ID: 1145907321

View in Genome Browser
Species Human (GRCh38)
Location 17:28523619-28523641
Sequence GCTGGGAGCCGGGGTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 335}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145907309_1145907321 29 Left 1145907309 17:28523567-28523589 CCTTCTCTGTAGACACAGGAGAC 0: 1
1: 0
2: 0
3: 33
4: 272
Right 1145907321 17:28523619-28523641 GCTGGGAGCCGGGGTTTCACTGG 0: 1
1: 0
2: 2
3: 69
4: 335
1145907312_1145907321 7 Left 1145907312 17:28523589-28523611 CCGATCTTGAGGAGCCAGAGGCA 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1145907321 17:28523619-28523641 GCTGGGAGCCGGGGTTTCACTGG 0: 1
1: 0
2: 2
3: 69
4: 335
1145907315_1145907321 -7 Left 1145907315 17:28523603-28523625 CCAGAGGCAGAGCCCAGCTGGGA 0: 1
1: 0
2: 7
3: 56
4: 487
Right 1145907321 17:28523619-28523641 GCTGGGAGCCGGGGTTTCACTGG 0: 1
1: 0
2: 2
3: 69
4: 335
1145907308_1145907321 30 Left 1145907308 17:28523566-28523588 CCCTTCTCTGTAGACACAGGAGA 0: 1
1: 0
2: 3
3: 22
4: 283
Right 1145907321 17:28523619-28523641 GCTGGGAGCCGGGGTTTCACTGG 0: 1
1: 0
2: 2
3: 69
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145907321 Original CRISPR GCTGGGAGCCGGGGTTTCAC TGG Intronic
900437320 1:2637357-2637379 GCTCGGAGGTGGGGTTTCACTGG + Intronic
900488302 1:2933924-2933946 GCTGGGAGCCGGGGGATCACAGG - Intergenic
901066893 1:6498522-6498544 GCTGGGTGCTGGGGACTCACTGG + Intronic
901673796 1:10871118-10871140 GCTGGGGGCGGGGGTTTCTTGGG + Intergenic
902676691 1:18013584-18013606 GGTGGGAGCCAGGGCTGCACGGG + Intergenic
903161232 1:21490591-21490613 GCTTGAAGCTGTGGTTTCACCGG - Intergenic
903240837 1:21981510-21981532 GCTGGGAGCCCAGGATGCACTGG - Intronic
903244574 1:22006150-22006172 GCTGGGAGCCCAGGATGCACTGG - Intronic
904449352 1:30600993-30601015 GCTTGGAGGCGGGGTTTCTCTGG - Intergenic
906882126 1:49603109-49603131 GCTAGGAGCAGGGGTTTGAAAGG - Intronic
907466556 1:54641688-54641710 GGTGGGAGCAGGGGTCTCATTGG + Intergenic
907614786 1:55912908-55912930 GCTTGAAGGCGGGGCTTCACTGG - Intergenic
907615897 1:55926596-55926618 GCTTGGAGGTGGGTTTTCACTGG - Intergenic
909801012 1:79806884-79806906 GCTTGAAGATGGGGTTTCACTGG + Intergenic
909926180 1:81440251-81440273 GCTTGAAGGTGGGGTTTCACCGG + Intronic
910036038 1:82790470-82790492 GCTTGGAGGTAGGGTTTCACTGG - Intergenic
911610460 1:99954623-99954645 GCTTGGAGGAGGGGTTTCACTGG - Intergenic
917098314 1:171421965-171421987 GCTTGAAGGAGGGGTTTCACTGG + Intergenic
917371922 1:174301965-174301987 GCTTGAAGGTGGGGTTTCACTGG + Intronic
918069150 1:181122352-181122374 GCTGGGCCCCGGGTTTTCCCAGG + Intergenic
919299598 1:195743651-195743673 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
920259733 1:204680696-204680718 GCTGGGAGCTGGGCTTCCAGTGG - Intronic
921650780 1:217675070-217675092 GCTTGAAGGTGGGGTTTCACTGG + Intronic
922722008 1:227904135-227904157 GCTGGGAGCCGGGATGTCACAGG - Intergenic
922766658 1:228159562-228159584 GCTGGGAGCCTGGGGTGGACAGG + Exonic
923088517 1:230720517-230720539 GCTTGGAGGCGGGATTTCACCGG - Intergenic
924362303 1:243254820-243254842 CCTGGGACCCGGGGCTTGACGGG - Intronic
1063100438 10:2945489-2945511 GCTGTGATCAGGGGTGTCACAGG + Intergenic
1063537744 10:6901288-6901310 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1065196371 10:23270276-23270298 GCTGGGGGCAGGGGTTTCTTTGG - Intronic
1067266340 10:44748592-44748614 GCTTGAAGATGGGGTTTCACTGG + Intergenic
1068461640 10:57337056-57337078 GGTGGGAGCCGGGGCTGCACTGG - Intergenic
1068474402 10:57507063-57507085 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1069156606 10:65037645-65037667 GCTGGAAAGTGGGGTTTCACTGG - Intergenic
1069610137 10:69767430-69767452 GCTGGGAGAGGGGGTAGCACAGG + Intergenic
1069769937 10:70891775-70891797 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1069898068 10:71691117-71691139 GCTGGGGGCAGGGGGCTCACAGG - Intronic
1070420634 10:76233103-76233125 GCTTGGAGGTGGGATTTCACCGG + Intronic
1070428770 10:76315728-76315750 GCTTGAAGGTGGGGTTTCACTGG - Intronic
1071068918 10:81669378-81669400 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1072361658 10:94664768-94664790 GCTGGGAGTGGGGGTTCCCCTGG + Intergenic
1072628320 10:97128532-97128554 TCTGGGAGCAGGAGTTTAACAGG + Intronic
1073268140 10:102240860-102240882 GCTGGGAGCCGGGGTGCGCCTGG - Intronic
1073640020 10:105242031-105242053 GCTTGGAGGTGGGGTTTCACTGG + Intronic
1074214365 10:111369845-111369867 GTTGGGAGCAGGGGTTATACTGG - Intergenic
1074745586 10:116528887-116528909 GCTTGGAGGTGGGATTTCACCGG - Intergenic
1074843387 10:117375877-117375899 GCTGCCAGCCGGGCTGTCACGGG - Intergenic
1075015765 10:118909055-118909077 GCTGGGAGGCAGGGGTGCACGGG - Intergenic
1075265322 10:120996073-120996095 GCTTGGAGGTGGGGATTCACGGG - Intergenic
1075697557 10:124447914-124447936 GCGGGGAGCCGGGGGATCCCGGG + Exonic
1075741319 10:124698176-124698198 GCTGGGGGCCGGGGTTCCCCAGG - Intronic
1076591511 10:131586925-131586947 GCAGGGAGCCGAGGCTTCAAAGG + Intergenic
1076909543 10:133380042-133380064 GCTGGAAGACGGGGTTACCCCGG - Exonic
1079391104 11:20022985-20023007 GCTGGGTGCCTGGGATTCCCTGG + Intronic
1080445757 11:32335476-32335498 GTTTGGAGGCGGGGTTTCACCGG + Intergenic
1080853794 11:36094104-36094126 GCTTGGAGGTGGGGTTTCACCGG + Intronic
1081650918 11:44823689-44823711 GCTTGGAGGTGAGGTTTCACCGG + Intronic
1082663778 11:55948984-55949006 GCTTGGAGGTGGGGTTTCACAGG - Intergenic
1083628470 11:64083997-64084019 GCTGGGTTCCGGCCTTTCACTGG + Intronic
1084649332 11:70479495-70479517 TCTGGGACCTGGAGTTTCACAGG + Intronic
1084784047 11:71431356-71431378 GCTTGGAGGTGGGGCTTCACCGG + Intronic
1085199538 11:74693382-74693404 GCTGGGAGAGGGGGTGACACTGG - Intergenic
1085507916 11:77070579-77070601 AATGGGAGCCGGGGTGTCATGGG - Intronic
1086181315 11:83955460-83955482 GCTTGAAGGTGGGGTTTCACTGG - Intronic
1086458845 11:86985679-86985701 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1086850122 11:91798925-91798947 GCTGGAAGGCTGGGTTTTACTGG - Intergenic
1090293560 11:125567319-125567341 GCTTGGAGGTGGGGTTTCAATGG + Intergenic
1090396719 11:126424084-126424106 GTGGGGAGCCGGGGTTTCTGGGG + Exonic
1091055475 11:132414343-132414365 AAGGGGAGCTGGGGTTTCACTGG + Intergenic
1091950439 12:4588498-4588520 GCTGGGTGCCTGTGTTCCACTGG + Intronic
1092491964 12:8953556-8953578 GCTTGGAGATGGGGTTTCACTGG + Intronic
1092698591 12:11201830-11201852 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1093022503 12:14216963-14216985 GCTGGGAGCGTTGGTTTAACTGG + Intergenic
1093514003 12:19964256-19964278 GCTGGGAGCCAGGTTTTGAAAGG - Intergenic
1093592382 12:20918021-20918043 GCTTGGAGGTGGGGTTTCACCGG + Intergenic
1093908487 12:24719492-24719514 GATGGGACTCTGGGTTTCACAGG + Intergenic
1094008804 12:25784860-25784882 GCTGGGAGCCGGGGAATGAGAGG - Intergenic
1094780081 12:33781149-33781171 TCTTGGAGGTGGGGTTTCACTGG - Intergenic
1096610219 12:52795990-52796012 GGCGGGAGCCAGGGTTTCTCCGG - Exonic
1098387556 12:69934953-69934975 GCTTGAAGGTGGGGTTTCACTGG + Intronic
1100236783 12:92669586-92669608 TCTGGGGGCCTGGGTTCCACAGG + Intergenic
1101441599 12:104708349-104708371 GCTGGGAGCAGGGTTGTCAAAGG + Intronic
1103607439 12:122097749-122097771 GCTGGGAGCAGGCATTCCACCGG - Intronic
1103928182 12:124435267-124435289 GCTGGGTGCCCGGGAGTCACAGG - Intronic
1104236023 12:126937218-126937240 GCTTGAAGGCGTGGTTTCACTGG + Intergenic
1104933512 12:132352720-132352742 GCTGGGAGCCGTGATGGCACTGG + Intergenic
1105479051 13:20756624-20756646 TCTTGGAGGCGGGGTTTTACTGG - Intronic
1106308101 13:28531326-28531348 GCCGGGAGCTTGGGTTTCCCGGG + Intergenic
1108782702 13:53855885-53855907 GCTTGGAGGTGGAGTTTCACTGG + Intergenic
1109074846 13:57821648-57821670 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1109406122 13:61902867-61902889 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1110935575 13:81283802-81283824 GCTTGCAGGTGGGGTTTCACTGG - Intergenic
1111141669 13:84127417-84127439 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1111310031 13:86472326-86472348 GCTTAGAGGTGGGGTTTCACTGG + Intergenic
1111466509 13:88619363-88619385 GGTGGCAACCAGGGTTTCACAGG - Intergenic
1111549122 13:89784243-89784265 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1112840607 13:103573074-103573096 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1114354356 14:21891030-21891052 GCTTGAAGGCCGGGTTTCACCGG - Intergenic
1116114046 14:40625406-40625428 GCTTGGAAGTGGGGTTTCACAGG + Intergenic
1116355536 14:43924394-43924416 GCTTGGAGGTGGGGTTTTACTGG - Intergenic
1116380534 14:44262137-44262159 GCTTGGAGGTGGGGTTTCACCGG + Intergenic
1117084699 14:52187717-52187739 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1118240094 14:64047512-64047534 GCATGGAGGTGGGGTTTCACTGG + Intronic
1118648030 14:67858736-67858758 GCTTGGAGGTGGGGTTTCACCGG + Intronic
1118695326 14:68379399-68379421 GCTGGGAGAAGGGGGTGCACTGG + Intronic
1119595895 14:75933571-75933593 GCTGGGAGCAGTGGTCTCATTGG + Intronic
1120030100 14:79631464-79631486 GGTGGGAGTCGGGGCTGCACTGG + Intronic
1120460783 14:84792512-84792534 GCTTGGAGATGAGGTTTCACTGG - Intergenic
1121244248 14:92450900-92450922 TCTGGGAGCCTGGGTTGCTCTGG - Intronic
1123489101 15:20765546-20765568 GCTGGAAGCCTGGGAGTCACAGG - Intergenic
1123545600 15:21334633-21334655 GCTGGAAGCCTGGGAGTCACAGG - Intergenic
1124096153 15:26650549-26650571 GCTTGGAGGTGGGGCTTCACTGG - Intronic
1124226622 15:27900759-27900781 GCCGGGAGCTGGGCATTCACAGG + Intronic
1124483899 15:30099798-30099820 GGGAGGAGCCGGAGTTTCACAGG + Intergenic
1124519680 15:30397426-30397448 GGGAGGAGCCGGAGTTTCACAGG - Intergenic
1124538973 15:30568795-30568817 GGGAGGAGCCGGAGTTTCACAGG + Intergenic
1126437595 15:48651765-48651787 GCTGGAAGCTGAGGCTTCACTGG + Intergenic
1127016543 15:54695164-54695186 GCTTGAAGGCAGGGTTTCACTGG - Intergenic
1128795011 15:70460143-70460165 GCCGGGAGCCAGGGTTTCAGTGG - Intergenic
1129410666 15:75348673-75348695 GCTGGGAGCTGGGGCTGCAGAGG - Intronic
1129676374 15:77634133-77634155 CCTGGGAGAGGGGGTGTCACTGG - Intronic
1129971239 15:79779942-79779964 GCTGGGGGTGGGGGTTTCCCTGG - Intergenic
1132682610 16:1149342-1149364 GCTGGGAGAAGGGGTCTCACTGG + Intergenic
1132730416 16:1358259-1358281 GCTGGGAGTCAGGGTTTGAAGGG - Intronic
1135926760 16:26701705-26701727 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1137976067 16:53033209-53033231 GCTTGGAGGTGGAGTTTCACTGG - Intergenic
1138152384 16:54670579-54670601 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1139586751 16:67908888-67908910 GCTGGGAACCCGGCTTTGACAGG - Exonic
1140950027 16:79808209-79808231 GCTTGGAGATGGAGTTTCACGGG - Intergenic
1141618228 16:85222035-85222057 GCTGGGAGCCTGGGGTACGCAGG + Intergenic
1142292499 16:89199489-89199511 GCTGGCAGCCAGGGCCTCACTGG + Exonic
1142581080 17:943262-943284 GCTGGGAGTCGGTGGTTCGCTGG - Intronic
1142960801 17:3551389-3551411 GCCTGGAGCCAGGGTGTCACTGG - Intronic
1143948863 17:10617347-10617369 GCTGGCAGAAGGGGCTTCACAGG + Intergenic
1145218892 17:21072730-21072752 GCTGGGAGCAGGGGTGCCTCGGG - Intergenic
1145907321 17:28523619-28523641 GCTGGGAGCCGGGGTTTCACTGG + Intronic
1146183436 17:30710683-30710705 GATGGGGGCCGGGGGTGCACTGG - Intergenic
1146509055 17:33430121-33430143 GCGAGGAGCCAGGGTTTCAGTGG - Intronic
1146837770 17:36126045-36126067 GTTTGAAGACGGGGTTTCACTGG + Intergenic
1147360820 17:39928438-39928460 CCTTGGAGGTGGGGTTTCACAGG - Intergenic
1147945565 17:44078360-44078382 GATGGGGGCCGGGGCGTCACAGG + Exonic
1148627049 17:49077606-49077628 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1148778314 17:50108241-50108263 GCTGGGAGCCGGTGCTTTGCGGG + Intronic
1148795420 17:50194598-50194620 CCTGGTAGCCGTGGTTTCCCTGG - Exonic
1148849580 17:50548171-50548193 GCTGGGAGCAGGGGTCCTACTGG + Intronic
1149169447 17:53792176-53792198 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1149469322 17:56902957-56902979 GCTGGGAGCAGGCATGTCACAGG - Intronic
1150451214 17:65270702-65270724 GGTGGGAGCAGACGTTTCACAGG - Intergenic
1150726848 17:67658188-67658210 GCTTGGAAGTGGGGTTTCACTGG - Intronic
1151018546 17:70585163-70585185 GCTTGGTGGTGGGGTTTCACTGG + Intergenic
1151360224 17:73584273-73584295 GCTGGGAGTGAGGGTCTCACTGG + Intronic
1151567020 17:74904391-74904413 GTTGGGGGCCGGGGAATCACTGG + Intergenic
1151635833 17:75347229-75347251 GCTTAGAGGTGGGGTTTCACTGG - Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152650571 17:81490699-81490721 TCTGGGAGCCGGGGACACACAGG - Intergenic
1152679831 17:81661389-81661411 GCTTGAAGGTGGGGTTTCACTGG - Intronic
1152697572 17:81804512-81804534 GCTGGGGGCGGGGGTGTCGCTGG + Intronic
1152820711 17:82436321-82436343 GCTGGGAGCCAGGGTGTCCTAGG + Intronic
1154173663 18:12067934-12067956 GCTGGGAGCCGGGGGGGCCCTGG + Intergenic
1154998490 18:21664122-21664144 CCTGGCAGCAGGGGTTTCAATGG - Exonic
1155310505 18:24518417-24518439 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1155623960 18:27813206-27813228 GCTTGAAGCCGGGGTTTTGCCGG + Intergenic
1155650027 18:28130545-28130567 GCTTGGTGCCATGGTTTCACAGG - Intronic
1155819174 18:30352920-30352942 GCTTGAAGATGGGGTTTCACCGG - Intergenic
1156042870 18:32843259-32843281 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1156160341 18:34351115-34351137 GCGTGGAGATGGGGTTTCACTGG - Intergenic
1158018387 18:52810852-52810874 GCTCGGAGGTAGGGTTTCACTGG + Intronic
1158488536 18:57889553-57889575 GCTTGAAGGTGGGGTTTCACCGG + Intergenic
1158521418 18:58174426-58174448 GCTCGAAGGTGGGGTTTCACCGG + Intronic
1159076315 18:63685433-63685455 GCTTGGAGGTGGGGTTTCACCGG + Intronic
1159161365 18:64646831-64646853 GCTTGAAGGTGGGGTTTCACCGG + Intergenic
1160130157 18:76218316-76218338 TCTGGGACCCGGGGTGTCACTGG - Intergenic
1161680053 19:5675573-5675595 GCTTGAAGGTGGGGTTTCACTGG - Intronic
1161736395 19:5994762-5994784 TCTGGGAACCTGGATTTCACCGG - Exonic
1161796020 19:6387287-6387309 GCTGGGAGCTGGGGACTCAGGGG - Intronic
1161989885 19:7678662-7678684 GCTGGGGGCAGGGGATTCAGGGG + Intronic
1162533217 19:11247682-11247704 GCTGGGATCCAGGGTTTGGCCGG - Intronic
1163387103 19:17006589-17006611 GCTGAGAGCAGGGGTGACACTGG - Intronic
1164746698 19:30621700-30621722 GGTGGGAGCCGGTGTCCCACAGG + Intronic
1165073808 19:33269854-33269876 GCTGGTAGCAGGAGTTTCCCTGG - Intergenic
1165330638 19:35139645-35139667 GCAGGGAGCTGGGATTTCGCGGG + Intronic
1167674052 19:50873727-50873749 GCTGGGAGCAGGGATTTGGCTGG - Intronic
929879390 2:45823004-45823026 GGTGGGAGTGGGGGTTTAACAGG - Intronic
929920613 2:46168795-46168817 GCTGGGAGCCAGCGTTTCTGTGG + Intronic
930677970 2:54224687-54224709 CCTTGGAGGTGGGGTTTCACCGG + Intronic
932360712 2:71103471-71103493 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
932860296 2:75284672-75284694 GCTGGAAGCCAGGGCTTGACAGG + Intergenic
936113433 2:109683578-109683600 GCTGGGGGCCTGGGCTTCTCTGG + Intergenic
936746566 2:115583496-115583518 GCTGGGAGCCTGGGTTCACCGGG + Intronic
939017659 2:136920643-136920665 GCTTGAAGGAGGGGTTTCACTGG + Intronic
939393887 2:141604453-141604475 GCTTGGAGGTTGGGTTTCACTGG - Intronic
939463840 2:142531916-142531938 GCTTGGAGGTGGGGTTTCACCGG - Intergenic
940683631 2:156818753-156818775 GCTTGGAAGTGGGGTTTCACTGG + Intergenic
940909095 2:159194719-159194741 GCTAGGAGCCAGGGTCTCCCTGG - Intronic
940918739 2:159285942-159285964 GCTGGGAGCCGGAGTTTGTTTGG - Intronic
942585082 2:177466450-177466472 GCTTGAAGGTGGGGTTTCACCGG + Intronic
945185616 2:207136687-207136709 GCTGGGTGCTGGGGATTCACTGG - Intronic
945419336 2:209615681-209615703 GCTTGGAGGTGGCGTTTCACCGG - Intronic
946193563 2:218020435-218020457 TCTGGGAGCCGGGGAGTGACAGG + Intergenic
947539387 2:230964585-230964607 GGTGGGAACCGGGGCTGCACGGG - Intergenic
947551724 2:231051299-231051321 GCTGGGGGCGGGGGTTGCCCTGG - Intergenic
947612001 2:231530373-231530395 GGTGGAAGCCGGGGTCTCGCGGG - Exonic
1172801832 20:37581407-37581429 GGTGGGAGCCGGGGGTCCGCGGG - Intergenic
1173058134 20:39636033-39636055 GCTTGAAGGCGGGGTTTCACTGG - Intergenic
1173730541 20:45325429-45325451 GCTGGGACCCTGGGTTGCAGTGG + Exonic
1174726960 20:52872672-52872694 GCTGGGAGCCCTGGTTCCTCTGG - Intergenic
1175047032 20:56116624-56116646 GCTGGGAGGAGGGGTTCCACAGG + Intergenic
1175237414 20:57524672-57524694 GCTGGGCGCCGGGTGTGCACTGG - Intronic
1176973286 21:15290165-15290187 GCTTGAAGGTGGGGTTTCACGGG + Intergenic
1177385080 21:20397675-20397697 GCTTGGAGGTGGGATTTCACTGG + Intergenic
1177894744 21:26845446-26845468 GGTGGGGGTGGGGGTTTCACTGG - Intergenic
1178103482 21:29295243-29295265 GCTTGGAGGTGGGGTTTCACCGG - Intronic
1178351547 21:31875205-31875227 CCTGTGACCAGGGGTTTCACAGG - Intronic
1178847842 21:36188305-36188327 TCAGGGAGTCGGGGTTCCACAGG - Intronic
1180009774 21:45041612-45041634 GCAGGGAGCCTGGGCTGCACCGG - Intergenic
1180139111 21:45880615-45880637 GCTGGGAACTGGGGATTCAGTGG + Intronic
1180145124 21:45914539-45914561 GCTGTGAGCAGGGGCCTCACAGG + Intronic
1181002905 22:19996118-19996140 GCCGGGGGCCTGGGGTTCACAGG + Intronic
1182433683 22:30316364-30316386 GCTGGGAGCAGTGGTTTCTGTGG + Intronic
1183107226 22:35623084-35623106 GCTGGGAGGAGGGGTGTCCCTGG - Intronic
1184472427 22:44703171-44703193 GCTGGGAGAAGGGGCTTCCCAGG - Intronic
1184807285 22:46803292-46803314 GCTGGGAACCGGGGTCACCCCGG + Intronic
950868740 3:16211043-16211065 GCTGGGGGCTGGGGCTTCCCAGG - Intronic
951566865 3:24019933-24019955 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
951763072 3:26165625-26165647 GCTGGGAGCCAGGGTGCTACTGG - Intergenic
951896622 3:27615429-27615451 GCTTGAAGATGGGGTTTCACTGG + Intergenic
953076352 3:39574032-39574054 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
953793279 3:45964749-45964771 GGTGGGAGCAGGGGTGGCACTGG - Intronic
954737894 3:52721915-52721937 GCTTGAAGGTGGGGTTTCACTGG - Intronic
956362727 3:68466560-68466582 GCTGGGACCCAGTGTTTCAAGGG - Intronic
956558218 3:70544235-70544257 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
956809293 3:72848591-72848613 CCTGGGAGCCGGCGTTGAACCGG + Intronic
957459406 3:80497466-80497488 GCCTGAAGCTGGGGTTTCACTGG + Intergenic
958047912 3:88307716-88307738 GCTTTAAGGCGGGGTTTCACCGG - Intergenic
958169989 3:89927507-89927529 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
959023941 3:101219334-101219356 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
959062141 3:101625488-101625510 GCTTGGAGATGGAGTTTCACTGG + Intergenic
959482509 3:106890498-106890520 GCAGGGACTCGGGGTCTCACAGG - Intergenic
959693582 3:109225085-109225107 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
961034463 3:123632714-123632736 GCTGGGTGGTGGGGTTTTACAGG + Intronic
961598957 3:128043849-128043871 GCTTGGAGGTGAGGTTTCACTGG + Intergenic
962307892 3:134304768-134304790 GCTTGGAGGTGGGGTTTTACTGG + Intergenic
963107125 3:141657051-141657073 GCTTGGAGGTGGAGTTTCACTGG - Intergenic
963138744 3:141930812-141930834 GCAAGGAGCCTGGGTTACACTGG + Intergenic
963247605 3:143077042-143077064 CCTGGGAGCCGGGGCACCACAGG + Intergenic
963250175 3:143095714-143095736 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
964133329 3:153315307-153315329 GCTTGGAGGTAGGGTTTCACTGG + Intergenic
965270547 3:166612673-166612695 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
966755784 3:183370104-183370126 GCTTGGAGAGGGGGTTTCACCGG - Intronic
967555339 3:190850355-190850377 GCTTGAAGGCAGGGTTTCACTGG - Intergenic
968487728 4:872003-872025 ACTGGCAGCCTGGGTTTCCCAGG - Intronic
968809252 4:2792737-2792759 GCTGGGCACTGGGGTGTCACTGG + Intergenic
968943516 4:3651842-3651864 GCTGGGAGCCGGGGAGTGTCAGG - Intergenic
969241697 4:5902972-5902994 GCTGGGGCCCGAGGTCTCACAGG - Intronic
969436309 4:7191562-7191584 GCTGGGAGGTGGGGTATGACTGG + Intergenic
973063698 4:45762083-45762105 GCTTAGAGGTGGGGTTTCACTGG + Intergenic
973970776 4:56211915-56211937 GCCTGGAGGTGGGGTTTCACTGG + Intronic
974210102 4:58761522-58761544 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
974227183 4:59061044-59061066 GCTTGAAGGCTGGGTTTCACTGG + Intergenic
974295590 4:59994784-59994806 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
974421632 4:61683759-61683781 GCTTGGAGGTGGGGTTTCACTGG + Intronic
977067093 4:92332391-92332413 GGTGGGAGCTGGGGTCTAACAGG - Intronic
977220429 4:94331888-94331910 GCTTGAAGGTGGGGTTTCACTGG - Intronic
978267914 4:106849469-106849491 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
979881009 4:125960837-125960859 GCTTGAAGGCAGGGTTTCACTGG - Intergenic
980299658 4:130972621-130972643 GCTTGAAGGTGGGGTTTCACCGG - Intergenic
981859158 4:149333859-149333881 GGTGGGAGTCGGGGGGTCACTGG + Intergenic
982477560 4:155872287-155872309 GCTTGAAGGCAGGGTTTCACTGG + Intronic
982607157 4:157529087-157529109 GCTTGGAGGTGGGGATTCACTGG + Intergenic
984403386 4:179295459-179295481 GCTTGGAGGTTGGGTTTCACTGG + Intergenic
985101264 4:186460698-186460720 GCTTGGAGGTGAGGTTTCACCGG + Intronic
985537479 5:473283-473305 GCGGGGATCTGGGGTTTCTCTGG + Intergenic
986164800 5:5264243-5264265 GCTTGAAGCTGGGGTTTCACAGG + Intronic
989022984 5:37031934-37031956 GCAGGGAGCTGGGGATTGACTGG + Intronic
989459772 5:41683887-41683909 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
989732474 5:44664762-44664784 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
989821667 5:45800509-45800531 GCTTGAAGGAGGGGTTTCACTGG - Intergenic
990561714 5:56990232-56990254 TCTGGGAAACAGGGTTTCACGGG - Intergenic
991039684 5:62162619-62162641 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
992773190 5:80068384-80068406 CTTGGGAGCTGGGGCTTCACCGG - Intronic
993292764 5:86096134-86096156 GCTTGGAGGTGGGGTTTCACCGG + Intergenic
993409705 5:87558660-87558682 GCGTGGAGGTGGGGTTTCACTGG - Intergenic
993618042 5:90136929-90136951 GCTTGAAGTTGGGGTTTCACTGG + Intergenic
994273602 5:97809660-97809682 GCTGGAAGGTGGGGTTTCACTGG + Intergenic
994891292 5:105639733-105639755 GCTGGAAGGTGGGGTTTCACTGG - Intergenic
995159986 5:108967927-108967949 GCTTGGAGTTGGGGTTTCACTGG + Intronic
995225161 5:109692615-109692637 GCTGGGAGCCTGGGCTACAAAGG - Intronic
995705957 5:114989712-114989734 GACGGGAGCTGGGGTTGCACGGG + Intergenic
996408135 5:123126983-123127005 TCTGGGAGCCAGGGTTTTCCTGG - Intronic
997780454 5:136652542-136652564 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
998651146 5:144122925-144122947 GCTTGAAGGTGGGGTTTCACCGG + Intergenic
999736845 5:154519262-154519284 GCTGGGAGCTGGCGTCCCACTGG - Intergenic
999797869 5:155004953-155004975 GCTGGAAGGTGGGGTTTCACTGG + Intergenic
999924455 5:156360083-156360105 GCTTGGAGGTGGGGTTTCAGTGG - Intronic
1000600873 5:163273289-163273311 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1000924692 5:167179581-167179603 GCGGGGAGCCGGGGTTGCGGGGG - Intergenic
1001210504 5:169806499-169806521 GCTTGGAGATGGGGTTTCACCGG - Intronic
1002940542 6:1711706-1711728 GCAGGCAGCCGGGGTGTCAGAGG - Intronic
1003791712 6:9553567-9553589 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1004171337 6:13297632-13297654 GCTGGGGGCAGGGGTGTCTCAGG - Intronic
1004983309 6:21050816-21050838 GCTTGGAGGTGGGGTTTCACTGG + Intronic
1005026342 6:21466265-21466287 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1005074549 6:21894191-21894213 GCTGAGGGCTGGGGTTGCACAGG + Intergenic
1005506474 6:26473147-26473169 GCTTGGAGGTGGGGTATCACTGG + Intronic
1006433477 6:34013289-34013311 GCTGGGAGCCGGGGTGGCCCAGG + Intergenic
1006540578 6:34736733-34736755 GGTTGGAGGTGGGGTTTCACTGG - Intergenic
1007924283 6:45638995-45639017 AATGGGAGCAGGGCTTTCACTGG + Intronic
1009582793 6:65558091-65558113 GCTTGAAGGTGGGGTTTCACTGG + Intronic
1010294611 6:74181936-74181958 GCTTGGAGGTAGGGTTTCACTGG + Intergenic
1010490149 6:76466225-76466247 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1011049254 6:83126377-83126399 GCTTGAAGGTGGGGTTTCACCGG + Intronic
1011284192 6:85706261-85706283 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1012132962 6:95519564-95519586 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1012889909 6:104885919-104885941 GCTTGAAGGTGGGGTTTCACCGG - Intergenic
1015045142 6:128767920-128767942 GCTGGTAGCTGGTGTTTCACAGG + Intergenic
1015353644 6:132251888-132251910 GCTTGGAGATGGGGTTTCACTGG - Intergenic
1016206531 6:141473822-141473844 GATTGGAGGTGGGGTTTCACTGG + Intergenic
1016210816 6:141531523-141531545 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1016891227 6:149008754-149008776 GCTGGGTGCTGGGCTTTCCCAGG - Intronic
1018024012 6:159789906-159789928 GCTTGGAGCTGGGGTGTAACTGG + Intronic
1018652303 6:166002583-166002605 CCTGGGAGCCCGGGTTTCCAAGG - Intergenic
1018654831 6:166025119-166025141 GCTTGAAGGTGGGGTTTCACTGG + Intergenic
1018796794 6:167192045-167192067 GGTGGGAGCCAGGAATTCACAGG - Intronic
1018819527 6:167363066-167363088 GGTGGGAGCCAGGAATTCACAGG + Intronic
1018976377 6:168570496-168570518 GGAGGGAGCCAGGTTTTCACAGG + Intronic
1019076254 6:169390336-169390358 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1019429723 7:993126-993148 GCTGGCTGCGTGGGTTTCACAGG - Intergenic
1019487604 7:1296486-1296508 GCTGGGAGCCGGGGACCCAGAGG + Intergenic
1020948419 7:14644938-14644960 GCTGGAAGGTTGGGTTTCACTGG - Intronic
1022391871 7:29950486-29950508 GCTTGAAGGTGGGGTTTCACTGG - Intronic
1022736354 7:33079829-33079851 ACTGGGAGCCGGCCTTTCCCTGG + Intergenic
1023055115 7:36284733-36284755 GCTGAGAGACGCGGGTTCACAGG + Exonic
1024866916 7:53913666-53913688 GCTGGCATCAGTGGTTTCACTGG + Intergenic
1026370194 7:69691274-69691296 GCTTGAAGTTGGGGTTTCACAGG + Intronic
1026451940 7:70537061-70537083 GCATGGAGCCTGGGTTTCAGCGG - Intronic
1027616756 7:80433518-80433540 GCTTGGAGGTGAGGTTTCACCGG - Intronic
1030206672 7:106958262-106958284 GCTGGGAGCAGGGCTTTCTGGGG - Intergenic
1030384273 7:108848637-108848659 GCTTGCAGGCGGGGTTTCGCTGG + Intergenic
1030593500 7:111508868-111508890 GCTTGGAAGGGGGGTTTCACTGG + Intronic
1031837037 7:126691014-126691036 GCCTGAAGGCGGGGTTTCACCGG + Intronic
1032538716 7:132685760-132685782 GCTTGGTGGTGGGGTTTCACTGG - Intronic
1034306105 7:150046833-150046855 GCTGGAAGCCTGGGTTTCAAAGG - Intergenic
1034717319 7:153255688-153255710 GCTTGGAGGTGGAGTTTCACTGG - Intergenic
1034800741 7:154053817-154053839 GCTGGAAGCCTGGGTTTCAAAGG + Intronic
1035345137 7:158192587-158192609 GCTGGGAGCCGGGCTCTCGGTGG + Intronic
1037434189 8:18845599-18845621 GCTGACAGCAGGAGTTTCACAGG + Intronic
1038285957 8:26206738-26206760 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1040509371 8:48080720-48080742 GCTTGGGGGTGGGGTTTCACCGG - Intergenic
1041478866 8:58296111-58296133 GCTTGAAGGTGGGGTTTCACGGG - Intergenic
1041978788 8:63831639-63831661 GCTTGAAGGTGGGGTTTCACAGG - Intergenic
1042724843 8:71862302-71862324 GCTGGAAGGCTGGGTTGCACCGG + Intronic
1044091777 8:88011054-88011076 GCTTGGAGATGGAGTTTCACTGG + Intergenic
1044132979 8:88549349-88549371 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1046406195 8:113775820-113775842 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1046682465 8:117185435-117185457 CCTGGGAGCCCTGGTTGCACTGG + Intergenic
1046819924 8:118622684-118622706 TCTGGGAGCCAGGATTGCACCGG + Intergenic
1046986716 8:120397063-120397085 GCTGGGAGTGGGGGTTTCTTTGG - Intronic
1047128269 8:121987570-121987592 GCTTGAAGGCAGGGTTTCACCGG + Intergenic
1047342399 8:123994645-123994667 GCTGGGAGCCTGGGTTTTGCGGG - Intronic
1047584939 8:126260922-126260944 GCTTGGAGGTAGGGTTTCACCGG + Intergenic
1048511989 8:135071419-135071441 GCTTGGAGATGGGGTTTCAATGG - Intergenic
1049207173 8:141369017-141369039 CCTGGCAGGCAGGGTTTCACCGG + Intergenic
1049274167 8:141711438-141711460 ACAGGGAGCCGGGGTTCCCCAGG - Intergenic
1049312085 8:141938653-141938675 CCTGGGAGTCGGGGTGTCATGGG - Intergenic
1049730354 8:144174304-144174326 GCTTGGAGGTGGGGTTTCTCAGG + Intronic
1049768827 8:144369626-144369648 GCTTGGAGGTGTGGTTTCACCGG + Intergenic
1050482014 9:6097292-6097314 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1050609624 9:7337921-7337943 GCTGGATGCTGTGGTTTCACTGG - Intergenic
1050939658 9:11442975-11442997 GCTTGGAGGTGGGGTTTTACAGG - Intergenic
1051170954 9:14317038-14317060 TCTGGGTGCCAGGATTTCACTGG - Intronic
1052122231 9:24731529-24731551 GCTGGAAGATGGGGTTTCACTGG + Intergenic
1052597114 9:30574971-30574993 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1052960549 9:34292728-34292750 GCTGGGAGCCAGGGTTCAAAAGG - Intronic
1053277102 9:36791342-36791364 GCTGGGAGCAGGGGTGTGTCAGG + Intergenic
1053312746 9:37029722-37029744 GCTGGGGGTGGGGGTGTCACTGG - Intronic
1053357886 9:37462345-37462367 GCTTGGAGGTGGGGTTTCACTGG - Intronic
1053476357 9:38384776-38384798 GCTTGGAGGTGGGATTTCACTGG - Intergenic
1056234853 9:84584719-84584741 GCTGGGAGTAGGGGTGTTACTGG - Intergenic
1057276278 9:93677436-93677458 GCTCGGAGCTGGGGCTTCATAGG + Intronic
1058334109 9:103803976-103803998 GCTTAGAGGTGGGGTTTCACTGG + Intergenic
1059104771 9:111501748-111501770 GCTTGAAGGCGGGGTTTCACTGG - Intergenic
1061044110 9:128155151-128155173 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1061332455 9:129904112-129904134 GCTGGCATCCTGGGTCTCACGGG + Intronic
1062107913 9:134765776-134765798 GCTGGGAGGCGGGGTCTCAAAGG - Intronic
1062331267 9:136045940-136045962 ACCGGGAGCCGGGGCTTCCCCGG - Intronic
1185782451 X:2861420-2861442 GCTGGGAGCCCTGGCTACACAGG + Intronic
1186311355 X:8323065-8323087 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1187194966 X:17074326-17074348 GCTGGGAGCCTTGGTTTCTGTGG + Intronic
1187471930 X:19577394-19577416 GCAGTGAGCCGGGGTGACACAGG - Intronic
1188660268 X:32750610-32750632 GCTTGGAAGTGGGGTTTCACTGG - Intronic
1188893827 X:35642883-35642905 TCTTGGAGGTGGGGTTTCACAGG - Intergenic
1189676778 X:43468550-43468572 GCTTGGAGGTGGGGCTTCACTGG + Intergenic
1189971353 X:46421099-46421121 GCTTGGAGTTGGGGTTTCACTGG - Intergenic
1190249174 X:48709062-48709084 GCTGGGAGCTGGGTTTGCCCAGG + Intergenic
1190569689 X:51768749-51768771 GCTTGAAGGTGGGGTTTCACTGG - Intergenic
1190705548 X:53023902-53023924 GCTTGGAGGTTGGGTTTCACCGG - Intergenic
1190909393 X:54757768-54757790 GCTGGGATGCCAGGTTTCACAGG + Exonic
1191754223 X:64576910-64576932 GCCTGGAGATGGGGTTTCACTGG - Intergenic
1192170618 X:68852296-68852318 CCTGGGAGTCTGGGTTTCATGGG - Intergenic
1193486134 X:82087100-82087122 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1197974618 X:132153562-132153584 TTTGGGAGCCAGCGTTTCACAGG + Intergenic
1198330375 X:135617283-135617305 GCTTGAAGGCGGGGTTTCACCGG + Intergenic
1198336552 X:135671716-135671738 GCTTGAAGGCGGGGTTTCACCGG - Intergenic
1199615585 X:149652509-149652531 GCTGGCAGCAGGGGTGGCACTGG + Intergenic
1199699225 X:150363903-150363925 GCTTGCAGCCTGGGTGTCACCGG + Intronic
1200111829 X:153744455-153744477 GGTGGGAGCCGGGGCCCCACGGG - Exonic
1200278669 X:154758109-154758131 GCTGGAAGGCTGGGTTCCACTGG - Intergenic