ID: 1145902576

View in Genome Browser
Species Human (GRCh38)
Location 17:28498120-28498142
Sequence CGGTTTTTCCAGCTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145902576_1145902590 27 Left 1145902576 17:28498120-28498142 CCTTCCTCCAGCTGGAAAAACCG 0: 1
1: 0
2: 5
3: 16
4: 204
Right 1145902590 17:28498170-28498192 GACCTGTGCTGGGTGCCCAGAGG 0: 1
1: 0
2: 4
3: 37
4: 306
1145902576_1145902589 17 Left 1145902576 17:28498120-28498142 CCTTCCTCCAGCTGGAAAAACCG 0: 1
1: 0
2: 5
3: 16
4: 204
Right 1145902589 17:28498160-28498182 AAGGCAGGCTGACCTGTGCTGGG 0: 1
1: 1
2: 0
3: 26
4: 260
1145902576_1145902582 -2 Left 1145902576 17:28498120-28498142 CCTTCCTCCAGCTGGAAAAACCG 0: 1
1: 0
2: 5
3: 16
4: 204
Right 1145902582 17:28498141-28498163 CGGTCCCACCAGGCCAGAGAAGG 0: 1
1: 0
2: 2
3: 18
4: 140
1145902576_1145902588 16 Left 1145902576 17:28498120-28498142 CCTTCCTCCAGCTGGAAAAACCG 0: 1
1: 0
2: 5
3: 16
4: 204
Right 1145902588 17:28498159-28498181 GAAGGCAGGCTGACCTGTGCTGG 0: 1
1: 0
2: 1
3: 36
4: 255
1145902576_1145902584 2 Left 1145902576 17:28498120-28498142 CCTTCCTCCAGCTGGAAAAACCG 0: 1
1: 0
2: 5
3: 16
4: 204
Right 1145902584 17:28498145-28498167 CCCACCAGGCCAGAGAAGGCAGG 0: 1
1: 0
2: 1
3: 27
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145902576 Original CRISPR CGGTTTTTCCAGCTGGAGGA AGG (reversed) Intronic
902142611 1:14369491-14369513 CGGCTTCTCCATCTGGAGAATGG + Intergenic
902340212 1:15778180-15778202 GGGTTGTTACAACTGGAGGAAGG + Intronic
903781381 1:25822158-25822180 TGGTTTTTCCATCTGGAAAAAGG - Intronic
904472194 1:30742797-30742819 CGGTTTTCCCATCTGCAAGATGG + Intronic
905240643 1:36578815-36578837 GGGCTTCTCCAGCTGGACGATGG - Intergenic
905560301 1:38921257-38921279 CTGTACTTCCAGCTGAAGGAAGG + Intronic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
907468894 1:54658886-54658908 TGGTTTTTACAACTGGAGGGTGG - Intronic
908295862 1:62712545-62712567 AGGACTCTCCAGCTGGAGGAAGG + Intergenic
911271698 1:95809506-95809528 TGGTTTTTCCACAGGGAGGAAGG + Intergenic
912573534 1:110642954-110642976 AGGTTTGTCCAGCTGGGGGAGGG + Intergenic
912612822 1:111066186-111066208 CGGGTTTTCAGGCTTGAGGATGG - Intergenic
913318108 1:117569235-117569257 CGGTTTTCTCATCTGTAGGATGG + Intergenic
922999658 1:229996539-229996561 AGCTTTCTCCAGCTGGAGGCAGG - Intergenic
923079641 1:230641600-230641622 CGGTATTTACAGCTAGCGGAAGG + Intergenic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
1063489264 10:6448036-6448058 GGATTTTTCCAGGTGGAGTAGGG + Intronic
1064040551 10:11959251-11959273 CGGTTTTTTCAGCTGGAGGTGGG + Exonic
1064944841 10:20775765-20775787 TTGTTTTTCCAGCTAGAGGTTGG + Intergenic
1065811742 10:29449305-29449327 TGGCTTCTCCAGCTGGAGGGAGG + Intergenic
1065960046 10:30726840-30726862 TGGCTTCTCCAGCTGGAGGGAGG - Intergenic
1067161297 10:43826844-43826866 CGGTTATCCCACGTGGAGGAAGG + Intergenic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1067776298 10:49167190-49167212 CAGTTTCTACAGCTGAAGGAGGG - Intronic
1070596301 10:77835180-77835202 GGGTTTTTCCAGGTGGAAAAGGG - Intronic
1072098215 10:92203719-92203741 CGATTTTTTGAGCTGAAGGAAGG + Intronic
1072107810 10:92290987-92291009 CATTTTTTCCCCCTGGAGGAAGG + Intronic
1072713684 10:97735320-97735342 TGGTTTTTCCAGCTGTAAAATGG - Intergenic
1075669984 10:124257671-124257693 CTACTTTTCCAGCAGGAGGAGGG + Intergenic
1079073990 11:17372126-17372148 CCGTCTTACCAGCTGCAGGATGG + Exonic
1079653548 11:22960944-22960966 GGGTGTTGCCAGCTGGGGGATGG - Intergenic
1080849756 11:36057945-36057967 CAGTTTTCTCATCTGGAGGAGGG + Intronic
1081457227 11:43235865-43235887 GTGATTTTCCAGTTGGAGGATGG + Intergenic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1085237357 11:75025428-75025450 CAGTTTTCCCAGCTGTACGATGG + Intergenic
1085502522 11:77037164-77037186 AGGTTTTTCCAGCTGCGGGAGGG + Intronic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1091202054 11:133788547-133788569 AGGGATTTCTAGCTGGAGGATGG - Intergenic
1091999047 12:5018064-5018086 CGGTGTTGCCAGCTGGTGGTGGG - Intergenic
1092555406 12:9555065-9555087 AGGTTATTCAAGCTGGAGGGAGG + Intergenic
1092566417 12:9671042-9671064 CCGCATTTCTAGCTGGAGGATGG - Intronic
1094516692 12:31135617-31135639 AGGTTATTCAAGCTGGAGGGAGG - Intergenic
1099946216 12:89247701-89247723 CTGTTTTTCCAACAGGAAGAAGG - Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1101566181 12:105907772-105907794 CAGTTTTCCCATCTGGAAGAAGG - Intergenic
1102760288 12:115379296-115379318 CAGTTTTTCCAGCTGGAAAATGG - Intergenic
1103163365 12:118749629-118749651 CAGTTCTTCCAGGTGGAGGTTGG - Intergenic
1103950733 12:124549667-124549689 CGGTTTCCCCATCTGGAGAAGGG - Intronic
1103991871 12:124804784-124804806 CGCCATTGCCAGCTGGAGGACGG + Intronic
1104351035 12:128044179-128044201 AGTTTTCTCCAGCTGGAGAAAGG + Intergenic
1111431946 13:88156995-88157017 CTGGTTTTCCAGCTTGTGGATGG - Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1111476028 13:88748936-88748958 TGGCTTTTTCACCTGGAGGAAGG + Intergenic
1113765566 13:112878757-112878779 CAGTCTTTCCAGCTGCAGAATGG - Intronic
1115762553 14:36589961-36589983 GGCTTTTACCAGTTGGAGGATGG + Intergenic
1116596408 14:46852672-46852694 AGGTTTTTCCATGTGGTGGATGG - Intronic
1121134204 14:91480296-91480318 CGGTTTCCCCATCTGAAGGATGG - Intronic
1121660274 14:95630049-95630071 GGGTTTGACCAGCTGAAGGAGGG + Intergenic
1122738111 14:103855446-103855468 CGGATTTTCCAGCGGGAGGGAGG - Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1124319486 15:28702554-28702576 TGGATTTTCCTGCGGGAGGACGG + Exonic
1124994896 15:34713887-34713909 AGGTTTTCCAAGCTGGGGGAAGG + Intergenic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128788698 15:70416793-70416815 CAGTTTTTCCAACTGGAAAACGG + Intergenic
1129711840 15:77824362-77824384 CTGGTTTTCCAGCTGTAGAAGGG + Intergenic
1131768320 15:95705476-95705498 AACTTATTCCAGCTGGAGGAAGG - Intergenic
1132396629 15:101479620-101479642 CTGGTTTCCCATCTGGAGGACGG + Intronic
1133296173 16:4753546-4753568 CGGTTTCCCCATCTGCAGGATGG - Intronic
1133490261 16:6261325-6261347 CAGTTTTTCCATCTTGAGGAAGG + Intronic
1133769659 16:8860352-8860374 CGGTAAATCCAGCTGGAGGGCGG + Intronic
1135918026 16:26623638-26623660 CAGTTTTCCCATCTGGAGAATGG - Intergenic
1141096381 16:81165895-81165917 CAGTTTTCCCAGCAGGAGGGTGG + Intergenic
1141809125 16:86362684-86362706 CCGTCTTTCCACCTGGAGCAGGG + Intergenic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1148149462 17:45388094-45388116 CAGTTTTTTCACCTGGAGAATGG - Intergenic
1152224335 17:79085769-79085791 CTGTTTGTCCAGCTGGAGTGGGG + Intronic
1153592213 18:6685502-6685524 CCGTCTTTCCTGCTGGATGATGG + Intergenic
1156039436 18:32803849-32803871 CCGTTGTTCCAGCAGAAGGAAGG + Intergenic
1157286063 18:46378297-46378319 CGGTTTTCCCATCTGTAGTATGG - Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1160345027 18:78125067-78125089 CGGCTCTTCCAGCAGGAGGGCGG + Intergenic
1160657898 19:282661-282683 CAGTTTTTCCAGCTGTAAAATGG - Intronic
1160935792 19:1593850-1593872 CAGTTTCTCCAGCTGGAGGCAGG - Intergenic
1163286478 19:16351640-16351662 GGGGTTTTCCTGCAGGAGGAAGG + Intergenic
1165486846 19:36101561-36101583 CAGTTTCCCCATCTGGAGGAGGG - Intronic
1166361096 19:42253415-42253437 TGGGTTTTCCGGCTGGGGGAGGG - Intronic
1166552334 19:43674515-43674537 CAGTTTTCTCAGCTGGAGAAGGG + Intergenic
1167381592 19:49141409-49141431 AGGGTGTTCCAGCTGGAGGCAGG - Exonic
1167983008 19:53291403-53291425 CGTGGTTTCCAGCTGGAGGCTGG - Exonic
1168434183 19:56304392-56304414 TGGTTGTGACAGCTGGAGGAGGG + Intronic
925191593 2:1889320-1889342 CGGTGTTTCCAGCTGGGCGAGGG - Exonic
925429479 2:3778668-3778690 CAGTTTCTCCAGATGCAGGATGG - Intronic
925734372 2:6948491-6948513 CAGTTTTCTCAGCTGGATGATGG - Intronic
926412219 2:12616284-12616306 CAATTTTGGCAGCTGGAGGAAGG + Intergenic
926468766 2:13226728-13226750 CGGTGTTTCCAGCTAGAATAAGG - Intergenic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
932297855 2:70641821-70641843 CCCATCTTCCAGCTGGAGGAGGG + Intronic
933225065 2:79738496-79738518 AGGCTTTTCCTGTTGGAGGAGGG + Intronic
934990858 2:98920619-98920641 AGGCTTTTCCAGCTGGGAGAGGG - Intronic
935112075 2:100103997-100104019 CGGTGGTGCCAGCCGGAGGAGGG + Intronic
935546654 2:104406576-104406598 CGGTTTTTCCTTCTGAAGGGTGG + Intergenic
936122897 2:109761154-109761176 CGGTGGTGCCAGCCGGAGGAGGG - Intergenic
936221791 2:110610310-110610332 CGGTGGTGCCAGCCGGAGGAGGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936972710 2:118190190-118190212 CGGTTTTTCCATCTGTAAAATGG + Intergenic
938787847 2:134648598-134648620 CGTTGTTGCCAGCTGGATGATGG - Intronic
938979714 2:136514560-136514582 GGGTTTTTCCAGCTGGAGGGAGG + Intergenic
940323903 2:152404952-152404974 CAGTTTTTCAAACTGGAGGAAGG - Intronic
940471342 2:154104462-154104484 AGGTTTTTCCCTCTGGAGGCTGG - Intronic
943528627 2:189050640-189050662 CGGTCGTTCCAGCTGGACCAGGG + Exonic
945569545 2:211448323-211448345 TGGATTTTCCAGCTTGAAGAAGG + Intronic
946563567 2:220939829-220939851 CAGGTTTTTCAGCTTGAGGATGG - Intergenic
948975901 2:241463795-241463817 CCTTGGTTCCAGCTGGAGGAAGG - Intronic
1169305990 20:4490843-4490865 CAGTTTCTGCAGCTGGAGCAGGG - Intergenic
1172117296 20:32580747-32580769 CAGTTTTCCCATCTGGAAGATGG + Intronic
1173487858 20:43454925-43454947 TGGTTGTCACAGCTGGAGGAGGG - Intergenic
1174393314 20:50231492-50231514 AGGTTGCTCCAGCTGGAGGGAGG + Intergenic
1175749109 20:61482947-61482969 AGGTTTGTGCAGCTGGAAGATGG + Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1181738223 22:24898589-24898611 CCTTCTTTCCAGCTGCAGGAGGG + Intronic
1182079832 22:27521139-27521161 CAGTTTTCCCAGCTGCAGAATGG - Intergenic
1183320656 22:37163351-37163373 CACCCTTTCCAGCTGGAGGATGG - Intronic
1183830620 22:40416778-40416800 CAGTGCTTCCAGCTGAAGGACGG + Intronic
949149600 3:750116-750138 CAGTTTTTCCATTTGGGGGATGG - Intergenic
949938722 3:9136963-9136985 TGGTTTTCCCATCTGCAGGATGG + Intronic
950667865 3:14508169-14508191 CAGTTTTCCCACCTGGAGAATGG + Intronic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
953168031 3:40482614-40482636 CTGATATTCCAGCTGGAGCAAGG + Exonic
953562007 3:43999065-43999087 CGGCTTTTCCAGGAGGAAGATGG + Intergenic
955397369 3:58566684-58566706 TGGTTTTTCCAGCTGAAGGAGGG + Exonic
956091134 3:65668156-65668178 CAGTTTTTCCATCTGCAAGATGG + Intronic
956770588 3:72522724-72522746 AGGGTTTCCAAGCTGGAGGAGGG - Intergenic
957319311 3:78608589-78608611 CGGTTATTCCGGCTGCAGTATGG + Intronic
957950009 3:87112324-87112346 CGGTTTTCCAGGCTTGAGGATGG + Intergenic
960896460 3:122511296-122511318 TTGTTTTTCCAGCGTGAGGAGGG - Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
962692852 3:137918212-137918234 CTGTTTTTCCAACTGGGAGAAGG + Intergenic
965439050 3:168690865-168690887 TGGCTTTTGCAGTTGGAGGAGGG + Intergenic
965632600 3:170748423-170748445 CGTTGTTTCCAGATGGAGGTAGG + Intronic
966508840 3:180737570-180737592 CGGTTTTTCCACCTGGAAAATGG - Intronic
967003915 3:185365465-185365487 CGGTTTTGCCATCTGAAGTATGG - Intronic
967479186 3:189954868-189954890 GGCTTTGTCCAGCTGGTGGAAGG - Intergenic
969117285 4:4878585-4878607 CAGTTTTTTCATCTGGATGATGG + Intergenic
969308263 4:6337704-6337726 CGGTTTTTCCTGCTGGAGGCTGG - Intronic
969878214 4:10151675-10151697 TGGTTTCCCCAGCTGGTGGAAGG - Intergenic
972410150 4:38785629-38785651 CAGTTTTTCCATCTGGCGAATGG - Intergenic
973848109 4:54933824-54933846 GTGTTCTTCCAGCTGGATGAAGG - Intergenic
973982580 4:56318387-56318409 CTGTTTGTCCTGCTGGATGAGGG + Intronic
979835695 4:125364710-125364732 AGGTTTTTTCAGCTGGTGCATGG + Intronic
980851743 4:138390594-138390616 CTGGTTTTGAAGCTGGAGGAAGG + Intergenic
981088594 4:140709390-140709412 CAGTTTTGCCAACTGGGGGACGG + Intronic
981818117 4:148854721-148854743 GGGTTCTCACAGCTGGAGGAAGG - Intergenic
982157695 4:152537441-152537463 AAGTCTTTCCACCTGGAGGAGGG + Intergenic
982943239 4:161585205-161585227 TGGGTTTCCCAGCTGGAGCATGG + Intronic
983965948 4:173810120-173810142 GGGTTTTTGCAGCTGGAAAAGGG + Intergenic
984760300 4:183357468-183357490 CCCTTCTCCCAGCTGGAGGATGG + Intergenic
985480157 5:105026-105048 CTGTTTTTCCACCTTCAGGATGG - Intergenic
986718093 5:10538455-10538477 TGGTTCTTCCAGGTGGAGGTGGG - Intergenic
987046762 5:14116047-14116069 CTGGTTCTCCAGCTTGAGGATGG - Intergenic
988551723 5:32206243-32206265 CAGTTTCTCCATCTGGAGAATGG - Intergenic
990707982 5:58551705-58551727 TGGTTTCTGCAGCTGGAAGATGG - Intronic
997492417 5:134288786-134288808 CAGTTTTCCCAGCTGGATAATGG - Intronic
997894460 5:137703779-137703801 AGATATTTCCAGGTGGAGGAGGG - Intronic
1000327355 5:160182412-160182434 CGGTTTTTACATCTGTAGAATGG - Intergenic
1000829694 5:166087327-166087349 CTGTTTTTCAGGCAGGAGGAAGG + Intergenic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1006082872 6:31577427-31577449 GGGGTCTTCCAGCTGGAGAAGGG + Exonic
1006679590 6:35787491-35787513 CGGGTGTTCCTGGTGGAGGATGG + Intronic
1011165638 6:84442849-84442871 CTCTTGTTCCAGCTAGAGGAGGG + Intergenic
1011950784 6:92960795-92960817 GGGTTGTTCCAGCTGAAGCAAGG + Intergenic
1018703364 6:166445517-166445539 TGGTTTTTCCAGCTGGGACAGGG - Intronic
1019488885 7:1301882-1301904 CGGTTTCTCCTTCTGGATGATGG + Intergenic
1019917522 7:4143327-4143349 GGGTCTTGCCAGCTGGAGGAGGG + Intronic
1022398254 7:30010288-30010310 TGGTTTTTCGAGGGGGAGGAGGG - Intergenic
1023821022 7:43980552-43980574 CAATTTTGCCAGCTGGAGAAGGG - Intergenic
1026327998 7:69327589-69327611 CAGCTGTTCCAGCTGGAGGATGG + Intergenic
1027328276 7:77065022-77065044 CAATTTTGCCAGCTGGAGAAGGG + Intergenic
1028345730 7:89779858-89779880 AGGCTTTTTCAGCTGGAGGGTGG - Intergenic
1029749295 7:102533991-102534013 CAATTTTGCCAGCTGGAGAAGGG - Intergenic
1029767238 7:102633095-102633117 CAATTTTGCCAGCTGGAGAAGGG - Intronic
1031063467 7:117077318-117077340 CAGGTTTTTCAGCTGGAGGGTGG + Intronic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1032696861 7:134344643-134344665 CTGTGTTTTCAGCTAGAGGAAGG + Intergenic
1034486410 7:151366980-151367002 CACTATATCCAGCTGGAGGACGG - Exonic
1034944039 7:155250552-155250574 AGTTTTCTCCAGCAGGAGGAAGG + Intergenic
1035167358 7:156999835-156999857 CGGTTTACCCAGCTGGGGGCAGG - Intronic
1035588304 8:794006-794028 GGGTGTTTCTAGCTGCAGGATGG + Intergenic
1035588427 8:794793-794815 CGGTGTTTCTAGCTGCAGGATGG + Intergenic
1035588445 8:794872-794894 GGGTATTTCTAGCTGCAGGACGG + Intergenic
1037990483 8:23318525-23318547 CATTTTTTTCATCTGGAGGATGG - Intronic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1041053974 8:53963697-53963719 TTGTTTATCCAGCTGGAGGATGG - Intergenic
1041644068 8:60233618-60233640 CTGTTGTTGCAGCTGGAGAAGGG - Intronic
1041731058 8:61063397-61063419 GGTATTTTCCAGCTGGAGGGTGG + Intronic
1042725325 8:71868869-71868891 GGGTCTTTCCAGCTTGTGGATGG + Intronic
1043413725 8:80027978-80028000 CAGTTTTTCCAGGAGGAGGCTGG - Intronic
1047451310 8:124967363-124967385 CAGAACTTCCAGCTGGAGGATGG - Intergenic
1047945174 8:129869826-129869848 CTGTACTTCCAGCTTGAGGAAGG - Intronic
1048353268 8:133633022-133633044 CAGCTATTCCAGTTGGAGGATGG + Intergenic
1048843475 8:138584872-138584894 CTCCTCTTCCAGCTGGAGGAAGG - Intergenic
1049843352 8:144787963-144787985 CGGTGTTTCCTCCTGAAGGATGG - Intergenic
1049939667 9:533361-533383 CTGTTTTTCCATCTGAAGAATGG + Intronic
1053022926 9:34708340-34708362 AGGTTTTTCCATCTGGAAGGAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055609648 9:78008479-78008501 CAGTTTTTCCAGTTGGATGGTGG - Intronic
1060149962 9:121282196-121282218 CGGTTTCTCCACCTGTAGGATGG + Intronic
1060333406 9:122697649-122697671 TGGCTGTTCCAGCTGGAGTAAGG - Intergenic
1060957194 9:127650612-127650634 CTGTTTTTAGAGCTTGAGGAGGG + Intronic
1061257204 9:129459957-129459979 CAGTTTTTCCATCTGGGGAATGG + Intergenic
1061432755 9:130541721-130541743 CAGTTTCTCCAGCTGTAAGATGG + Intergenic
1061763094 9:132863898-132863920 AATTATTTCCAGCTGGAGGACGG + Intronic
1187397076 X:18928047-18928069 CCGTTTTTCCACCTGCAGGCTGG - Intronic
1187942194 X:24392882-24392904 GGCTTTTTCCAGCTGCAGGGGGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195666897 X:107440039-107440061 GGGATGTTCTAGCTGGAGGAGGG - Intergenic
1196698086 X:118635286-118635308 CGATTTTTACAGTTAGAGGAGGG + Intronic
1198722030 X:139633482-139633504 AGGCTTTGCCAGCTGGGGGAAGG - Intronic
1200129252 X:153831974-153831996 CGGTCTCTGCAGCTGGTGGATGG + Intergenic