ID: 1145904926

View in Genome Browser
Species Human (GRCh38)
Location 17:28511065-28511087
Sequence CAGGGAACAATCTCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145904921_1145904926 19 Left 1145904921 17:28511023-28511045 CCAGCACCTGGAGGAAGGAGCAG 0: 1
1: 1
2: 4
3: 56
4: 447
Right 1145904926 17:28511065-28511087 CAGGGAACAATCTCTCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 130
1145904919_1145904926 21 Left 1145904919 17:28511021-28511043 CCCCAGCACCTGGAGGAAGGAGC 0: 1
1: 0
2: 9
3: 38
4: 400
Right 1145904926 17:28511065-28511087 CAGGGAACAATCTCTCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 130
1145904920_1145904926 20 Left 1145904920 17:28511022-28511044 CCCAGCACCTGGAGGAAGGAGCA 0: 1
1: 0
2: 3
3: 48
4: 368
Right 1145904926 17:28511065-28511087 CAGGGAACAATCTCTCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 130
1145904922_1145904926 13 Left 1145904922 17:28511029-28511051 CCTGGAGGAAGGAGCAGCGCACA 0: 1
1: 0
2: 2
3: 23
4: 322
Right 1145904926 17:28511065-28511087 CAGGGAACAATCTCTCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 130
1145904917_1145904926 27 Left 1145904917 17:28511015-28511037 CCATAGCCCCAGCACCTGGAGGA 0: 1
1: 0
2: 1
3: 36
4: 328
Right 1145904926 17:28511065-28511087 CAGGGAACAATCTCTCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 130
1145904915_1145904926 28 Left 1145904915 17:28511014-28511036 CCCATAGCCCCAGCACCTGGAGG 0: 1
1: 1
2: 1
3: 73
4: 916
Right 1145904926 17:28511065-28511087 CAGGGAACAATCTCTCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145904926 Original CRISPR CAGGGAACAATCTCTCCCAC TGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900779888 1:4611351-4611373 CAGAGCTCAGTCTCTCCCACAGG - Intergenic
901815731 1:11792379-11792401 CAGGCACCTGTCTCTCCCACAGG - Exonic
901946261 1:12706493-12706515 CAGGGGACAATCTGGCCCTCTGG + Intergenic
908234850 1:62139007-62139029 CAGGGAACCTTTGCTCCCACTGG + Intronic
908398838 1:63751263-63751285 CAGGGAATAATCACTTCCCCCGG + Intergenic
908787586 1:67750289-67750311 CAGGGAACATGTTCTCCCAGTGG + Intronic
910328201 1:86035859-86035881 CAGAGAACAGTTTCTCCCACTGG - Intronic
915627761 1:157126073-157126095 CAGGAAACAATCATTCCAACTGG + Intronic
917483329 1:175432139-175432161 CAGAGGACAATCTGTCCCAGAGG + Intronic
923360333 1:233204893-233204915 GAGGGAACATTCTTTTCCACTGG - Intronic
924955586 1:248923549-248923571 CAGCGAGCTTTCTCTCCCACTGG + Intergenic
1063133390 10:3197073-3197095 CGGGGAACATTCCCGCCCACTGG + Intergenic
1064236470 10:13580709-13580731 CAGGGACCAGTCTCGGCCACAGG - Intergenic
1064278974 10:13933578-13933600 CAGGGGTCACTCTATCCCACTGG + Intronic
1067422822 10:46171755-46171777 CAGGGACTATTCTCTCACACTGG + Intergenic
1068086654 10:52381832-52381854 AAGGGAGCAATCACTCCCGCTGG + Intergenic
1068347539 10:55801483-55801505 CAGGGACCATTCTCTCACACTGG - Intergenic
1068863931 10:61874981-61875003 CAGCCAGCAATCTCTGCCACAGG - Intergenic
1075061087 10:119257321-119257343 AAGAGAACATTCTCTCCCATAGG + Intronic
1075124810 10:119691234-119691256 CAGGGAAAATTGTATCCCACAGG + Intergenic
1076883636 10:133251672-133251694 CAGGGACCCACCTCACCCACTGG + Intergenic
1082789322 11:57336240-57336262 GAGGAAACGACCTCTCCCACTGG + Intergenic
1083029139 11:59575980-59576002 TATAGAACAATCTCTCTCACAGG + Exonic
1084352882 11:68615926-68615948 CAGGGCACAAGCTCTCCAGCCGG + Intergenic
1085027171 11:73243035-73243057 CAGGGAATGATCTCTACCCCTGG - Intergenic
1085322422 11:75583326-75583348 CAGGGCACTATCCTTCCCACCGG + Intergenic
1085529113 11:77181302-77181324 CAGGGAACAAGCTCTCCCTGGGG - Intronic
1090654629 11:128833457-128833479 CTGGGCAGACTCTCTCCCACTGG + Intergenic
1092647408 12:10591223-10591245 CAGGGAAGATTCTCTCTTACAGG - Intergenic
1096415120 12:51406256-51406278 CAGGCCAAAATCTCTCCCTCGGG - Intronic
1096609579 12:52792053-52792075 CAGGCAACCATCTCCCCCAGGGG + Intronic
1096753153 12:53776109-53776131 TAGGAAACAGTCTCTCCCAAAGG - Intergenic
1097375839 12:58841372-58841394 CAGTGAACAGTCTGTCTCACTGG + Intergenic
1098088505 12:66874823-66874845 CATGGAACAGTTTTTCCCACTGG - Intergenic
1107097664 13:36553668-36553690 CAGGGCAGAATCTCTCCAGCTGG + Intergenic
1107390551 13:39958616-39958638 CTGGGAAAAGCCTCTCCCACTGG + Intergenic
1108123884 13:47219839-47219861 CAGGAAAAAATTTCTCCTACAGG - Intergenic
1110493268 13:76134863-76134885 AAGGAAATGATCTCTCCCACTGG - Intergenic
1112665308 13:101565013-101565035 CATGGAACAGTTTCTCCCTCAGG + Intronic
1116752621 14:48905685-48905707 TAGGGAAAGATCTCTCTCACGGG + Intergenic
1116941402 14:50794838-50794860 CAGGGAACCATTTCATCCACCGG - Intronic
1118186838 14:63545306-63545328 CAGAGAACAATTTCTCACATAGG - Intergenic
1118316530 14:64729379-64729401 CAGGGAAGGTTCTCTTCCACAGG - Intronic
1122415238 14:101546487-101546509 CAGCCAGCAATCTCTGCCACTGG + Intergenic
1129878916 15:78994485-78994507 CATGGCACAATCTCTGCCTCTGG + Intronic
1132146090 15:99430875-99430897 CAGGGAGAAATCTCTCTCCCGGG + Intergenic
1132953666 16:2579257-2579279 CAGAGGACAGTCCCTCCCACAGG + Intronic
1132960685 16:2620910-2620932 CAGAGGACAGTCCCTCCCACAGG - Intergenic
1134840586 16:17398663-17398685 CATGGAACATTCTTTCTCACAGG - Intronic
1136403755 16:30031570-30031592 CAGGGAACGCTCTCTTCCGCTGG - Intronic
1137238946 16:46638539-46638561 AATGGAACAACCTCTCCCTCGGG + Intergenic
1140326330 16:74006287-74006309 CTTGGAACAAACTCTCCCTCTGG + Intergenic
1141165184 16:81655543-81655565 CAGGGAGCCTTCTCTCCCCCAGG - Intronic
1141247190 16:82318914-82318936 AAGGGAACAATTTCTACCAAAGG + Intergenic
1143463969 17:7123302-7123324 CTGGCAACCAGCTCTCCCACGGG - Intergenic
1144021568 17:11243027-11243049 CAGGGAACAAACCCTGCCCCGGG + Intronic
1144037934 17:11384073-11384095 AAGGTAACGAGCTCTCCCACAGG - Intronic
1145904926 17:28511065-28511087 CAGGGAACAATCTCTCCCACTGG + Intronic
1147594332 17:41706806-41706828 CAGGGAACAGTCTCCTTCACAGG + Intergenic
1151453944 17:74215060-74215082 CAGGGAACACAGACTCCCACAGG - Intronic
1157079371 18:44506221-44506243 TAGGGATCATTCTCTCCCAATGG + Intergenic
1157181613 18:45503295-45503317 CAGGGAACAAGCTCTACAAGGGG + Intronic
1158181507 18:54720738-54720760 CAGTAAACACTGTCTCCCACAGG - Intronic
1158727172 18:59984065-59984087 CAGGGAACAACAACTACCACGGG - Intergenic
1160713302 19:563435-563457 CAGTCAACCATCTCACCCACTGG - Intergenic
1161322140 19:3646221-3646243 CAGGGAACAGTGGCTCCCTCTGG + Intronic
925477070 2:4229398-4229420 GAGGAAACACTCTCTCCCTCAGG + Intergenic
925807150 2:7661592-7661614 CAGGGAGCCAGATCTCCCACAGG - Intergenic
929856241 2:45640660-45640682 CAGTGAGCAACGTCTCCCACTGG - Intergenic
930375560 2:50561577-50561599 CAAGGAACAAACTCTGCCATAGG + Intronic
932441747 2:71741766-71741788 CATGGAAAACTGTCTCCCACAGG - Intergenic
933951099 2:87330577-87330599 CAAAGCACAATTTCTCCCACTGG - Intergenic
934163598 2:89274420-89274442 CAGGGAACATTCTATGCCATGGG + Intergenic
934203675 2:89908104-89908126 CAGGGAACATTCTATGCCATGGG - Intergenic
936328678 2:111528001-111528023 CAAAGCACAATTTCTCCCACTGG + Intergenic
937098485 2:119250864-119250886 CAGGCAACCATCCCTCCCGCAGG + Intronic
937255620 2:120553334-120553356 TAAGGAACAATCTCATCCACAGG + Intergenic
941477760 2:165969413-165969435 GAGGGAACAATGTCCCCCAGTGG - Intergenic
943471637 2:188301634-188301656 CAAGGAACAATCACTGCCAAGGG - Intronic
944523896 2:200598907-200598929 CAGGCAAAATTCTCTCCCTCTGG - Intronic
945155791 2:206835735-206835757 CAGAGAACAATCTCTGCAGCAGG + Intergenic
946201975 2:218075819-218075841 CTGGGACCATTCCCTCCCACGGG + Intronic
1173457037 20:43211228-43211250 CAGGGAACTAACACCCCCACTGG + Intergenic
1174361223 20:50029963-50029985 CAGAGAACACTCTCTCCACCAGG - Intergenic
1174564265 20:51453362-51453384 CAGTGCACAATCCCTCCAACTGG + Intronic
1180736575 22:18022228-18022250 CAGGGTAAAATCTTCCCCACAGG - Intronic
1181763562 22:25075128-25075150 CAGGGGAAAATCACCCCCACTGG - Intronic
1183282548 22:36939438-36939460 CAGGCAACTCTCCCTCCCACCGG + Exonic
1183483067 22:38075370-38075392 CAGAGACCAAGCTCTCCCTCTGG - Exonic
1184889757 22:47372434-47372456 CAGGGAACACACCCACCCACAGG - Intergenic
949716484 3:6937573-6937595 CATTGAAAATTCTCTCCCACAGG + Intronic
949842994 3:8340401-8340423 CATTTAAAAATCTCTCCCACTGG + Intergenic
950567199 3:13777034-13777056 CAAGGAACAAATGCTCCCACTGG + Intergenic
955726365 3:61937192-61937214 CAGAAAGCAATCTCTCACACAGG - Intronic
956348074 3:68302696-68302718 CAGGAAGCAGTCTCTCCTACAGG + Intronic
961714208 3:128847619-128847641 CAGGGCACCATCTCTTCCTCCGG - Intergenic
962978096 3:140463727-140463749 CAGGGAACCTGCTCTCCCTCTGG - Intronic
964493371 3:157261277-157261299 CAGGGACCGCTCTCTCCCCCGGG - Exonic
970363835 4:15337850-15337872 CTGGGAACAACTTCTCCCACTGG - Intergenic
972083219 4:35181432-35181454 CCAGGAAGAATGTCTCCCACTGG + Intergenic
977290002 4:95154849-95154871 CATGGATCAATCTCTCCTTCTGG - Exonic
979632590 4:122920959-122920981 TATGGAAAAATCTCTCACACTGG - Intronic
986060076 5:4179736-4179758 CACTGAACAAACTCTCCCAGTGG + Intergenic
989305282 5:39948076-39948098 CAGGGACTAATCTCTCACAGTGG - Intergenic
996642570 5:125774551-125774573 CTGGGACCAATCTCTTCCTCTGG + Intergenic
999531055 5:152464044-152464066 GGGGGAAAAATCTTTCCCACTGG - Intergenic
1001256725 5:170189157-170189179 CAGGGAGCCATCTCTTCCCCTGG + Intergenic
1001686293 5:173597224-173597246 CAGGGAACAAGCTCTGGCTCTGG + Intergenic
1002870540 6:1163539-1163561 AAGGGAATAATCTGACCCACAGG + Intergenic
1003320277 6:5044961-5044983 CAGGTAATAATCTCTCCAGCTGG + Intergenic
1007000763 6:38310215-38310237 GAGGGAACAACTTGTCCCACTGG + Intronic
1008777925 6:55063138-55063160 AAGGGAATATTCTCTCCTACAGG + Intergenic
1015617606 6:135093807-135093829 CAGGGGACAAACACTCCCACAGG + Intronic
1020278769 7:6639449-6639471 CAGGGAACTGTGTCACCCACTGG + Intronic
1024955011 7:54909009-54909031 CATGGAACAATCACTAACACAGG + Intergenic
1028253749 7:88566547-88566569 CAGCAAACAATCTCTCTCCCTGG - Intergenic
1029195555 7:98802865-98802887 CAGAGAACAATCCCACCCCCAGG + Intergenic
1030506676 7:110433344-110433366 AAGGGAAAAATCACTCTCACTGG - Intergenic
1032284403 7:130530006-130530028 CTGGGCATACTCTCTCCCACTGG - Intronic
1033353674 7:140582612-140582634 GAGGGAACAACCTATCCCAAAGG - Intronic
1034944302 7:155251987-155252009 AATGGCACAATCTCTCCCAGGGG + Intergenic
1035391529 7:158507788-158507810 CAGGGAACAGCCTCTGCAACAGG + Intronic
1036199723 8:6758730-6758752 CATGGAACAATATATCCCATGGG + Exonic
1037583977 8:20263795-20263817 CAGGGAACAGTGTCTCCCGAAGG + Intronic
1039440633 8:37592870-37592892 CAGGGAACAATCTATACAATGGG + Intergenic
1046740422 8:117821853-117821875 GAGGGATAAATCTCTACCACCGG - Intronic
1047673643 8:127175713-127175735 CCAGGAACAATCTCTACCAGTGG + Intergenic
1048882260 8:138880927-138880949 CAGGGCACATTTTCTCCCAGAGG + Intronic
1057571275 9:96205986-96206008 AAGGGAACCATCTCAGCCACAGG - Intergenic
1059899057 9:118902120-118902142 GAGGGAACAATCTCTCCCTTTGG + Intergenic
1062566592 9:137166416-137166438 CAGGGACCAGTCTGGCCCACAGG + Intronic
1186190098 X:7059853-7059875 CATGGAAAAATCACTCACACAGG - Intronic
1187496869 X:19802912-19802934 AGGGCACCAATCTCTCCCACAGG + Intronic
1189195355 X:39147907-39147929 CAGGGCACAATCTAGCCCACTGG - Intergenic
1190870379 X:54420120-54420142 CAGGGAACAATCTGTTCCCCTGG - Intergenic
1191165819 X:57390439-57390461 CAGTGAACATTTTATCCCACAGG + Intronic
1198536745 X:137594173-137594195 CAGGCACCAATGTCCCCCACTGG - Intergenic
1201562278 Y:15330979-15331001 CATGGAAAAATCACTCACACAGG - Intergenic