ID: 1145902206

View in Genome Browser
Species Human (GRCh38)
Location 17:28496395-28496417
Sequence TTGGTCCCCAAGCCAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145902206_1145902212 16 Left 1145902206 17:28496395-28496417 CCTCCCTCTGGCTTGGGGACCAA 0: 1
1: 0
2: 2
3: 32
4: 292
Right 1145902212 17:28496434-28496456 CTGCCTCCCACTCCAGGCCCAGG 0: 1
1: 1
2: 11
3: 88
4: 748
1145902206_1145902210 10 Left 1145902206 17:28496395-28496417 CCTCCCTCTGGCTTGGGGACCAA 0: 1
1: 0
2: 2
3: 32
4: 292
Right 1145902210 17:28496428-28496450 GCGCCACTGCCTCCCACTCCAGG 0: 1
1: 0
2: 1
3: 31
4: 795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145902206 Original CRISPR TTGGTCCCCAAGCCAGAGGG AGG (reversed) Intronic