAAGCTGTCCCCCAGG + Intronic
1088820570 11:113453039-113453061 CTAACAAGATGCAGAACCCCAGG - Intronic
1088997551 11:115014832-115014854 CTAAGGAGAAGCAGAACGCCAGG + Intergenic
1095547487 12:43388713-43388735 CTAACTATAGGCAGCACCTCAGG - Intronic
1097913796 12:64998824-64998846 CTACATAGAAGCAGCATCCTAGG - Intergenic
1102457080 12:113077559-113077581 CCTACGAGAAGCAGCACCCGTGG + Exonic
1105564565 13:21531469-21531491 CTGAGTAGCAGCAGCACCCAAGG - Intronic
1105642571 13:22280790-22280812 CTAACAAGAAAGAGAACCCCAGG + Intergenic
1110095347 13:71511924-71511946 ATTACTAGAAGCAGGACCCAAGG - Intronic
1110320139 13:74151966-74151988 CTAAAGAGTAGCAGCACTCCTGG + Intergenic
1113240093 13:108327869-108327891 GTAAGCAGAAGCAGAACCCCCGG - Intergenic
1113415313 13:110124366-110124388 CTAACAAGAGACAGCCCCCCAGG + Intergenic
1117333680 14:54738382-54738404 CTGACAAGAAGCTGCTCCCCTGG + Intronic
1122599063 14:102912354-102912376 GGACCTAGGAGCAGCACCCCAGG + Intergenic
1125396999 15:39259919-39259941 CTTGCTAAAAGTAGCACCCCAGG + Intergenic
1130949185 15:88572022-88572044 CTAAATTGGAGCAGCAGCCCAGG + Intergenic
1131995381 15:98127910-98127932 CTAATTATGAGCAGGACCCCGGG - Intergenic
1135501310 16:22998340-22998362 CTAATGACAACCAGCACCCCTGG - Intergenic
1145899570 17:28481505-28481527 CTAACTAGAAGCAGCACCCCAGG + Intronic
1146660454 17:34662169-34662191 CTACCTAGAAGCAGCAGTGCTGG - Intergenic
1146746865 17:35338620-35338642 CTGACTAGAATCAGAACCACAGG - Intergenic
1147478583 17:40737669-40737691 CTAATTCGAAGCAGCACCTAAGG - Intergenic
1149026207 17:52030367-52030389 GTAACCAGAAGCAGCACCCATGG + Intronic
1150930281 17:69577340-69577362 CTAAGTAGAAGCAACAACACGGG - Intergenic
1157411163 18:47464700-47464722 ATCACTAGGAGCAGGACCCCAGG - Intergenic
1159353032 18:67299652-67299674 CTAGGCAGCAGCAGCACCCCAGG - Intergenic
1165149971 19:33754405-33754427 CTCTCTAGAAGAAGCACACCAGG + Intronic
1165333900 19:35155799-35155821 CTCACTGGAAGCAGCCACCCGGG - Intronic
1166041542 19:40205826-40205848 CCAACCAGACGCAGCAGCCCTGG + Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1168639582 19:58021754-58021776 GTAACTAGAATCCGAACCCCAGG - Intergenic
925914583 2:8595648-8595670 CTGAGCAGAAGCAGCAGCCCAGG + Intergenic
927330485 2:21857020-21857042 CTAACTAAATGCATAACCCCAGG + Intergenic
927986038 2:27411039-27411061 CTAACTAGTAGCAGTGCCCCAGG - Intergenic
946515949 2:220411958-220411980 TTAGGTAGAAGCAGGACCCCTGG + Intergenic
947698331 2:232211469-232211491 AAAACTAGAAGCAGCACATCTGG - Intronic
1168957464 20:1844461-1844483 CTTACCAGATGCAGCCCCCCTGG + Intergenic
1169181614 20:3574169-3574191 TTAACTTGGAGCAGCATCCCAGG - Intronic
1170095577 20:12642415-12642437 CTGCCCAGAAGCAGCAGCCCTGG - Intergenic
1173794517 20:45849906-45849928 CTAACTAGAAGCATGACACCTGG + Intronic
1174513259 20:51071977-51071999 CTAACTATAAGCATCAGCCTGGG + Intergenic
1175395412 20:58655670-58655692 AGAACTAAAAGCAGGACCCCAGG - Intronic
1177912030 21:27044473-27044495 CTAACCTGCAGCAGCATCCCAGG - Intergenic
1179173215 21:38989179-38989201 CAAATTATAAGCAGCACCTCAGG - Intergenic
950631407 3:14284517-14284539 CAAATTTGAAGGAGCACCCCAGG + Intergenic
950663369 3:14480767-14480789 CTGACTAGAAGCAGAAGCCCCGG + Intronic
957350640 3:79018970-79018992 CAAAGTAGAAGCAGCAGCTCCGG + Intronic
960281135 3:115783074-115783096 ATTACTTGAAGCTGCACCCCTGG - Intergenic
965612999 3:170564453-170564475 CTAACTAGCAGCATGACCCTGGG - Intronic
965907879 3:173732414-173732436 CTAACTAGTAGCAGCATCTTAGG - Intronic
971342554 4:25783903-25783925 ATAACAAGCAGCAGGACCCCTGG - Intronic
972356914 4:38288069-38288091 CCAACTAGAAGCAGAACCTTAGG - Intergenic
972726851 4:41752038-41752060 CCAAGCAGAAGCAGGACCCCGGG - Intergenic
982202170 4:152971815-152971837 CTGACTTGGATCAGCACCCCGGG + Intronic
989358067 5:40567109-40567131 CCAACTAGCTGCAGCATCCCAGG + Intergenic
990203203 5:53400520-53400542 CTAATGAGAACCACCACCCCTGG - Intergenic
991540927 5:67727252-67727274 CTAACTATAAGCATCACCTGGGG + Intergenic
995321365 5:110837857-110837879 CTTACTGGAAGCAGCAGCCCAGG - Intergenic
997837053 5:137203506-137203528 GTAATTAGAAGCAGCTCCCTGGG - Intronic
997967695 5:138372696-138372718 GTAACTGGAAGCAACACTCCTGG + Exonic
998139426 5:139691472-139691494 TGAACTAGAAGGAGCACTCCTGG + Intergenic
998662377 5:144254209-144254231 CTCACTGGAAGCTCCACCCCCGG + Intronic
1003003791 6:2361848-2361870 CAAAATAGAAGCAGCAGCCTGGG + Intergenic
1003079748 6:3012401-3012423 CTGACCAGAAGCTGCACCCTGGG - Intronic
1019877891 7:3831294-3831316 GTAACTAAAAGCTGAACCCCAGG - Intronic
1020220401 7:6232280-6232302 GCAACTACAAGAAGCACCCCGGG + Intronic
1022618349 7:31955616-31955638 GTAACTAGTTGCAGCACTCCAGG + Intronic
1023851597 7:44153228-44153250 CTAGCTGGGAGAAGCACCCCAGG - Intronic
1026460975 7:70614895-70614917 CTAACCTGCACCAGCACCCCAGG + Intronic
1030110626 7:106023567-106023589 CCTAGTAGAAGCTGCACCCCTGG + Intronic
1031642982 7:124188723-124188745 CTAATGAGAAGAAGCACCCCAGG - Intergenic
1034191750 7:149218450-149218472 CAAACTAGAACCAGCAACACAGG - Intronic
1038217357 8:25574482-25574504 TTAAGTGGAAGCAGAACCCCAGG - Intergenic
1039053393 8:33514690-33514712 CTAAATGGAAGCAGCTCCTCGGG - Intergenic
1040058680 8:43085425-43085447 CTGAGTAGCAGCAGCACCCAAGG - Exonic
1048408211 8:134144154-134144176 CTTACTAGAAGAAGCAAGCCTGG + Intergenic
1049741037 8:144241020-144241042 CTTACTTGAAGCAGCACCCAGGG - Exonic
1054740976 9:68805381-68805403 CTCACCAGAAGGAGCACCACAGG - Intronic
1058621070 9:106883760-106883782 CTACCTGGAATCAGCAGCCCTGG + Intronic
1060898755 9:127238849-127238871 TTGACTAGAAGCAGCTCTCCTGG + Intronic
1190336658 X:49266823-49266845 ATCACTAGAATCAGCTCCCCAGG - Intergenic
1194487597 X:94505117-94505139 CCAACTTGAGGCTGCACCCCAGG + Intergenic
1195564572 X:106325927-106325949 CAAACAAGAAGCAGCAACCAGGG + Intergenic
1201576910 Y:15470597-15470619 CTAACTACAAGCAGAAACCTTGG + Intergenic
1201944492 Y:19497084-19497106 CTAACATTAAGCAGCACCCATGG - Intergenic