ID: 1145901383

View in Genome Browser
Species Human (GRCh38)
Location 17:28492589-28492611
Sequence CTGGAGAAGTAGGCAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1024
Summary {0: 1, 1: 0, 2: 9, 3: 93, 4: 921}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145901383 Original CRISPR CTGGAGAAGTAGGCAGGGGA AGG Intronic
900086424 1:899997-900019 CTGGGCAAGTAAGCAGGGGGTGG + Intergenic
900159159 1:1215350-1215372 CTGGAGAGGGAGGGAGTGGAGGG + Intergenic
900287008 1:1906670-1906692 GTGGAGAAGCAGGCATGGGGAGG + Intergenic
900422113 1:2560157-2560179 CAGGTGATGGAGGCAGGGGAAGG + Intronic
900512357 1:3066708-3066730 CTGGAGGAGGAGGCAGGGAGAGG + Intergenic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900919773 1:5662783-5662805 CAGGGGCAGGAGGCAGGGGAGGG + Intergenic
901193437 1:7426049-7426071 CTGGAAAAGGTGGCAGGGTAGGG + Intronic
901483247 1:9540087-9540109 CAGGAGAAGGGGGCGGGGGAGGG - Intronic
901520209 1:9777970-9777992 GGGGAGAAGACGGCAGGGGAGGG + Intronic
901861858 1:12079562-12079584 GTGGAGAAGGAGGCAAGGGCCGG - Intronic
902232360 1:15036205-15036227 GGGGAGAGGTAGGCAGGGTAGGG - Intronic
903142936 1:21350558-21350580 CTGAAGAGGCTGGCAGGGGAGGG + Intergenic
903537307 1:24075535-24075557 CTGGAGGTTTAAGCAGGGGAGGG - Intronic
903673567 1:25050855-25050877 CTGGAGAGGTAGGCAAGGGCTGG - Intergenic
903771880 1:25769507-25769529 CTGGAGGGGCACGCAGGGGAGGG - Intronic
903817570 1:26075950-26075972 CTGGAGCAGTTGGCAGAGGCAGG + Intergenic
903819926 1:26094351-26094373 GTGGAGAGGTGGGGAGGGGAGGG - Intergenic
903947941 1:26975739-26975761 CTGGAGCTCAAGGCAGGGGATGG - Intergenic
904263717 1:29305753-29305775 CTGAAGAGGTAGGCAGGGGCTGG + Intronic
904424799 1:30416406-30416428 CTGGAGTAGGAGGCAGAGGTGGG - Intergenic
904446528 1:30577446-30577468 CTGGGCAATTAGGCAGGAGAAGG - Intergenic
904877565 1:33668192-33668214 CAGGAGAGGTAGGCAGGGGCAGG + Intronic
905017972 1:34790728-34790750 CTGGAGAAGTGGCCAGGGACTGG + Intronic
905223952 1:36467312-36467334 CTGGAGAAGGGGGCAGGTGGAGG + Intronic
905492138 1:38352986-38353008 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
905738202 1:40345789-40345811 CTGGAGGAGAAAGGAGGGGAAGG + Intronic
906107684 1:43304696-43304718 CTGAAGAACCGGGCAGGGGAAGG + Intronic
906805047 1:48772550-48772572 CTGGAGAAGTAAGGTGGGGCTGG + Intronic
906848263 1:49218451-49218473 CTGGAGAAGTAGTCAGAAAATGG + Intronic
907145122 1:52224306-52224328 GTGGAGGGGTAGGGAGGGGAAGG + Intronic
907145134 1:52224348-52224370 GTGGAGGGGTAGGCAGGGGAAGG + Intronic
907257230 1:53188954-53188976 TTGGAGCAGTTGGCAGGGGTAGG + Intergenic
907306704 1:53517350-53517372 CTGGGGAGGTAGGCAGTGGCTGG - Intronic
907640826 1:56188613-56188635 CTGGTGAAGTAGGGAGTGGGTGG + Intergenic
907760310 1:57351589-57351611 TTGCAGATGTAGGCAGGGAAGGG + Intronic
908262470 1:62349561-62349583 GGGGAGAAGTGGGGAGGGGAGGG + Intergenic
908353160 1:63306231-63306253 GAGGAGAAGGAGGAAGGGGAAGG + Intergenic
908583795 1:65546802-65546824 CAGGACAATTAGGCAGGAGAAGG - Intronic
908792699 1:67798576-67798598 GAGGAGAAGGAGGAAGGGGAGGG - Intronic
908893939 1:68877775-68877797 CAGGGCAATTAGGCAGGGGAAGG - Intergenic
909125885 1:71668820-71668842 ATGGAGAGCTAGGCAGGGAATGG + Intronic
909675022 1:78229266-78229288 CTGTAGAAGTAGGTAAGGAAAGG + Intergenic
910664559 1:89710162-89710184 CTTGGGAAGTAGGCAGAGGGAGG - Intronic
910725691 1:90336320-90336342 CAGAAGAAGTAGGCAGGGTCAGG + Intergenic
910885148 1:91956315-91956337 CAGGAAAAGCAGGCAGGGGGTGG - Intronic
912208511 1:107533929-107533951 GTGGAGAAGTAGGCAGAAAATGG - Intergenic
912379994 1:109242191-109242213 CTGGAGATGTGGGCAGGGTCAGG + Intergenic
912466701 1:109879632-109879654 CTTGTGAAGTAGGCCGGGCATGG + Intergenic
912496198 1:110093725-110093747 CTGCTGAGGTAGGCAGGGTAGGG - Intergenic
912587256 1:110778361-110778383 CTGAAGAGGTAGGCAGGAGGTGG + Intergenic
912747091 1:112253963-112253985 CTGGTGATGGAGTCAGGGGACGG - Intergenic
912798969 1:112709372-112709394 CTGGAGAAGGAAGCAGTGGCTGG + Intronic
914712258 1:150225371-150225393 CTGGAGGAGAAAGCAGGGGCCGG + Intronic
915115985 1:153599837-153599859 CTGGAACAGAAGGCAGGAGAGGG - Intergenic
915216471 1:154343887-154343909 CTCCAGGAGTACGCAGGGGAAGG + Exonic
915465110 1:156092795-156092817 CTGGAGAGGTGGGCAGGAGCTGG - Intronic
915472367 1:156133674-156133696 CTGGGTCAGTAGGCAGGGGCTGG - Intronic
916978607 1:170109473-170109495 CAGGGCAATTAGGCAGGGGAAGG - Intergenic
916990203 1:170235247-170235269 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
917517236 1:175718446-175718468 CTGGAGACCTGGGTAGGGGAAGG + Intronic
918011432 1:180590561-180590583 ATAGAGAGGTAGGCAGGGGCTGG + Intergenic
918067438 1:181110850-181110872 CAGTAAAAGTAGGCAGGGAATGG - Intergenic
919440497 1:197627676-197627698 CAGGGCAATTAGGCAGGGGAAGG + Intronic
919750896 1:201037526-201037548 CCTGAGAAGTAGGCAGGCCAAGG + Intergenic
919759986 1:201091793-201091815 CTGCAGAGGCAGGCAGGGAAGGG + Intronic
919913078 1:202123777-202123799 CAAGAGAAGTAGGCAGGCCAGGG + Intronic
919978875 1:202630113-202630135 CTGGAGGGGCAGGCAGGGGCTGG + Intronic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920122452 1:203668887-203668909 GGGGAGAAGGAGGTAGGGGAAGG + Intronic
920195403 1:204223193-204223215 CTCCAGAAGCAGGCAGGGAATGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921301491 1:213755357-213755379 ATGGAGAAGGAAGCAGGGAAAGG + Intergenic
921380287 1:214517638-214517660 CAGGAGGAGTAGGGAGGGAAAGG + Intronic
921808010 1:219478094-219478116 CTGGAGAATGAGGGTGGGGAGGG + Intergenic
922225257 1:223640485-223640507 CTGGACAAGAAGGCAGGTGGTGG - Intronic
922599914 1:226842659-226842681 ATGGAAAAGTAGGCCGGGCATGG - Intergenic
923690967 1:236192462-236192484 CTGGAGAGGTAGGCACCAGAGGG + Intronic
924631316 1:245743395-245743417 TTGGAGAAGGGGGCAAGGGATGG - Intergenic
1062812677 10:478091-478113 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812685 10:478111-478133 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812702 10:478151-478173 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812759 10:478286-478308 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812770 10:478311-478333 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812778 10:478331-478353 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812789 10:478356-478378 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062984289 10:1753169-1753191 CCACAGAAGTAGGCAGGGTAGGG + Intergenic
1063132833 10:3193427-3193449 CTGGGGCAGGAGGCAGAGGAAGG - Intergenic
1063857883 10:10275069-10275091 CTGGAGAAGTGGACAGGGAGAGG - Intergenic
1063908228 10:10802569-10802591 CAGGAGAATTAAGCAGGGAATGG + Intergenic
1064124813 10:12650659-12650681 CGGGTGGAGTGGGCAGGGGAGGG - Intronic
1064198309 10:13263499-13263521 CTGGAGAAGCGGGCAGCAGAGGG - Intergenic
1064262718 10:13798939-13798961 CTGGGGAAGAAGGAAGGGAAAGG - Intronic
1064457086 10:15497829-15497851 TTGGAGAAGGAGGGAGTGGATGG + Intergenic
1064622660 10:17230350-17230372 CGGGAGAAGGAAGGAGGGGAAGG + Intronic
1064672361 10:17729678-17729700 CTGTAGAAGTGGGCATAGGAAGG + Intergenic
1064785976 10:18894755-18894777 CTGGGGAGGGTGGCAGGGGAAGG + Intergenic
1065865631 10:29912831-29912853 CTGGAGCAGGAGGAAGGGGCTGG - Intergenic
1066440710 10:35436076-35436098 CTGGAGAGTTGGGCAGGGGTGGG + Intronic
1067247946 10:44561819-44561841 CTGCAGCAGTCAGCAGGGGAAGG - Intergenic
1067450020 10:46376370-46376392 CTGGGGAAGCAGGCAGGGCCAGG + Intronic
1067587225 10:47483393-47483415 CTGGGGAAGCAGGCAGGGCCAGG - Intronic
1067634282 10:47991160-47991182 CTGGGGAAGCAGGCAGGGCCAGG - Intergenic
1067701962 10:48580283-48580305 CTGGAAAACGTGGCAGGGGAGGG + Intronic
1068765033 10:60753478-60753500 CTGGAGCAGGAGGCAGTGGAAGG - Intergenic
1069293629 10:66815314-66815336 CTGGGGATGAAGGGAGGGGATGG - Intronic
1070306090 10:75240009-75240031 CAGGTGAAGTAAGCAGGGCAAGG + Intergenic
1070478135 10:76850361-76850383 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1070530338 10:77331446-77331468 CTGAAGAGGAAGGCAGTGGAGGG + Intronic
1070688238 10:78505668-78505690 CTGGAGAAGGAGACAGGGCAGGG + Intergenic
1070711667 10:78687438-78687460 CTGGAGATGGAGGAAGGGAAAGG + Intergenic
1070806290 10:79272962-79272984 CTGGAGAGGATGACAGGGGATGG + Intronic
1070855162 10:79602903-79602925 CTGGAAAAGGGGGCAGGGGAAGG + Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071411503 10:85401454-85401476 CTGAAGGAGGAGCCAGGGGAAGG + Intergenic
1071777934 10:88810000-88810022 ATGGAAAAGTAAGCAGGGTAAGG - Intronic
1072437120 10:95423982-95424004 CTGGAGCAGAAGGCAAGGTAGGG + Intronic
1073209157 10:101784291-101784313 CTGGTGATGGAGGTAGGGGAGGG + Intergenic
1073265518 10:102226141-102226163 CTGGGGAAGTGGGCGGGCGATGG + Intergenic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073684746 10:105739855-105739877 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1073768415 10:106708769-106708791 GTGGAGAAGCAGGAATGGGAAGG - Intronic
1073975475 10:109095925-109095947 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074303571 10:112255045-112255067 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
1074458423 10:113615128-113615150 CTTTGGAGGTAGGCAGGGGATGG + Intronic
1074566521 10:114583969-114583991 GTGGGGAAGCAGGCAGGGAAAGG + Intronic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1075139246 10:119816730-119816752 CTGGAGAGCCAGGCAGCGGAAGG + Intronic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1075652021 10:124133561-124133583 CTGGTGTAGTGGGAAGGGGAGGG + Intergenic
1075683911 10:124350857-124350879 CTGGAGGAGGAGACATGGGAGGG - Intergenic
1076209961 10:128632439-128632461 ATGCAGGAGTGGGCAGGGGAGGG + Intergenic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076566436 10:131402795-131402817 CTGGGATAGGAGGCAGGGGATGG + Intergenic
1076668950 10:132108612-132108634 CAGGTGAATGAGGCAGGGGAGGG - Intronic
1076721196 10:132394133-132394155 CTGGAGGAGGAAGCAGGGGCTGG - Intergenic
1077161396 11:1114213-1114235 GTGGAGACGGAGGCAGGGCATGG - Intergenic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077530519 11:3092737-3092759 CTGGAGGAGTCGGTGGGGGAGGG - Intronic
1077649394 11:3956386-3956408 CTGGAAAAGTAGGAAGGTTAGGG + Intronic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1078359996 11:10660751-10660773 CAGGAGGAGTGGGCTGGGGAGGG - Intronic
1078810670 11:14758761-14758783 CAGGACAATTAGGCAGGAGAAGG - Intronic
1079375553 11:19888665-19888687 CTAGAGAAGAAAGCAGGGCAGGG - Intronic
1079975266 11:27083387-27083409 GTGGAAAAGTAGGCAAGGGCTGG - Intronic
1080033810 11:27689872-27689894 CTGGAGCAGGGGGCAGGGGAAGG - Intronic
1080199131 11:29648165-29648187 CAGGGCAAGTAGGCAGGAGAAGG + Intergenic
1080352500 11:31401494-31401516 TGGGAGAGGTAGGCAGAGGAAGG - Intronic
1081520534 11:43877126-43877148 CTGGGGAAGTAGCCACTGGATGG + Intergenic
1081718838 11:45271502-45271524 CTGGAGAGGAAGGCTGGGGTTGG + Intronic
1081779322 11:45699079-45699101 CTGGAGAAGTGAGCTGGAGAAGG - Intergenic
1082059309 11:47847064-47847086 CTGGAGAGGTAGGCAGGACTCGG - Intronic
1082314334 11:50698589-50698611 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1083096108 11:60253392-60253414 CTGGGGAAGGAGGCAGGGGGAGG - Intergenic
1083106366 11:60361914-60361936 CTGGGGAAGGAGGGAGGGGGAGG + Intronic
1083266722 11:61550356-61550378 GTGGAGAAATAGGAAAGGGAAGG + Intronic
1083587513 11:63870953-63870975 CTGGAGCTGCAGGCAGGGAAGGG + Intronic
1083627302 11:64078285-64078307 CTGGAGAAGAGGCCAGGGCAGGG - Intronic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857712 11:65401337-65401359 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857718 11:65401350-65401372 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857724 11:65401363-65401385 CTGGGGAGGGAAGCAGGGGAGGG - Intronic
1083990424 11:66243073-66243095 CTGGAGAGGGAGGCAGGCAATGG + Intronic
1084013588 11:66366091-66366113 GTGGAGAAGACGGCAGGGCAGGG - Intronic
1084026330 11:66452366-66452388 CTGGAAATGTTGGCAGGGGCTGG + Intronic
1084110968 11:67013995-67014017 GTGGAGACGGAGGCAGGGGCTGG - Intronic
1084170241 11:67397394-67397416 CTGGAGGTGGAGGCAGGGGTGGG + Intronic
1084665029 11:70571720-70571742 CTGGAGGAGTCGGCAAAGGAGGG + Intronic
1084729915 11:71066238-71066260 GTGGGGAAGTTGGCGGGGGAGGG + Intronic
1084736114 11:71106806-71106828 CTCAAGAAGAAGGAAGGGGAGGG + Intronic
1085174015 11:74471090-74471112 CTGAAAAACAAGGCAGGGGATGG - Intergenic
1085261811 11:75209980-75210002 CTGGTGAAGAAGGCAGGAAAGGG + Intergenic
1085463844 11:76710989-76711011 CTGGGGAGGAAGGCAGGGGCGGG + Intergenic
1085703397 11:78764797-78764819 CTGGAGAAGAAGGAAGTAGAAGG + Intronic
1086618442 11:88853943-88853965 CTGGAAAGGTAGCCAGGGGTAGG - Intronic
1087104751 11:94398338-94398360 GCGGAGGAGTGGGCAGGGGAGGG - Intronic
1087612948 11:100455868-100455890 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1088166970 11:106950579-106950601 CTGGTGAAGAAGGTGGGGGAGGG + Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1089310806 11:117556993-117557015 CTGGAGATGGATGCAGGGAAGGG + Intronic
1089710793 11:120313056-120313078 CTGGAATGGTAGGCAGGGGCTGG + Intronic
1090040986 11:123291328-123291350 CTGAAGGAGTATGCAGGGGAAGG + Intergenic
1090555525 11:127870664-127870686 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1090826488 11:130390724-130390746 GTGGATATGCAGGCAGGGGAAGG + Intergenic
1090839106 11:130473883-130473905 CTGGAGTAGCGGGCAGAGGACGG + Exonic
1091218804 11:133918926-133918948 CTGGAGAAGGAAGGAGGGGCAGG + Intronic
1091402571 12:189700-189722 CTGGAGGAGGAGGCAGGGTTTGG - Intergenic
1091533816 12:1386798-1386820 CTGCAGGAATAGGCAGGGGATGG - Intronic
1091601084 12:1918154-1918176 CGGGAGGAGTGGGCAGAGGATGG + Intronic
1091607274 12:1965001-1965023 AGGGAGAAGTGGGGAGGGGAGGG + Intronic
1091638969 12:2219881-2219903 CTGGTGACCTAGGCAGTGGAGGG + Intronic
1091647975 12:2288229-2288251 CTGGAGAGGGAGGCCAGGGAGGG - Intronic
1091702087 12:2670225-2670247 CTGGAAGTGTAGGAAGGGGAAGG - Intronic
1091848615 12:3677577-3677599 CTGGAGAAGGGGGAAGGAGAAGG - Intronic
1091849592 12:3684443-3684465 GTGGAGGGGAAGGCAGGGGAGGG + Intronic
1092061104 12:5551246-5551268 CGTGAGAAGGAGGCAGGGAAGGG + Intronic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092208772 12:6632922-6632944 CTGGAGAAGCAGGCAGGCCTGGG - Intronic
1092218494 12:6698136-6698158 CTGGGGAAGTACACAGGGCAGGG - Intronic
1092530308 12:9338578-9338600 CTGGAGGACAAGGAAGGGGAGGG + Intergenic
1095514964 12:42995362-42995384 CTGGAGAAGAATGCAGAGAAGGG + Intergenic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1096003133 12:48145856-48145878 CTGGAGGAGCAGGCAGTGGGTGG + Exonic
1096181678 12:49554603-49554625 CTGGTGAAGTGGGCAGAGGCTGG + Intronic
1096470838 12:51874616-51874638 CTGGGGAACTTGGCAGGGGCTGG + Intergenic
1096596954 12:52701880-52701902 CAGGAGAAGCAGGCAGGGCATGG - Intronic
1096650472 12:53059766-53059788 CTGGAGAGGGAGGCTGGAGAAGG + Exonic
1096656555 12:53096224-53096246 CTGGAGAGGCAGGGAGGAGAGGG - Intergenic
1096879185 12:54653690-54653712 ATGGAGAGGGAGGCATGGGATGG + Intergenic
1097400341 12:59120804-59120826 GTGGAGAAGTAGGCATTGTAGGG + Intergenic
1097452715 12:59755252-59755274 CAGGGCAATTAGGCAGGGGAAGG + Intronic
1097544947 12:60986928-60986950 CTAGAGTAGTAGGAAGAGGAAGG - Intergenic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1097951156 12:65429470-65429492 TTGGAGAGGTAGGCAGGAGTTGG + Intronic
1098073425 12:66700330-66700352 CTGGGGAGGTAGGCAGGAAAGGG + Intronic
1098483356 12:70991899-70991921 CCAGGGAAGGAGGCAGGGGAAGG - Intergenic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1100001047 12:89835550-89835572 TTGAAGAAGGAGGCAGGGGATGG + Intergenic
1100120217 12:91360875-91360897 CTGGAGAAGTAGGTAGATAATGG - Intergenic
1100176728 12:92039048-92039070 CTGTAGAAGTTGGAAGGGTAAGG - Intronic
1101292095 12:103381223-103381245 CATGAGAAGTAGGAAGGGAAGGG - Intronic
1101336019 12:103797597-103797619 CAGGAGAAATTGGGAGGGGAAGG - Intronic
1101359212 12:104010226-104010248 CTGGAGAAGTGAGCAGGGGCTGG - Intronic
1101568823 12:105934644-105934666 CTTGAGAAGCAGGCAAGGGAGGG + Intergenic
1101686685 12:107030777-107030799 GTGGGGAAGGGGGCAGGGGAAGG + Intronic
1101749356 12:107570765-107570787 CTGGAGAGAGAGGCAGGGGGAGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102493521 12:113303787-113303809 CTGGATAAGCACGCAGCGGAAGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103862485 12:124025938-124025960 TTGGAGAAGCAGGGAAGGGATGG + Intronic
1103940905 12:124500700-124500722 CTGGAGAGGAATGCAGGGGTGGG - Intronic
1104038937 12:125116880-125116902 AGGGAGAGGTAGGGAGGGGAAGG - Intronic
1104374321 12:128250523-128250545 CAGGACAAGAAGGCAGAGGAAGG + Intergenic
1104609899 12:130219481-130219503 GTGGAGATGCAGGCAGGGGCTGG + Intergenic
1104640290 12:130462794-130462816 GTGGACAAGCAGGCAGGAGAGGG - Intronic
1104726174 12:131077011-131077033 CTGGAGATGTGGGCAGGGCCTGG + Intronic
1104789223 12:131471476-131471498 CTGGAGCTGTAGACAGGCGAAGG + Intergenic
1105303820 13:19155795-19155817 GCGCAGCAGTAGGCAGGGGAGGG - Intergenic
1105341426 13:19529625-19529647 CAGGAGAAGAAAGTAGGGGAAGG - Intronic
1105635137 13:22209206-22209228 CTGGAAAGGTAGGCTGGGGCTGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106025759 13:25953872-25953894 CTGGTGATGTAGGCACCGGAGGG - Intronic
1106232062 13:27828117-27828139 TTGGAGAATTAGGCAGAGGGCGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107245685 13:38291057-38291079 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1107298425 13:38939752-38939774 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
1107469055 13:40675023-40675045 CTGGGGAAGTAGGGTGGAGAAGG + Intergenic
1107720196 13:43240360-43240382 CTGGAGAAGTAGGTAGATCATGG + Intronic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108596470 13:51954251-51954273 CTGGAGCACAACGCAGGGGATGG + Intronic
1108763368 13:53597450-53597472 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1108965617 13:56296568-56296590 CAGGACAACTAGACAGGGGAGGG - Intergenic
1109203827 13:59459897-59459919 CTGAAAAAGGATGCAGGGGAAGG + Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1109731499 13:66419673-66419695 CTGGTGATGTAGGCACCGGAGGG - Intronic
1109738801 13:66523647-66523669 CTGTAGGAGTTGGCAGGGGGAGG + Intronic
1112108447 13:96267791-96267813 ACAGGGAAGTAGGCAGGGGAAGG + Intronic
1112295101 13:98179526-98179548 CTGTAGAAGTGGGCTGGGAAGGG + Intronic
1112922767 13:104636110-104636132 CAGGAGAGATAGGCAGGGGAGGG - Intergenic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1116004914 14:39282445-39282467 CTGGAGGGGTGGGCAGGGAATGG - Intronic
1116339439 14:43702651-43702673 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1116479842 14:45384349-45384371 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1116524196 14:45885223-45885245 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1117463620 14:55971235-55971257 CTGGAGAAGGAAGCAGAGGTTGG - Intergenic
1117621994 14:57596955-57596977 CTGGAGACGTATTCAGGGGTTGG + Intronic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1118130793 14:62961211-62961233 CTGAAGAGGTAGGCAGGGGTAGG - Intronic
1118291129 14:64525280-64525302 AACGGGAAGTAGGCAGGGGACGG + Intronic
1118475186 14:66109781-66109803 GTGAAGAAGTAGGCATGGCAAGG + Intergenic
1118821635 14:69349701-69349723 CTTGTGAGGTAAGCAGGGGAGGG - Intronic
1119148114 14:72334365-72334387 CTGGGGAAGCTGGCAGGGCAGGG + Intronic
1119168518 14:72515260-72515282 CTGGAGGAAGAGGAAGGGGAGGG - Intronic
1119637817 14:76291063-76291085 CTGGAGAAATAGGCCAGGCATGG + Intergenic
1120751159 14:88199504-88199526 CTGGAAAAGCAGCCAGGGCAAGG + Intronic
1120779100 14:88469822-88469844 GTGGAGAAAAAGGCAGGGTAGGG - Intronic
1120839962 14:89076885-89076907 CTGCAGAGGTAGGCAGGGGCTGG + Intergenic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121237328 14:92401840-92401862 CTGGAGCATTTGGTAGGGGAGGG - Intronic
1121403417 14:93702888-93702910 GTGAAGAAGGAGGCAGGGAATGG - Intronic
1121701102 14:95954835-95954857 TTGCAGAACTAGGGAGGGGAGGG - Intergenic
1122270127 14:100565255-100565277 GTGGACAAGAAGGCAGGGAAGGG + Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122505241 14:102227743-102227765 CTGGAGGAGGAGGCAAGGGCGGG - Intronic
1122636066 14:103130254-103130276 CTGGACAAGGGGGCAGGGGACGG - Intronic
1122751535 14:103937463-103937485 CTGGGAAAGAAGGGAGGGGAGGG - Intronic
1123002169 14:105301363-105301385 CTGGAGCTGTGGGCGGGGGAAGG + Exonic
1123151495 14:106185965-106185987 CAGGTGAAGGAGGCTGGGGAGGG - Intergenic
1123437112 15:20262653-20262675 CTGTAGAAGGAGGCCGGGCACGG - Intergenic
1123629930 15:22254446-22254468 CTGGAGAGGGAGGCAGCTGAAGG - Intergenic
1124677332 15:31697221-31697243 CTGGGGAAGGAGGCAGGTGGAGG - Intronic
1124924650 15:34059550-34059572 CTGGAGAGGCTGGCAGGAGAAGG - Intronic
1125127204 15:36238218-36238240 CTGGAGAAATAGTCAAGGCAAGG - Intergenic
1125236510 15:37520306-37520328 CTGGAGCAGTGGGCAGGAAAGGG + Intergenic
1125427819 15:39567330-39567352 CTGGAGAAGTCGGCCGGGCGCGG - Intergenic
1125570170 15:40710829-40710851 CTTGAGAAGGTGGCAGGAGATGG - Intronic
1125845731 15:42851339-42851361 CAGAAGAAGCAGGCAGGGGTCGG + Intronic
1125938047 15:43653986-43654008 CAGGACAATTAGGCAGGAGAAGG + Intronic
1126691063 15:51289405-51289427 CTGGAGCAGGAGTCAGGGGCAGG - Intronic
1127352911 15:58170691-58170713 CTGAAGAAATAGGCAGGGCATGG - Intronic
1128036205 15:64528872-64528894 GTGGTGAAGTAGGCATCGGAGGG - Intronic
1128223726 15:65987051-65987073 CTGAAGCAGTCAGCAGGGGAAGG - Intronic
1128691380 15:69726984-69727006 CTAGAGCAGAGGGCAGGGGAGGG + Intergenic
1128726614 15:69992655-69992677 CTGGGAAAGGAGGCAGGGCAAGG - Intergenic
1128749812 15:70140800-70140822 CTGGAGAAGAAGGCAGGGCAGGG + Intergenic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130162249 15:81413603-81413625 CTGGGGAAATTGGGAGGGGAGGG + Intergenic
1130376973 15:83337944-83337966 CTGGAGAAGTAATCAGGGGCTGG + Intergenic
1130415441 15:83690321-83690343 TTGGAGAGGTAGGCATGGGCTGG - Intronic
1131011144 15:89019507-89019529 TGGGTGAAGTAGGAAGGGGAAGG - Intergenic
1131403834 15:92147340-92147362 CAAGAGAAGAAGGCAGGGCATGG + Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131827303 15:96331747-96331769 GTGGAGAAAGAGGGAGGGGAGGG - Exonic
1132144980 15:99424351-99424373 GTGGAGGGGGAGGCAGGGGAGGG + Intergenic
1132226752 15:100148745-100148767 CTGCACAGGTGGGCAGGGGAGGG + Intronic
1132233540 15:100202035-100202057 CTGGAGAAGTTGCCTGGTGAGGG + Intronic
1132511737 16:346079-346101 CTGGAGAACAAGCCAGGGAAAGG - Intronic
1132933756 16:2471209-2471231 GTCGGGAAGGAGGCAGGGGAGGG - Intergenic
1132989637 16:2786122-2786144 CTGGAGGAGGAAGCAGGGAAGGG + Intronic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133588011 16:7214472-7214494 ATGGAGATGGAGGCAGTGGATGG - Intronic
1133631948 16:7630111-7630133 CTGGAGACGTACCCAGGGCAGGG - Intronic
1134096832 16:11423938-11423960 CTGGAGAGGAAGGCAGAGGGTGG - Intronic
1134323087 16:13181510-13181532 CTGGAGAAGTTGGTAGGTGCGGG + Intronic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135264993 16:21017067-21017089 CTGGAGATGGAGGGAGGTGATGG + Intronic
1135647336 16:24174630-24174652 CTGAAGAAAGAGGCAGGGCAGGG - Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135920026 16:26641554-26641576 CAGAAGAATGAGGCAGGGGAGGG - Intergenic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1136678855 16:31941686-31941708 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1136777235 16:32878528-32878550 CTGGAGAGGTGGGCAGGGGGTGG + Intergenic
1136893388 16:33982985-33983007 CTGGAGAGGTGGGCAGGGGGTGG - Intergenic
1137594159 16:49712925-49712947 CTGGAGAAATTGGCAATGGAAGG - Intronic
1137628826 16:49927822-49927844 CTGGAGAGGGAGGGAGGGAAGGG + Intergenic
1137832623 16:51558376-51558398 GTGGAGGAGAAGGGAGGGGAGGG + Intergenic
1138280457 16:55768918-55768940 CTGGTTAAGTAGGCAGAGGCAGG + Intergenic
1138354936 16:56370001-56370023 GTGGAAAGGTAGGGAGGGGAGGG + Intronic
1138539532 16:57679944-57679966 GGGGAGAGGAAGGCAGGGGAGGG - Intronic
1139004300 16:62551640-62551662 GGGGAGAAGAAGGGAGGGGAGGG - Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140948438 16:79793254-79793276 CTGGAGTGGTAGGGAGGCGATGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1141973209 16:87496309-87496331 CTGGAGAGGGAGGCAGCTGAAGG + Intergenic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1203079649 16_KI270728v1_random:1140637-1140659 CTGGAGAGGTGGGCAGGGGGTGG + Intergenic
1142631524 17:1229283-1229305 CCGGAGAAGCCGGCGGGGGAAGG - Intergenic
1142756531 17:2019569-2019591 CAGGAGGAAAAGGCAGGGGAAGG - Intronic
1143293446 17:5851424-5851446 CAGGACAATTAGGCAGGAGAAGG + Intronic
1143755089 17:9061191-9061213 CTGGTGGAGGAGGAAGGGGAGGG + Intronic
1143887579 17:10076303-10076325 CGGGAGGAGAAGGGAGGGGAGGG + Intronic
1144461614 17:15463194-15463216 ATGGGGAAGTGGGTAGGGGAGGG + Intronic
1144672319 17:17139836-17139858 CTGGGGCACTAGGCAGGGGCTGG - Intronic
1144759360 17:17698628-17698650 CTGGGGGTGCAGGCAGGGGAAGG - Intronic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145247615 17:21279954-21279976 CTGGAGAAGTCACCAGGGGTTGG + Intergenic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145895490 17:28455344-28455366 CTGGAGAACCAGGAAGGTGAGGG - Intergenic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146689485 17:34863356-34863378 CTGGAGTGGGAGGCAGGGGTTGG - Intergenic
1147330357 17:39695664-39695686 CTGGTGAAGTAGGTAGAGGGAGG + Intronic
1147609779 17:41794631-41794653 CTGGAGGAGGAGGCTGGGAAGGG - Intergenic
1147614471 17:41820084-41820106 CTGGGGCAGGGGGCAGGGGAAGG - Intronic
1147790960 17:43014085-43014107 CTGGAAAAGGAGCCAGGAGATGG - Intronic
1147953224 17:44118578-44118600 CTGGAGGAGTGGGCATGGGTTGG - Intronic
1147967196 17:44199685-44199707 CGGGACAAGAAGGGAGGGGAAGG - Intronic
1148017715 17:44534086-44534108 CTGGAGAAGTTGGAATAGGATGG - Intergenic
1148190440 17:45675006-45675028 CTGGGGAGGAAGGCAGGGGAAGG - Intergenic
1148536390 17:48442581-48442603 CTAGAGAAGTTGGAAGGAGAAGG - Intergenic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1148744368 17:49910249-49910271 CTGGAGGAGGAGGCAGGGCCAGG + Intergenic
1148943953 17:51241854-51241876 CTTGAAAAGTAGGCTGGGCATGG - Intronic
1149026834 17:52036537-52036559 CAGGAAAAATAGGCAGGTGAGGG + Intronic
1149270836 17:54975722-54975744 TTAGAGAAGTAGGCAGGGTCTGG - Intronic
1149453891 17:56771712-56771734 CTGGAGAGGGAGGCAGGAGGGGG + Intergenic
1149891265 17:60392153-60392175 GCGGAGTAGGAGGCAGGGGAAGG - Intronic
1151262774 17:72929705-72929727 CTGGAGAGGTCTGGAGGGGAAGG - Intronic
1151718708 17:75844085-75844107 AGGGTGGAGTAGGCAGGGGAGGG + Intronic
1152031809 17:77847463-77847485 CTGTTCAAGTAGGCCGGGGAGGG - Intergenic
1152092839 17:78256601-78256623 CTGGGGAAGTGAGCAGGGGTGGG + Intergenic
1152342266 17:79731672-79731694 CTGGAGGGGCGGGCAGGGGAGGG - Intronic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152586210 17:81190594-81190616 CTGGAGACGGAGGCGGGGCAGGG - Intronic
1152742004 17:82022568-82022590 CTGCAGAAACAGGCAGGGGTGGG - Intronic
1152802974 17:82340255-82340277 CTGGGGAAGAACACAGGGGAGGG - Intergenic
1153384215 18:4474140-4474162 CTGGGCAATTAGGCAGGAGAAGG - Intergenic
1153430251 18:5008138-5008160 CTGGGCAATTAGGCAGGAGAAGG + Intergenic
1153950494 18:10054126-10054148 ATGGAGGAGCAGGTAGGGGAGGG + Intergenic
1155184098 18:23372384-23372406 CAGGAGAAGAAAGCAGGCGAGGG - Intronic
1155195627 18:23471423-23471445 CTGGAGGAGTAAGCAGGGGCTGG + Intronic
1155330647 18:24712810-24712832 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1156309603 18:35909757-35909779 GGGGAGAGGAAGGCAGGGGAGGG + Intergenic
1156337368 18:36183628-36183650 CTGGAGGAGGAGGTGGGGGAAGG - Intergenic
1157239757 18:45998001-45998023 TTGGTGAAGTAGGCAAAGGAGGG + Intronic
1157315179 18:46580906-46580928 CTGGAGTAGAAGGAATGGGAAGG + Intronic
1157520349 18:48341252-48341274 CCGGAGATGTGGGCAGAGGAAGG + Intronic
1157621592 18:49020380-49020402 GTGGAGAAGAAGGCCGGGGGTGG - Intergenic
1157926943 18:51776882-51776904 CTGGAGGAGTCAGCAGGGGCTGG + Intergenic
1157947556 18:51997911-51997933 CTGGACATGTCAGCAGGGGAAGG + Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158391946 18:57051479-57051501 CTGGGACAGAAGGCAGGGGAAGG - Intergenic
1158803126 18:60936809-60936831 CAGGAGGAAGAGGCAGGGGATGG + Intergenic
1159713387 18:71791599-71791621 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1159946327 18:74447069-74447091 TTGGAAGAGGAGGCAGGGGAGGG - Exonic
1160121117 18:76131177-76131199 CTGGAGAGGCAGGCAGGGGCCGG - Intergenic
1160343922 18:78113757-78113779 CTGGAGGATCTGGCAGGGGAGGG + Intergenic
1160393885 18:78558281-78558303 CTGGAGATGTAGGGTGGGGAGGG - Intergenic
1160975495 19:1790449-1790471 GTGGCGAAGTGGGCAGTGGAGGG - Intronic
1161223826 19:3133107-3133129 CTGGAGAAGTGGGCAGAGCCTGG + Intergenic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161788551 19:6344012-6344034 CTTGATAAGTAGGCCGGGCATGG + Intergenic
1162562368 19:11424076-11424098 CTTGGGAAGGAGGCCGGGGAGGG + Intronic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162921592 19:13906378-13906400 CCGGGGAAGGAGGCAGGGCAAGG + Exonic
1163237796 19:16039422-16039444 CTGGGGATGCAGGCAGGGCAGGG + Intergenic
1163655423 19:18542881-18542903 CGGGAGGAGCAGGCAGGTGAGGG - Intronic
1163774736 19:19211609-19211631 CTGGAGAATCAGGCAGGGCGAGG + Intergenic
1164514611 19:28923074-28923096 CGGGAGAAGAATGCAGGGGCTGG + Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164763726 19:30747060-30747082 CAGGAGAAGGAGGCATGGCAGGG + Intergenic
1165148709 19:33748883-33748905 TTGGAGGAGAAGGCAGGTGAAGG + Intronic
1165169871 19:33884386-33884408 CTGGAGGAGCAGGCGGGGAAGGG - Intergenic
1165775284 19:38400727-38400749 GTGGAGAAGTGGGCAGGTGTTGG + Intergenic
1166137859 19:40788055-40788077 CTGGAGAACTATGAATGGGAGGG - Intronic
1167556871 19:50202302-50202324 CTGGAGCAGTATGAAGGGGAGGG + Intronic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1168321317 19:55511723-55511745 CTGGAGAAGCTGGCAGGGGCTGG + Intronic
925220264 2:2133792-2133814 CAGGAAAAGTAGCCTGGGGAAGG - Intronic
925317773 2:2938724-2938746 CTGGAGCAGCCAGCAGGGGAGGG - Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926152526 2:10432884-10432906 CTGGGGCAGGAGGCTGGGGAGGG + Intergenic
927695482 2:25236836-25236858 CTGGAGAAGCAGGCGGGACAAGG + Intronic
927943964 2:27123664-27123686 GAGGGGAAGAAGGCAGGGGAGGG + Intergenic
928000664 2:27520472-27520494 GTGAAGAAGTAGGAAGGGGAGGG + Intronic
929005639 2:37390408-37390430 CAGAAGGAGTAGGCAGAGGAAGG + Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929647006 2:43637600-43637622 CGGGAGAGGTGGGCAGGGGGCGG + Intronic
930065489 2:47324504-47324526 CTAGGGCAGTAGGCAGGGCAAGG + Intergenic
930105911 2:47639308-47639330 CTGGAGAACTAGGGAGTGGGAGG + Intergenic
930798533 2:55419354-55419376 CTGGAGGAGGAGGAAGGGAAAGG + Exonic
930818536 2:55622473-55622495 CTGGAGAGGTAGGCAGAAGCAGG - Intergenic
930941483 2:57019412-57019434 CAGGACAATTAGGCAGGAGAAGG + Intergenic
931270710 2:60699985-60700007 CTGAAGAAGAATCCAGGGGAAGG - Intergenic
931465369 2:62482028-62482050 CTGAAGAAGGATCCAGGGGAAGG + Intergenic
931668483 2:64626646-64626668 CTGGAGGAGGTGGCAGGGGAGGG - Intergenic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932283837 2:70516521-70516543 CTGGAGTTGGAGGCAGGGCAGGG + Intronic
932509736 2:72273706-72273728 CTGGAAAGGCAGGCAGGGGCTGG + Intronic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932780838 2:74557337-74557359 TTGGGGAAGTAGGGAAGGGATGG - Exonic
933078040 2:77954280-77954302 CAGGAGACTGAGGCAGGGGATGG + Intergenic
933113299 2:78432130-78432152 CTGGAGAACTGGTCTGGGGAAGG + Intergenic
933699350 2:85243612-85243634 CAGGAGGAGAAGGCTGGGGATGG + Intronic
933901393 2:86852915-86852937 CTGGGGAAGGAAGGAGGGGAGGG + Intronic
933939810 2:87235754-87235776 CAGGAGAACCAGGCAGTGGACGG + Intergenic
934124470 2:88873425-88873447 GTGGAGGAGCAGGCAGGGAAAGG + Intergenic
934477197 2:94601678-94601700 CTGGAGAAGGACGCTGGGCAGGG + Intronic
934915468 2:98298009-98298031 CTGGAGCAGCGGGCAGGGCATGG - Exonic
935779157 2:106496322-106496344 CTGGGGAAGGAAGGAGGGGAGGG - Intergenic
935796332 2:106644803-106644825 GTGGAGTAGGAGGTAGGGGAAGG + Intergenic
935971451 2:108534284-108534306 CTGGAGAGGTAGGCGCGGGGGGG - Intergenic
936353327 2:111730019-111730041 CAGGAGAACCAGGCAGTGGACGG - Intergenic
936524407 2:113233052-113233074 GTGGAGAGGAAGGGAGGGGAAGG - Intronic
936922429 2:117702572-117702594 CTGGAGAAGTAGGCATGAGTTGG - Intergenic
937072047 2:119071882-119071904 CTGGAGAAATAAGCAGGAGGAGG + Intergenic
937247747 2:120504402-120504424 CTGATGAGGTAGGCAGGGCAGGG - Intergenic
938196638 2:129334438-129334460 CTGGAGAAGTGGGCCTGGGCGGG + Intergenic
938476166 2:131615922-131615944 CAGGGCAATTAGGCAGGGGAAGG - Intergenic
938573768 2:132585458-132585480 CGGGAGAAGCGGGGAGGGGACGG - Intronic
938785664 2:134626393-134626415 CTGGAAAAGGAGGCTGGGCATGG - Intronic
938829417 2:135035741-135035763 CTGGAAATGCAGGCAGGGGCTGG - Intronic
938981206 2:136528957-136528979 CTTGAGAAATAGGCAGGGGCAGG - Intergenic
939142624 2:138373741-138373763 CTGGGGAGGTAGGCAGGAAAAGG - Intergenic
940387455 2:153090338-153090360 CTGGTGGAGGTGGCAGGGGAAGG + Intergenic
942321755 2:174742149-174742171 CTGGGGAAGGAGGCAGAGGGAGG - Intergenic
942504132 2:176623816-176623838 CAGGACAATTAGGCAGGAGAAGG - Intergenic
942520688 2:176800414-176800436 CAGGACAATTAGGCAGGAGAAGG + Intergenic
943660431 2:190554174-190554196 CTGGTGACGTAGGCACTGGAGGG - Intergenic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
945047051 2:205790791-205790813 CTGGAGGAGAATGCAGGGAATGG + Intronic
945346635 2:208725561-208725583 AAGGAAAAGTAGTCAGGGGAAGG + Intronic
946070281 2:217029053-217029075 CTGGAGAGGTAGGCAGGGGCCGG + Intergenic
947479316 2:230483417-230483439 CTGGAGAGGTAGAGAGGGGTTGG + Intronic
947483560 2:230525742-230525764 CTGCTGAAGCAGGCATGGGAGGG - Intronic
947535548 2:230938667-230938689 CTGGAGCAGCGGGCAGGGCAAGG + Intronic
947536289 2:230942280-230942302 CAGGAGAAGGAGGCAGAAGAAGG - Intronic
947546358 2:231013124-231013146 CTGGTGAAGCAGGGAGGAGAAGG - Intronic
947554593 2:231080179-231080201 CTGGAGAAGTATCCTTGGGAAGG - Exonic
947911190 2:233802060-233802082 CTGGGGAAGCAGGGATGGGATGG + Intronic
948182827 2:235996280-235996302 CTGGAGAGGTGGGCAGTGGACGG - Intronic
948296282 2:236863050-236863072 CCTGAGAAGAAGGCAGGGCAGGG - Intergenic
948310876 2:236985689-236985711 GTGGAGAGCTAGGCTGGGGAAGG - Intergenic
948421951 2:237865230-237865252 CTGGGGGAGTAGGGAGGGCAGGG + Intronic
948760013 2:240184512-240184534 CTAGGGAAGAAGGTAGGGGATGG - Intergenic
948810961 2:240478104-240478126 CTGGAGCGGGAGGAAGGGGAGGG - Intergenic
948814984 2:240505948-240505970 CTGGATATTTAGGAAGGGGAAGG - Intronic
1168741974 20:199894-199916 CTTGAGAAGTAGCCAGGGAGTGG - Intergenic
1168947169 20:1770740-1770762 GTGGAGAAGAGGGCAGGGTAAGG + Intergenic
1169100285 20:2941663-2941685 CTGGAGATGTATACAGGGTAGGG - Intronic
1169314158 20:4574250-4574272 CTCGAGAGGTGGGGAGGGGAAGG + Intergenic
1169674266 20:8135866-8135888 CTGGTGAGGTAGACAGTGGAAGG + Intronic
1169677083 20:8166413-8166435 CTGGAGAGGTAGGAAGAGGTAGG - Intronic
1169768184 20:9171954-9171976 CTTGACAAGTTGACAGGGGAAGG - Intronic
1169933195 20:10856091-10856113 CTGGACAAGTAGTCAGTGGAAGG + Intergenic
1170427425 20:16248807-16248829 AGGGAGAAGTGGGCAGGGAAGGG - Intergenic
1170582770 20:17711508-17711530 CTGGTGAAGGAAGCAGGAGAGGG + Intronic
1170883272 20:20316533-20316555 CAGGGCAATTAGGCAGGGGAAGG - Intronic
1170898770 20:20439609-20439631 CTGGGGGAGTGGGCTGGGGAGGG + Intronic
1170911862 20:20580175-20580197 CTGTTGAAATAGTCAGGGGAGGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171459494 20:25290904-25290926 CAGGAGGAGAGGGCAGGGGAGGG - Intronic
1171459525 20:25290997-25291019 CAGGAGGAGAGGGCAGGGGAGGG - Intronic
1171577229 20:26342970-26342992 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
1171740146 20:28874466-28874488 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1171764564 20:29251397-29251419 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1172192131 20:33068521-33068543 GTGGAGAGGCGGGCAGGGGATGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172554516 20:35829314-35829336 TTGGAGAAGTAGGCTGGTAATGG - Intronic
1172608426 20:36231421-36231443 CTGAAGAAGGTGGGAGGGGAGGG + Exonic
1172635610 20:36407829-36407851 CCGCAGAAGTAGGCAGGGGCAGG + Intronic
1173050825 20:39559971-39559993 CTGGAGACTGAGGCAGGGAAGGG - Intergenic
1173129952 20:40382891-40382913 CTGAAGAATCAGGCAGTGGAGGG - Intergenic
1173333778 20:42097057-42097079 ATGAAGCAGTAGGCAGGGGTTGG - Intronic
1173593068 20:44240470-44240492 CTGGGGCAGCAGGCAAGGGAGGG + Intergenic
1173774203 20:45689835-45689857 CTGGGCAATTAGGCAGGAGAAGG - Intronic
1174486779 20:50866188-50866210 CTGGAGGAGACAGCAGGGGAGGG + Intronic
1174655372 20:52167529-52167551 GAGGAGAAGGAGGGAGGGGAAGG - Intronic
1175306785 20:57981700-57981722 TTGGGGAAGGAGGCAGGGGCCGG + Intergenic
1175522593 20:59611692-59611714 CCGGAGAGGGAGGCAGGGGTAGG - Intronic
1175567233 20:59989950-59989972 CTGGAGATGGAGGGAGGTGATGG - Intronic
1175814496 20:61876459-61876481 CCGGAGAACTGGGAAGGGGAAGG + Intronic
1176301841 21:5102293-5102315 CTGGCTGGGTAGGCAGGGGACGG - Intergenic
1176700772 21:10047208-10047230 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1176734639 21:10534258-10534280 TTGGAGATGTAGGCAGGTGGAGG + Intronic
1177954124 21:27576219-27576241 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178368075 21:32004291-32004313 CTGATGAAGGAGTCAGGGGAAGG - Intronic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179113763 21:38470907-38470929 CTGGACCAGGAGCCAGGGGAGGG + Intronic
1179550259 21:42139336-42139358 CTGGAGCAGGAGGAAGGGGTTGG + Intronic
1179802143 21:43816180-43816202 CAGGAGAGGGAGGCAGGGGCCGG - Intergenic
1179802564 21:43817819-43817841 CTGGAGAGGTGGGCAGGGGCTGG + Intergenic
1179855190 21:44159607-44159629 CTGGCTGGGTAGGCAGGGGACGG + Intergenic
1180635220 22:17258451-17258473 CTGGGGAGGCAGGCATGGGAGGG - Intergenic
1181927344 22:26370571-26370593 CTGGAGAAGAAAGAAAGGGATGG - Intronic
1182465670 22:30514717-30514739 TTGGGGAAGTAGGGAGGGCATGG - Intergenic
1182961902 22:34483292-34483314 CTGGAGAGGTAAGCAGAGGCTGG + Intergenic
1183049563 22:35249923-35249945 CTGGAGGAGAAGGTAGGGGCTGG + Intergenic
1183153788 22:36058242-36058264 CTGGAGAGGTTGGCAGGGGCAGG + Intergenic
1183240226 22:36652360-36652382 CTGCAGAGGTAGGCAGGGCCTGG - Intronic
1183338164 22:37262864-37262886 CTGGAGGCGAGGGCAGGGGAGGG - Intergenic
1183507988 22:38220036-38220058 CTGGAGAAGCTGGTAGGGTAAGG - Exonic
1183524851 22:38317058-38317080 CTGGAGAGGGAGGGAAGGGAGGG - Intronic
1183656612 22:39189359-39189381 TTGGAGGAGAAGGCAGGGTACGG + Intergenic
1184321142 22:43742946-43742968 CTGGAGAGCAAGGCTGGGGAAGG + Intronic
1184739127 22:46416947-46416969 CTGGGGAAGGTAGCAGGGGAAGG + Intronic
1184815419 22:46865170-46865192 CTGGAGAGGAAGGCAGGGCCTGG - Intronic
1184871902 22:47245932-47245954 CTGGAGATGTGGGCAGGGGCCGG - Intergenic
1185036953 22:48484480-48484502 AAGGAGAAGGAGGGAGGGGAGGG - Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
1185301888 22:50085446-50085468 CTTGAGCTGAAGGCAGGGGAAGG + Exonic
949320920 3:2809463-2809485 CTGGGGACGTAGGCAGGGGCTGG + Intronic
949480957 3:4493428-4493450 GTGGAGGAGGAGGCAGGGGGTGG + Exonic
950113556 3:10435687-10435709 CTGGAGAAGGTGGGAGGGGTTGG + Intronic
950163496 3:10776947-10776969 CAGGAGAAACTGGCAGGGGAGGG - Intergenic
950165966 3:10799162-10799184 CTGGTGAAGAGGGCAGGGCAGGG - Intergenic
950221017 3:11196185-11196207 CTGGAGACTTAGGCAGAGGCTGG - Intronic
950448080 3:13049563-13049585 CTGGATAAGGAGGCAGGGAATGG - Intronic
950481507 3:13247139-13247161 CTGGTGAGGTCTGCAGGGGACGG + Intergenic
950573537 3:13816906-13816928 CTGGAGGAGTGGGCATGTGAAGG - Exonic
950610209 3:14121981-14122003 GTGGAGAAGACGGAAGGGGAGGG + Exonic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951827589 3:26885502-26885524 CAGGACAATTAGGCAGGAGAAGG + Intergenic
951933576 3:27997148-27997170 CAGGACAATTAGGCAGGAGAAGG - Intergenic
952717962 3:36500443-36500465 CAGGCGAAGGAGGTAGGGGAGGG + Intronic
952756757 3:36875746-36875768 GGGGGGAAGTAGGTAGGGGATGG - Intronic
952802179 3:37304798-37304820 TTGGAGAAGCAAGCAAGGGAAGG - Intronic
952814725 3:37437205-37437227 CTGGAGAAGTAAGACAGGGAAGG + Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953275695 3:41494577-41494599 CAGGACAATTAGGCAGGAGAAGG + Intronic
953289122 3:41644186-41644208 CAGGACAATTAGGCAGGAGAAGG - Intronic
953359627 3:42283918-42283940 CAGGACAATTAGGCAGGAGAAGG - Intergenic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953863036 3:46561552-46561574 GGGGAGAGGTTGGCAGGGGAAGG + Intronic
954464317 3:50645799-50645821 CAGGAGATGGAGGCAGGGGGTGG - Intronic
954613732 3:51959195-51959217 CTGCACAAGGAGGCAGGGGGAGG - Intronic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
954722680 3:52578941-52578963 CTGGAGAAACTGCCAGGGGAAGG + Intronic
955772087 3:62395229-62395251 CTGGAGAAGTAGGCAAGGGTTGG + Intergenic
955899525 3:63737323-63737345 CAGGACAATTAGGCAGGAGAAGG + Intergenic
955948332 3:64217014-64217036 CTGGATAAGCTGTCAGGGGAAGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956342536 3:68242041-68242063 CTGCAGACTTAGGCAGGGCAAGG - Intronic
956397074 3:68837441-68837463 CTGGAGTGGAAGGAAGGGGAGGG - Intronic
957265955 3:77966111-77966133 CTGGAGTAGGGGGAAGGGGAAGG + Intergenic
957390329 3:79558194-79558216 GTAGAGAAGTTGGAAGGGGAAGG - Intronic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
958512015 3:95061797-95061819 CAGGACAATTAGGCAGGAGAAGG - Intergenic
958527709 3:95284938-95284960 CTGGGCAATTAGGCAGGAGAAGG - Intergenic
958749503 3:98178231-98178253 CTGGGCAATTAGGCAGGAGAAGG + Intronic
960419687 3:117428427-117428449 ATGGGGAAGTAGGCTGGGCATGG - Intergenic
960506372 3:118499795-118499817 CTGGGGAGGAAGGCTGGGGAAGG - Intergenic
960638956 3:119809527-119809549 CTGGAGAAGGCGGCGGGGGGTGG + Intronic
960971150 3:123141190-123141212 CTGGAGTAGGAATCAGGGGAGGG - Intronic
961053763 3:123768900-123768922 CTGGAGAAGCAGGCAGAGAGGGG - Intronic
961172695 3:124809442-124809464 CTGGAGAAGCAAGCAGGGGATGG - Intronic
961364921 3:126393590-126393612 CTGCAGAGGTAGGCTGGGGCCGG + Intergenic
961370304 3:126424519-126424541 CAGGAGAACTGGGCAGGGCAGGG + Intronic
961394817 3:126579211-126579233 CTGGAGAAGTTGGCCAGGGCTGG - Intronic
961465228 3:127077257-127077279 CTGGAGAAGTAGTCTGGGCCAGG + Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
962610613 3:137073252-137073274 CTGGAGAGGTAAGCAGGGCCAGG + Intergenic
963107608 3:141660240-141660262 CTGGAGGAGGAGGCAGGTGGCGG - Intergenic
963575447 3:147055993-147056015 TTGGAGAATTAGGCAGGCCAAGG - Intergenic
963608262 3:147432691-147432713 TTGGGGATGTAGGCATGGGAGGG + Intronic
964473913 3:157081985-157082007 CCGGAGAACAAGGCTGGGGAAGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965613477 3:170569004-170569026 CAGGGCAATTAGGCAGGGGAAGG - Intronic
965623520 3:170664363-170664385 CAGGGCAATTAGGCAGGGGAAGG - Intronic
966488125 3:180494027-180494049 GTGGAGAAGTGGTTAGGGGAAGG - Intergenic
967473197 3:189886916-189886938 CTAGAGAAATAGGCCGGGCATGG + Intronic
967664143 3:192151310-192151332 CAGGGCAATTAGGCAGGGGAAGG - Intronic
968186293 3:196635198-196635220 CTGGAAAAGCAGTCAGGGGTCGG + Intergenic
968919771 4:3516507-3516529 CTGAAGCAGGAGGCAGAGGATGG + Intronic
968933553 4:3597374-3597396 CTGGAGCAGAAGGGAGGGGCGGG + Intergenic
969582405 4:8072867-8072889 CTGGGGAAGTAGGGAGGGGTCGG + Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
970148943 4:13068856-13068878 CTGCAGAAGGAGCCAGGAGATGG + Intergenic
970590848 4:17559609-17559631 ATGGTGGAGTAGACAGGGGAGGG - Intergenic
970627346 4:17902167-17902189 CTGGATAGGTGGGCAGGGGCTGG + Intronic
970803356 4:20002963-20002985 CTGGAGAGGTAGGCAGGACAGGG - Intergenic
971018881 4:22515404-22515426 GTGGAGCTGTAGGCAGGGGGCGG - Intronic
971327366 4:25655479-25655501 CTTGAGGAGAAGGCAGGGGCGGG + Intronic
971419783 4:26464859-26464881 TTGGAGAAGAAGGGAGGTGACGG - Intergenic
971764188 4:30808014-30808036 CTGGTGTAGGAGGCAGGGGAGGG + Intronic
972348221 4:38211545-38211567 CTGCACGAGTGGGCAGGGGAGGG + Intergenic
972685439 4:41348255-41348277 ATGGAGAATTAGGTAGGGCATGG - Intergenic
972691374 4:41402026-41402048 CAGGGCAATTAGGCAGGGGAAGG - Intronic
973905095 4:55520791-55520813 CTGGTGCTGGAGGCAGGGGATGG - Intronic
975025395 4:69542356-69542378 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
975238605 4:72030406-72030428 CAGGAGAAGTACTCAGGGAAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975392495 4:73836300-73836322 CAGGACAATTAGGCAGGAGAAGG - Intergenic
975665928 4:76735110-76735132 CTGGAGAAGTAGCCAGACCATGG + Intronic
976266884 4:83193352-83193374 ATGGAGAGATAGGCAGGGCAAGG - Intergenic
976569781 4:86594618-86594640 CTGTAGAAGGAGCCTGGGGAGGG - Exonic
976677004 4:87714385-87714407 CAGGACAATTAGGCAGGAGAAGG + Intergenic
977034170 4:91928299-91928321 CTGGAGCAGGAGGAAGGGGGTGG - Intergenic
977109922 4:92940561-92940583 CAGGGCAATTAGGCAGGGGAAGG - Intronic
977631814 4:99251420-99251442 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
978245580 4:106568574-106568596 TTGGAGTAGGGGGCAGGGGAGGG - Intergenic
978352744 4:107837498-107837520 CAGCAGAAGTAGGCAAGAGATGG + Intronic
978489915 4:109301991-109302013 CTGAAGAAGCACGCAGGGAAAGG - Exonic
978856097 4:113396666-113396688 ATTGATAAGTAGGCCGGGGATGG - Intergenic
978883767 4:113741767-113741789 GTTGGGAGGTAGGCAGGGGATGG - Intronic
978985627 4:115008681-115008703 CAGGACAATTAGGCAGGAGAAGG + Intronic
979295685 4:119030654-119030676 CTGGAGAAGGCGTCAGGGGGAGG - Exonic
979316930 4:119276092-119276114 CAGGACAATTAGGCAGGAGAAGG - Intronic
979441978 4:120760955-120760977 CTGGAGAAGTGGGCAGGTGAAGG + Intronic
979871615 4:125829581-125829603 TAGGAGAAGTATGCAGGGCAGGG + Intergenic
980613305 4:135185408-135185430 GTGGAGCCATAGGCAGGGGAAGG - Intergenic
981175038 4:141671880-141671902 CTGGAGAAGGGTGCATGGGATGG + Intronic
981817094 4:148843091-148843113 GAGGAGAAGGAAGCAGGGGAGGG - Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982080334 4:151783485-151783507 ATGAAGAAGTAGGCAGAGGTGGG - Intergenic
982487816 4:155989137-155989159 CTGGAAAAATAGGCTGGGCATGG - Intergenic
984628951 4:182040011-182040033 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984628982 4:182040086-182040108 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629022 4:182040186-182040208 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629033 4:182040211-182040233 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985905625 5:2833672-2833694 CCGGAGGAGCAGGCAGGGAAAGG + Intergenic
986285308 5:6354524-6354546 CGGGAGAAGGAGGCAGAGGCTGG + Intergenic
986780541 5:11061443-11061465 CTGGAAAACGAGGCAGGGAAAGG - Intronic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987047921 5:14124834-14124856 ATGGAGAAGGAGGCCGGGCATGG + Intergenic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
987678992 5:21111425-21111447 CAGGACAATTAGGCAGGAGAAGG + Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988042947 5:25911609-25911631 CTGAAGAAGAAGGCAGTGGTAGG - Intergenic
988688378 5:33547953-33547975 CTCAAGAACTAGGCAGGGGAAGG + Intronic
988871960 5:35400225-35400247 CAGGACAATTAGGCAGGAGAGGG + Intergenic
989193146 5:38690685-38690707 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
989272545 5:39550038-39550060 CTAGATAAGTAGGTTGGGGATGG - Intergenic
990982430 5:61614238-61614260 CTGAAGAGGTAGGGAGGGGTTGG + Intergenic
990986956 5:61649547-61649569 TTGGAGAGGTAGGCAGGGGCTGG - Intronic
991292608 5:65047222-65047244 TTGGAGAAGTGGGCAGGGACCGG - Intergenic
991603659 5:68378868-68378890 CTGGGGAAGCAGACAGGGAAAGG + Intergenic
991630022 5:68647301-68647323 CTGGCCAAGTGGGCTGGGGATGG - Intergenic
992446181 5:76835985-76836007 TTGGAGAAATAGGAATGGGATGG + Intergenic
992513961 5:77472421-77472443 CAGGGCAATTAGGCAGGGGAAGG + Intronic
992619777 5:78581285-78581307 CAGGGCAATTAGGCAGGGGAAGG - Intronic
992652213 5:78870812-78870834 CAGGGCAATTAGGCAGGGGAAGG + Intronic
992754203 5:79889051-79889073 CTGGAGAAGTTGGGAAGGAAGGG - Intergenic
993525557 5:88961437-88961459 CTGGACCAGTAGTCAGGCGAAGG + Intergenic
994104086 5:95926230-95926252 GTGGAGGAGTAGGAAGGGGAGGG + Intronic
994209289 5:97070280-97070302 CTGGAGAAAGAGGAAGGGTAAGG - Intergenic
994300263 5:98138963-98138985 CAGGACAATTAGGCAGGAGAAGG + Intergenic
995504071 5:112840606-112840628 CTGGAGAAGGAGTTAGAGGAGGG + Exonic
995918749 5:117284463-117284485 CAGGAGAAGCAGGCCGGGCACGG - Intergenic
996519736 5:124413561-124413583 ATGGAGAAGAAGGCAGGGAGAGG + Intergenic
996631904 5:125643025-125643047 CTGGAGGAGGTGGCAGGGGAGGG - Intergenic
997422382 5:133779720-133779742 CTGGAGAGTTAGGCAGGGCCTGG - Intergenic
998306282 5:141080277-141080299 CCAGAAAAGTAGGCAGGGGCTGG + Intergenic
999009848 5:148024095-148024117 CAGGGGAATTAGGCAGGAGAAGG + Intergenic
999145717 5:149391947-149391969 CTGGGGAAGAGGGCAGGGCATGG - Intronic
999175600 5:149629644-149629666 CTGGAGAGGTGGGCAGGGACAGG + Intronic
999194304 5:149771529-149771551 CAGCAGAGGTGGGCAGGGGATGG + Intronic
999278996 5:150352364-150352386 GTGGAGAAGTGGGCAGGGAATGG + Intergenic
999279144 5:150353497-150353519 CTGAAGAAGAAGGGAGGGCAGGG - Intergenic
999382191 5:151129178-151129200 CTACAGAAGGAGGCAGGGGCTGG - Intronic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1001411883 5:171518065-171518087 CTGGAGGAGTAGCCAGAGGCAGG + Intergenic
1001493031 5:172168972-172168994 CTGGGGAAGTGGGCAGGGGCAGG - Intronic
1001933885 5:175691255-175691277 CTGGAGAGGAAGTCAGGGGAAGG + Intergenic
1002041984 5:176521241-176521263 CTGGAGAAGACGGGAGAGGAGGG + Intergenic
1002386943 5:178875421-178875443 CAGGAGGAGCTGGCAGGGGAAGG + Intronic
1002521557 5:179795574-179795596 AGGGAGAAGTAGGCTGGGGGAGG - Exonic
1002697007 5:181098381-181098403 GGGGAGAGGTAGGGAGGGGAGGG + Intergenic
1002697040 5:181098451-181098473 GGGGAGAGGTAGGGAGGGGAGGG + Intergenic
1002886078 6:1295499-1295521 AGGGAGAGGAAGGCAGGGGAGGG - Intergenic
1002966766 6:1974451-1974473 CTAGAGAAGTAGGCACAGGAGGG + Intronic
1003080528 6:3017532-3017554 CTGGGGAAGCAGGCCTGGGAGGG - Intronic
1003097237 6:3151989-3152011 CTTGAGCAGCAGGCTGGGGATGG + Intronic
1003482387 6:6545917-6545939 CTGGAGAAGGAGCTTGGGGATGG - Intergenic
1003619461 6:7685188-7685210 CTGGAGAAGAAGCCTTGGGATGG + Intergenic
1003629204 6:7771658-7771680 CTGAAGACTTAGGCAGGGCATGG + Intronic
1003660522 6:8056499-8056521 CTGGAGAAGGTGGCAGTGGCGGG - Intronic
1003777888 6:9389888-9389910 ATGAAAAAGGAGGCAGGGGATGG + Intergenic
1004523559 6:16384712-16384734 CTGGAGCAGGAGGAAGGGAAAGG - Intronic
1004648725 6:17588164-17588186 CTGGAAAAGTAGGGAGGGGTTGG - Intergenic
1005033129 6:21530025-21530047 CTGCAGAAGGAGACAGGGCAAGG - Intergenic
1005574599 6:27179692-27179714 GCGGAGAGGTAGGCAGGGGAAGG - Intergenic
1005648973 6:27868901-27868923 CTGGAGAAGTTGGCAGACTATGG + Intergenic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1005994135 6:30921566-30921588 CTGCAAAAGTAGGAAGGGGTTGG - Intronic
1006362605 6:33595154-33595176 CGGGGGAAGCAGGCAGGGGCTGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1007208522 6:40172294-40172316 CTGAAGAAATGGGCAGGGGCAGG - Intergenic
1007687136 6:43673654-43673676 CAGGAGAGGTAGGAAGGGGCTGG - Intronic
1007694659 6:43724677-43724699 AAGGAGCAGGAGGCAGGGGATGG - Intergenic
1008817766 6:55589549-55589571 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
1009752746 6:67893466-67893488 CAGGGCAAGTAGGCAGGAGAAGG + Intergenic
1010460361 6:76107608-76107630 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1012939007 6:105398000-105398022 ATGGAGAAATAGGAAAGGGATGG + Intronic
1013305120 6:108840570-108840592 ATGTAGAAGTAGGCAGGGCGCGG - Intergenic
1013346267 6:109263608-109263630 CTTGAGAAGTTGGCACGTGAAGG - Intergenic
1013355139 6:109339843-109339865 CTGGAGAGGAAGGCAGGAGGAGG - Intergenic
1013405770 6:109841534-109841556 CTGGAGAGTTAGGCAGGGACTGG + Intergenic
1013455223 6:110323878-110323900 GTGAGGAAGTAGGCAGGGGAGGG + Intronic
1013611567 6:111800768-111800790 CTGGAGATGTGGGCAGGAGAGGG - Intronic
1013639233 6:112057211-112057233 CTCAAGAGGTAGGCAGGAGAGGG + Intronic
1013889779 6:115012462-115012484 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
1013890194 6:115017493-115017515 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
1014153705 6:118087624-118087646 TTGGAGAGGTAGGCAGAGGAGGG - Intronic
1014471245 6:121817287-121817309 CTTATGAAATAGGCAGGGGAGGG + Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016378072 6:143444331-143444353 CTGGAATGGTAGGCAGGGGAGGG + Intronic
1016548527 6:145250971-145250993 CTTGAGAAATAAGTAGGGGAAGG - Intergenic
1016739576 6:147513129-147513151 CTGGAGAAAGTGGCAGGAGATGG + Intronic
1016868631 6:148795195-148795217 TTTGAGAAGTAGGCTTGGGATGG + Intronic
1017060005 6:150474217-150474239 CAGGGCAAGTAGGCAGGAGAAGG + Intergenic
1017125560 6:151060960-151060982 CCTGAGGTGTAGGCAGGGGATGG + Intronic
1017194386 6:151684332-151684354 CTGGAGAGGTTGGCTGGAGACGG + Intronic
1018017840 6:159727696-159727718 CTGGAGAGGTAGGCGCGGGCCGG + Intronic
1018071633 6:160169932-160169954 CTTGAGAAGTGTACAGGGGAGGG + Intergenic
1018459393 6:163983414-163983436 CTGGAGAAGTGGGAAAGGGGAGG + Intergenic
1018747431 6:166773228-166773250 TTGGAGAAGGAGGCAGGGAAGGG + Intronic
1018824973 6:167402045-167402067 CTGGAGAAGGAGGAACCGGAGGG + Intergenic
1018901235 6:168052768-168052790 CTGGAGAACCAGGCATGGGCCGG + Intergenic
1019160964 6:170066602-170066624 TTGGAGATGGAGGCATGGGATGG - Intergenic
1019215218 6:170438908-170438930 CTGGAGGAGCAGGCTGGGGGTGG + Intergenic
1019288853 7:237286-237308 TCAGAGGAGTAGGCAGGGGAAGG + Intronic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1020954126 7:14718635-14718657 CAGGAGAAGTAGTCCGGGGAGGG + Exonic
1021144132 7:17064794-17064816 CTATAGAAGGAAGCAGGGGAGGG - Intergenic
1021319315 7:19191040-19191062 CAGGGCAATTAGGCAGGGGAAGG - Intergenic
1021628876 7:22623914-22623936 CAGCAGAAGTAGGAAGGGGCAGG + Intronic
1022590210 7:31654341-31654363 ATGGAGATGGAGGGAGGGGAAGG + Intronic
1022990497 7:35702584-35702606 CTGGAGAAGTTGTCCGTGGAAGG - Intergenic
1023334722 7:39156796-39156818 CTGAAGAGGTAAGCAGGGAAGGG - Intronic
1023355994 7:39367545-39367567 CTGTTTAAGAAGGCAGGGGATGG - Intronic
1023669580 7:42561568-42561590 CTGGAGATGTAGGGAGAGTAGGG + Intergenic
1023821438 7:43982871-43982893 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1024091804 7:45949391-45949413 CAGGGCAATTAGGCAGGGGAAGG - Intergenic
1026380207 7:69791964-69791986 CTGGAGTAGGAGGCTGGGGAAGG + Intronic
1026646541 7:72175665-72175687 ATGGAGAAGTAGGCAGACCAGGG + Intronic
1027717740 7:81694328-81694350 CTGGAAATTTAGGCAGAGGAGGG + Intergenic
1028071711 7:86459028-86459050 CAGGGCAAGTAGGCAGGAGAAGG - Intergenic
1028355237 7:89898884-89898906 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1028810036 7:95075538-95075560 ATGGAGAGGTAGGCTGGGCATGG + Intronic
1029290415 7:99498351-99498373 CTGGAGAAGGATAGAGGGGAAGG + Intronic
1029479081 7:100802203-100802225 CTGGAGAGGGAGGCTGGGGCAGG - Intergenic
1029749701 7:102536292-102536314 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1029767651 7:102635397-102635419 TGGGAGAGGCAGGCAGGGGATGG - Intronic
1030052011 7:105546322-105546344 CAGGAGGAGTAGGAAGGGAAAGG + Intronic
1030117271 7:106071468-106071490 CTGGGGCAGGAGGCAGGGCAGGG + Intergenic
1030500117 7:110349553-110349575 CTGGGCAATTAGGCAGGAGAAGG + Intergenic
1030510427 7:110476354-110476376 CTGGGCAATTAGGCAGGAGAAGG + Intergenic
1030703132 7:112662693-112662715 CTGGTGGTGTAGGCATGGGAAGG + Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031642810 7:124186225-124186247 CTGGAGAAGGAGCCAATGGAGGG + Intergenic
1032062347 7:128735631-128735653 CTGGAGCAGGAGGAAGGGGCGGG + Intergenic
1033137670 7:138798333-138798355 CTGAAGGATTAGGCAGGGGGTGG + Intronic
1033803748 7:144930638-144930660 CTAGAGAAGGAAGCAAGGGAGGG - Intergenic
1034283656 7:149870506-149870528 CTCCAGAAGTAGGCAGGGCCTGG + Intergenic
1034360297 7:150490646-150490668 CAGGGGAATTAGGCAGGAGAAGG + Intergenic
1034360707 7:150495064-150495086 CAGGGGAAATAGGCAGGAGAAGG + Intergenic
1034411709 7:150945552-150945574 ATGGAGGAGGAGGAAGGGGAGGG + Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1034655005 7:152722286-152722308 CTGGAGATGTAGGCAGGTCACGG + Intergenic
1034859875 7:154585946-154585968 AAGGAGAGGAAGGCAGGGGAAGG + Intronic
1034944180 7:155251233-155251255 CAGGATAAATAGGCATGGGAGGG + Intergenic
1035009883 7:155705603-155705625 CTGGGGAAGAAGGCAGGAGAAGG + Intronic
1035020502 7:155797460-155797482 CTGGAGAAGCAGCCAGGAGCTGG + Intergenic
1035044152 7:155953026-155953048 CTGGTGCAGAAGGCAGGGGAGGG + Intergenic
1035606155 8:930931-930953 GTGGGGAGGGAGGCAGGGGAAGG + Intergenic
1035772391 8:2158284-2158306 CTGGAGTGGTAGACAGGGAAAGG - Intronic
1035783670 8:2247411-2247433 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783683 8:2247449-2247471 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783696 8:2247487-2247509 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783707 8:2247525-2247547 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783733 8:2247601-2247623 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783746 8:2247639-2247661 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783771 8:2247715-2247737 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783823 8:2247867-2247889 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783836 8:2247905-2247927 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783849 8:2247943-2247965 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783887 8:2248056-2248078 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783900 8:2248094-2248116 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783913 8:2248132-2248154 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783949 8:2248246-2248268 CAGGAGGAGGAGTCAGGGGAAGG + Intergenic
1035783973 8:2248322-2248344 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783997 8:2248398-2248420 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784019 8:2248474-2248496 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784055 8:2248588-2248610 CTGTAGGAGGAGCCAGGGGAAGG + Intergenic
1035784081 8:2248664-2248686 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784202 8:2249044-2249066 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784215 8:2249082-2249104 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784265 8:2249234-2249256 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784290 8:2249310-2249332 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784474 8:2249918-2249940 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035808335 8:2471795-2471817 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808369 8:2471909-2471931 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808382 8:2471947-2471969 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808395 8:2471985-2472007 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808418 8:2472061-2472083 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808444 8:2472137-2472159 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808457 8:2472175-2472197 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035831115 8:2695304-2695326 CTGAAGAAGAAGGCAGAGGTTGG - Intergenic
1036407560 8:8468596-8468618 CTGTACATGTAGGCAGGTGACGG + Intergenic
1036582307 8:10086793-10086815 GTGGAGAAGGAAGGAGGGGAGGG + Intronic
1036726422 8:11224787-11224809 CCAGAGCAGTAGGCTGGGGATGG - Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037250366 8:16886446-16886468 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1037316996 8:17608497-17608519 CTGGGGAAGGAGGCAGAGGGAGG + Intronic
1037461325 8:19113003-19113025 CTGGAGAGTTGGGCGGGGGAAGG - Intergenic
1037540736 8:19868004-19868026 CCAGAGAGGTAGGCAGGGAAAGG + Intergenic
1037649469 8:20823475-20823497 TTGGAGAAGTCGGGAGGGAAGGG - Intergenic
1037666141 8:20971809-20971831 CTGGTGAAGGAATCAGGGGAAGG + Intergenic
1037747644 8:21659680-21659702 CTGCAGAAGGAGACAGGGAAGGG - Intergenic
1037839880 8:22237044-22237066 CTGCAGTTGTAGGCAGGGAAAGG + Intergenic
1038151356 8:24944036-24944058 GGGGAGCAGTAGGCAGAGGAGGG + Intergenic
1038544507 8:28414770-28414792 GTGGGGAAGTGGGCAGGGGAGGG - Intronic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1039608891 8:38903551-38903573 CTGCAGAAGTGGGAAGGGGAAGG + Intronic
1040118016 8:43647361-43647383 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1040273278 8:45982028-45982050 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1040492776 8:47940447-47940469 ATGGATAAGTTGGCAGTGGAAGG - Intronic
1040682467 8:49829078-49829100 TGTGAGAAGCAGGCAGGGGATGG + Intergenic
1040686310 8:49877111-49877133 CAGGAAAATTAGGCAGGAGAAGG - Intergenic
1041628146 8:60054949-60054971 TTGGAGATGAAGGGAGGGGAGGG + Intergenic
1041788285 8:61660288-61660310 GGGGAGAAGTAGGAATGGGATGG + Intronic
1042130477 8:65582724-65582746 AAGGAGAAGGAGGCAGGGGAAGG + Intergenic
1042680984 8:71383739-71383761 CTGGAGAAGTAAGGAGAGTAAGG + Intergenic
1043059523 8:75482358-75482380 ATGGAGCAGAAGGGAGGGGAGGG - Intronic
1043358342 8:79440278-79440300 CTGGGGAAGTAGGAAGGGGGTGG + Intergenic
1043515194 8:80989609-80989631 ATGAGGAAGAAGGCAGGGGATGG + Intronic
1043706618 8:83358453-83358475 CTGGAGAAGGAAGCAGGTGTTGG + Intergenic
1043718339 8:83511357-83511379 CTGGTGGAGGTGGCAGGGGAGGG + Intergenic
1043810275 8:84730532-84730554 CAGGACAATTAGGCAGGAGAAGG + Intronic
1043829755 8:84973340-84973362 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1043888227 8:85627258-85627280 CTGGAGAGGAAAGCAGGGCAAGG - Intergenic
1044445460 8:92270086-92270108 CTGGATCAGTAGGCCTGGGAGGG + Intergenic
1044922511 8:97180973-97180995 CTGGAGAATAGGGCAGGGCAGGG - Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044960965 8:97530178-97530200 CTGGAGATGTAGGCACCCGAGGG - Intergenic
1045025140 8:98079827-98079849 ATGGAAAAGTAGGCCGGGCACGG - Intronic
1045187628 8:99855014-99855036 CTGGAAAAGTCTGCAGGGGGTGG + Intronic
1045296007 8:100872159-100872181 CTGGAGAAGGGGGCTGGGGGTGG - Intergenic
1045931552 8:107633097-107633119 CTGGAGAAGCAGGCCCTGGAGGG + Intergenic
1046090688 8:109499906-109499928 CTGGTGAGGTGGGTAGGGGACGG + Intronic
1046848722 8:118948926-118948948 GTGGAGAAGTGGGCAGGGAGGGG - Intronic
1046879868 8:119296167-119296189 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1047537346 8:125731957-125731979 CTGGAGACGGAGACGGGGGAGGG + Intergenic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048412086 8:134185696-134185718 CTGTACAAGTAGGTGGGGGAAGG + Intergenic
1048470223 8:134698360-134698382 AAGGAGAAGGAGGCAAGGGAAGG + Intronic
1048517449 8:135123800-135123822 CAGGAGAAGAAGGAAAGGGAAGG - Intergenic
1048624856 8:136173812-136173834 TTGGAGAGGTAGGCAGGGAAGGG + Intergenic
1048636554 8:136302024-136302046 GTGGTGAAGAAAGCAGGGGACGG - Intergenic
1048820565 8:138376562-138376584 CTGGAGAAGTAAGAAGTTGATGG - Intronic
1048862340 8:138733131-138733153 GTGGAAATGCAGGCAGGGGAGGG - Intronic
1049121992 8:140747559-140747581 CGGGAGGAGGAGGAAGGGGAGGG + Intronic
1049310634 8:141931942-141931964 CTGGAGAGGTTGGCAGGGGAGGG - Intergenic
1049624234 8:143612966-143612988 CTGCAGAGGCAGGCAGGTGAGGG + Intronic
1049649981 8:143761304-143761326 CCGGAGCAGCAGGCAGGGGCCGG - Intergenic
1049655153 8:143793963-143793985 CTGGAGGAGTAGGCAGTGGGTGG + Intronic
1050134137 9:2443563-2443585 TTGGAGGAGGTGGCAGGGGAAGG - Intergenic
1050817977 9:9839199-9839221 CAGGACAATTAGGCAGGAGAAGG + Intronic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1051515816 9:17929490-17929512 CTGGGGAGCTAGGCAGGGGCTGG - Intergenic
1052467777 9:28851778-28851800 CTGAAGAAGTAGGCATGGCTAGG - Intergenic
1052527456 9:29636810-29636832 CTGGTGAACTGGGCAGTGGAGGG + Intergenic
1052852775 9:33387874-33387896 CTGGAGAAGGACGCTGGGCAGGG - Intronic
1053039705 9:34859410-34859432 CTGGAGAAGTGGTCAGGCAAGGG + Intergenic
1053459032 9:38254237-38254259 CTGGAGGATAAGGGAGGGGATGG + Intergenic
1053465966 9:38308774-38308796 GTGGGGAAATAGGCAGGAGAAGG + Intergenic
1053637913 9:40033710-40033732 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1053728912 9:41032685-41032707 TTGGAGAAGCAGGCAAGAGATGG + Intergenic
1053768169 9:41431510-41431532 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1053854214 9:42321187-42321209 TTGAAGAAGTAAGGAGGGGAAGG + Intergenic
1054318710 9:63630314-63630336 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
1054425804 9:65066004-65066026 CTGGGCAATTAGGCAGGAGAAGG + Intergenic
1054546837 9:66343014-66343036 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1054699600 9:68399398-68399420 TTGGAGAAGCAGGCAAGAGATGG - Intronic
1055321485 9:75087737-75087759 CTGGAGAAGTCGCCAGGGACAGG - Intronic
1056132997 9:83603614-83603636 CTGGACAAGGCAGCAGGGGATGG + Intergenic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056887538 9:90457709-90457731 CTGGAGAAGAAGGCATGGGCTGG - Intergenic
1056938612 9:90936855-90936877 CTAGAGAAGTAGTGATGGGAAGG + Intergenic
1056939912 9:90946182-90946204 ATTGAGAAGAGGGCAGGGGAAGG + Intergenic
1057003461 9:91534191-91534213 CTGGGGAAGAAGGCAGAGTAGGG + Intergenic
1057226652 9:93296425-93296447 ATGGAGAAGGAGGAAGGTGAGGG - Intronic
1057270456 9:93647387-93647409 CTGCAGAAGCAGGGAGGAGATGG + Intronic
1057328633 9:94091075-94091097 CTGGGCAATTAGGCAGGAGAAGG - Intronic
1057423079 9:94927675-94927697 CTGGGGCAGCAGCCAGGGGAGGG - Intronic
1057836790 9:98451770-98451792 CTGGATAAGGAGGCTGGGAAGGG - Intronic
1057839345 9:98472963-98472985 CTAGAGAGGTAAGCAGTGGAGGG + Intronic
1058580196 9:106447534-106447556 GTGGAGAAGGTGGAAGGGGAGGG - Intergenic
1059047019 9:110879812-110879834 CTGGAGAAGTATTTAGGAGACGG + Intronic
1059350634 9:113662454-113662476 CAGGAGAAGGAGGCAGGAGAAGG - Intergenic
1059352563 9:113676048-113676070 GTGGAGAAATAGGCTGGGCATGG + Intergenic
1059570525 9:115429492-115429514 CAGGGGAATTAGGCAGGAGAAGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060376378 9:123118268-123118290 CTGAAGGAGTAGGAAGGGAAGGG - Intronic
1060887173 9:127162647-127162669 CTTGAGGAGTAGGCAGGTGTGGG + Intronic
1060909695 9:127339684-127339706 CTGGTGGAGTTGGCAAGGGAGGG - Exonic
1061025927 9:128049467-128049489 GTGGAGAAGTTGGCCGGGTACGG + Intergenic
1061026850 9:128055349-128055371 AGGGAGAAGAAGGGAGGGGAAGG + Intergenic
1061055148 9:128218556-128218578 CTCCAGAAGCGGGCAGGGGAAGG - Intronic
1061214480 9:129213195-129213217 CTGGAGAAGAGGTCAAGGGAGGG - Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061832028 9:133302303-133302325 CTGGAGAGGTTGGGAGGGGAAGG - Intergenic
1061854809 9:133436264-133436286 TTGGAGAAGGAGGAAAGGGAGGG - Intronic
1062124653 9:134853442-134853464 CTGGGAAAGATGGCAGGGGATGG + Intergenic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062393905 9:136344961-136344983 CTGGGGCAGCAGGCAGGTGAGGG + Intronic
1062569772 9:137179701-137179723 CTGGAGAAGGGGGCAGGGCTGGG + Intronic
1202785783 9_KI270719v1_random:17266-17288 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1203440702 Un_GL000219v1:5373-5395 CAGGGGAATTAGGCAGGAGAAGG - Intergenic
1203511580 Un_KI270741v1:123756-123778 CAGGGGAATTAGGCAGGAGAAGG - Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187117181 X:16364203-16364225 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1187130853 X:16501481-16501503 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1187417263 X:19104031-19104053 CTGGGGAAGAAGGCAGGAGGAGG + Intronic
1187882873 X:23862844-23862866 AGGGAGAAGGAGGGAGGGGAGGG + Intronic
1188037222 X:25332185-25332207 CAGGGCAAGTAGGCAGGAGAAGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1189010508 X:37042484-37042506 CTGGAGAAGAAGGGAAGGAAGGG - Intergenic
1189877761 X:45454485-45454507 GCGGAGGAGAAGGCAGGGGAGGG + Intergenic
1189928882 X:45986690-45986712 CTTGAGATGTGGGCAGGAGAAGG + Intergenic
1190183162 X:48211217-48211239 GTGGAGAAGGAGGGAGGGCAGGG + Intronic
1190303024 X:49067426-49067448 CGGGAGGAGAAGGCAGGGGTTGG - Exonic
1190570866 X:51779926-51779948 CTGGAGAGGTAGGCAGGGCCAGG - Intergenic
1190799580 X:53775142-53775164 CTGGAGAACCAGGCAGGGTCAGG - Intergenic
1191028862 X:55945636-55945658 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1191173854 X:57479483-57479505 CAGGGAAATTAGGCAGGGGAAGG - Intronic
1191763397 X:64668363-64668385 CAGGGCAATTAGGCAGGGGAAGG + Intergenic
1191804556 X:65120642-65120664 CAGGACAATCAGGCAGGGGAAGG - Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1191959839 X:66688984-66689006 CAGGGCAATTAGGCAGGGGAAGG - Intergenic
1192225792 X:69226908-69226930 CTGGAGGACCTGGCAGGGGAGGG + Intergenic
1192362623 X:70449163-70449185 CTGGGGAATTGGGGAGGGGATGG + Intronic
1192753173 X:74016313-74016335 TTAGAGAAGTAGGCCGGGCATGG + Intergenic
1193372110 X:80711288-80711310 CTGCAGAGGTGGGCATGGGAGGG + Intronic
1193979893 X:88169144-88169166 CTGGAGAAGCAGTTAGGGGAGGG + Intergenic
1194069021 X:89296644-89296666 CAGGACAATTAGGCAGGAGAAGG + Intergenic
1194254758 X:91622452-91622474 CTGGTGAGGTAGGCACTGGAGGG + Intergenic
1195656272 X:107334210-107334232 CTGGAGCAGTAGGTATGGAAAGG + Intergenic
1195741424 X:108068555-108068577 CTGGAACAGGAGGAAGGGGAGGG + Intronic
1196394368 X:115243546-115243568 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1196431152 X:115627140-115627162 CTAGAAAAGTAGGCTGGGCACGG - Intronic
1196654366 X:118201645-118201667 CCAGAGAATGAGGCAGGGGATGG - Intergenic
1196900029 X:120373889-120373911 CAGGAGGAGGAGGCGGGGGAGGG - Intronic
1197771936 X:130094803-130094825 CTGCAGATGTAGGGAGGGGCTGG - Intronic
1198681405 X:139186637-139186659 CTGAATAGGTAGGCAGGGGCTGG - Intronic
1198688252 X:139250815-139250837 GAGGAGAAGTAGACAGGGCATGG + Intergenic
1198931978 X:141871854-141871876 GTGGAGAAGTAGGAGGGGCAAGG + Intronic
1199494578 X:148438889-148438911 CTGGAGAAACAGGCAGGGTCAGG + Intergenic
1200102625 X:153695520-153695542 CTGGAGAGGTGGGCAGGGGGTGG - Exonic
1200333172 X:155319577-155319599 CTGGTGGAGTAGGCACTGGAGGG - Intronic
1200573543 Y:4862055-4862077 CTGGTGAGGTAGGCACTGGAGGG + Intergenic
1201397147 Y:13561265-13561287 CAGGACAATTAGGCAGGAGAAGG - Intergenic
1201452962 Y:14136122-14136144 GTGGAGAGGGAGGGAGGGGATGG - Intergenic
1201527883 Y:14956891-14956913 CAGGACAATTAGGCAGGAGAAGG + Intergenic