ID: 1145908049

View in Genome Browser
Species Human (GRCh38)
Location 17:28527061-28527083
Sequence GCAATTTAGTGGTAGAGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145908049_1145908053 -10 Left 1145908049 17:28527061-28527083 CCCCGGCTCTACCACTAAATTGC 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1145908053 17:28527074-28527096 ACTAAATTGCTGAGTTCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 205
1145908049_1145908059 30 Left 1145908049 17:28527061-28527083 CCCCGGCTCTACCACTAAATTGC 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1145908059 17:28527114-28527136 TCTGTTCTCTGTTGTTCTCCAGG 0: 1
1: 0
2: 2
3: 34
4: 390
1145908049_1145908054 -9 Left 1145908049 17:28527061-28527083 CCCCGGCTCTACCACTAAATTGC 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1145908054 17:28527075-28527097 CTAAATTGCTGAGTTCCCTTGGG 0: 1
1: 0
2: 1
3: 17
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145908049 Original CRISPR GCAATTTAGTGGTAGAGCCG GGG (reversed) Intronic
902663081 1:17918922-17918944 GCTAGTAAGTGGTAGAGCCGAGG - Intergenic
903008408 1:20313594-20313616 GCATGTTAGTGGAAGAGCCAGGG + Intronic
906317504 1:44797681-44797703 GCATTTTTTTGGTAGAGACGGGG + Intergenic
909326459 1:74357178-74357200 GCAATTTGGAGGTAAAGCTGAGG + Intronic
909331744 1:74421511-74421533 GCTATTTATTGGTAGAGCTGTGG + Intronic
910405475 1:86885004-86885026 GCACATTAGTGATAGAGCTGAGG - Intronic
913172979 1:116249016-116249038 GCAAGTTAGTGGTAGAGTTAGGG + Intergenic
916067337 1:161146820-161146842 GCAATTAAATGGTAGAGACCTGG - Intergenic
918344750 1:183597210-183597232 GCAATCTAGTCATAGAGCCAGGG + Intronic
922854074 1:228759167-228759189 GCAATTAAGTGGTAGAGCCATGG - Intergenic
922931285 1:229391646-229391668 GCAAGTAAGTGGCAGAGCTGGGG - Intergenic
1065078964 10:22109249-22109271 TCAATTTAGTGGTAGAGTCTGGG - Intergenic
1069197912 10:65575658-65575680 GCTAGTTAGTTGTAGAGCCATGG + Intergenic
1071721222 10:88148327-88148349 GCATATTAGTGATAGAGCTGAGG - Intergenic
1072192415 10:93086909-93086931 GCTAGTAAGTGGTAGAGCCAGGG + Intergenic
1075321050 10:121492009-121492031 GCTATTTTTTGGTAGAGACGGGG - Intronic
1079154055 11:17927538-17927560 GCAAATTAGTGGAAGAGACCAGG - Intronic
1079386574 11:19985358-19985380 TCAAGTTAGTGGTAGAGACTGGG - Intronic
1080088304 11:28313992-28314014 GCAATTTAGTGGTATAGAGCAGG + Intronic
1081570934 11:44290346-44290368 GCAAATAAGTGGCAGAGCCAGGG - Intronic
1083059722 11:59857267-59857289 GAAATTTAGAGGTGGAGCCTGGG - Intronic
1091545000 12:1495646-1495668 GCACTTTAGTGGAGGAGCTGAGG + Exonic
1092733211 12:11553984-11554006 GCTAGTTAGTGGTAGAACTGGGG - Intergenic
1095787999 12:46131835-46131857 GAATTTTAGTGGTAGAGGAGGGG + Intergenic
1098985256 12:77005219-77005241 GCTAGTCAGTGGCAGAGCCGGGG + Intergenic
1102592553 12:113967796-113967818 GTAATTTTTTGGTAGAGGCGAGG + Intergenic
1104188699 12:126457588-126457610 GCAATCAAATGGTAGAGCCCAGG - Intergenic
1107509332 13:41067124-41067146 GCGATTTTTTGGTAGAGACGGGG + Intronic
1110278930 13:73670158-73670180 GACATTTACTGGTGGAGCCGTGG + Intergenic
1115094587 14:29619524-29619546 GTATTCTAGTGGTAGAGCCAAGG + Intronic
1115468048 14:33737680-33737702 GAAAGTTAGTGGAAGAGCTGAGG + Intronic
1119620389 14:76127300-76127322 GCAATGAAGTGGTGGAGCTGGGG + Intergenic
1121944299 14:98104495-98104517 TCAATTTAGAGGTAGAGATGAGG + Intergenic
1130169296 15:81495256-81495278 GCGAGTAAGTGGTAGAGCTGGGG - Intergenic
1130869035 15:87955799-87955821 GCAAATAAGTGGGAGAGCCCTGG - Intronic
1130943094 15:88527930-88527952 CCACCTTAGTGGTAAAGCCGAGG - Intronic
1135326275 16:21527763-21527785 GCAACTCAGTGGGAGTGCCGTGG + Intergenic
1135380029 16:21988180-21988202 GTAATTTACTAGTAGAGACGGGG + Intronic
1135408961 16:22218762-22218784 GCCAGTTAGTGGTAGAGATGGGG + Intronic
1135844063 16:25902319-25902341 TCAATTTTTTGGTAGAGACGGGG - Intronic
1136088186 16:27900405-27900427 GCAAGTAAGTGGCAGAGCTGGGG + Intronic
1137599634 16:49747852-49747874 GCAAGTTAGTGGCAGAACCAGGG + Intronic
1139370969 16:66469264-66469286 GCAAATTAGTGGTAGAGCTGAGG - Intronic
1141376639 16:83536758-83536780 GCAATTAGGTGGTAGAGATGGGG + Intronic
1144287409 17:13790977-13790999 GCAAATAAGTGGCAGAGCCATGG + Intergenic
1144621552 17:16821644-16821666 GCAAATTAATGGCAGAGCCAAGG - Intergenic
1144884866 17:18451069-18451091 GCAAATTAATGGCAGAGCCAAGG + Intergenic
1145147358 17:20493308-20493330 GCAAATTAATGGCAGAGCCAAGG - Intergenic
1145908049 17:28527061-28527083 GCAATTTAGTGGTAGAGCCGGGG - Intronic
1147573527 17:41585985-41586007 GCAAATTAATGGCAGAGCCAAGG - Intronic
1147687013 17:42292245-42292267 GCTAGTAAGTGGTAGAGCCAGGG - Intronic
1148653665 17:49267650-49267672 GAAAATTCTTGGTAGAGCCGAGG - Intergenic
1148666906 17:49381857-49381879 GCAATTTGATGGCAGAGGCGGGG + Intronic
1149256221 17:54829972-54829994 GCAATTTAGTAGCAGAGGCAGGG + Intergenic
1149608980 17:57945578-57945600 GCTACTTAGTGGTAAAGCCAGGG - Intronic
1149946582 17:60934290-60934312 TCAATTAAGTGGTAGTGCTGTGG - Intronic
1151414188 17:73950965-73950987 GCTAGTCAGTGGCAGAGCCGGGG + Intergenic
1152358515 17:79818587-79818609 GCTACTGAGTGGTAGGGCCGGGG - Intergenic
1155991687 18:32285123-32285145 GGAACTTAATGGTGGAGCCGGGG - Intronic
1163177098 19:15571989-15572011 GCAGGTTAGTGGCAGAGCCATGG - Intergenic
1165779699 19:38425433-38425455 GCAGTTTAGTGGTAGACTCCTGG - Intronic
1168259058 19:55182710-55182732 GCTAATAAGTGGCAGAGCCGGGG + Intronic
926519414 2:13891754-13891776 GCATTTTTTTGGTAGAGACGGGG + Intergenic
927716781 2:25358342-25358364 GCAAATTAGAGGCAGAGCCAGGG - Intergenic
927894776 2:26774703-26774725 GCAAGTTGCTGGTAGAGCTGGGG - Intronic
929269320 2:39956285-39956307 GCTAATTAGAGGCAGAGCCGTGG + Intergenic
932572190 2:72943941-72943963 GCCATTTAGTGACAGAGCCAGGG + Exonic
935902853 2:107811146-107811168 GCCATGTAGTGGCAGAGCTGTGG + Intergenic
937070984 2:119062913-119062935 GCAAGTTAGTGGCAGAGTAGTGG + Intergenic
939017120 2:136915709-136915731 GCAAGTAAGTGGCAGAGCCAAGG + Intronic
941015821 2:160354994-160355016 GAAATTTCGTGAGAGAGCCGTGG - Intronic
943459125 2:188148217-188148239 GCAATTTATTTGTAAAGCAGTGG + Intergenic
944202456 2:197122046-197122068 GCATTTTAGTAGCAGAGCAGTGG + Intronic
944310894 2:198232741-198232763 GGCATTTAGTGGTAGAGGCCAGG + Intronic
944912735 2:204326416-204326438 GCAAATTTGTTGTAGAGACGGGG + Intergenic
945675841 2:212854807-212854829 GCAATTTACTAGTAGAACCCTGG - Intergenic
947574615 2:231262861-231262883 GCTAATGAGTGGTAGAGCAGAGG - Intronic
948691663 2:239708875-239708897 GTAACTTAGTGGCTGAGCCGGGG - Intergenic
1169299972 20:4433513-4433535 GCTATTTAGTGGTAGAAATGGGG - Intergenic
1169704341 20:8485671-8485693 GCAAATTAGTGGCAGAGCCTAGG + Intronic
1170565676 20:17602532-17602554 GAAATTTAGTGTTAGTGCAGTGG + Intronic
1173253725 20:41377976-41377998 GTATTTTATTGGTAGAGACGAGG - Intergenic
1174234982 20:49082314-49082336 GCAATTTTTTGGTAGAGACAGGG + Intronic
1178160913 21:29913189-29913211 GCTAGTTAGTGGCAGAGCTGGGG - Intronic
1181659943 22:24338861-24338883 GCAATTAAGTGGTAGAGTAGGGG + Intronic
1183858909 22:40654845-40654867 GCAAGTCAGTGGAAGAGCCAAGG + Intergenic
1184575768 22:45364552-45364574 CCCACTTAGTGGTAGAGCCAGGG + Intronic
950004938 3:9685588-9685610 GCATTTTAGTTGCAGAGACGAGG - Intronic
951467461 3:23017701-23017723 GCAATTTAGGGGTAGGGGAGGGG + Intergenic
951579283 3:24144802-24144824 GCAAGTTAATGGCAGAGCCAAGG + Intronic
952930013 3:38352632-38352654 GCACTTTTGTGGTAGAGACAGGG - Intronic
953017195 3:39088746-39088768 GCAAGGTCCTGGTAGAGCCGGGG + Intronic
953602994 3:44386640-44386662 GCAAATTTGTGGCAGAGCCTGGG + Intronic
955302286 3:57792962-57792984 GCAATTTTTTGGTAGAGATGGGG - Intronic
955884418 3:63582770-63582792 GCTAGTAAGTGGTAGAACCGGGG - Intronic
957155763 3:76542013-76542035 GCACTTTAGTGGCAGAGAGGAGG - Intronic
962510551 3:136095558-136095580 GCCATATAGTGGTAGAGTCCAGG - Intronic
962647150 3:137451493-137451515 GCAAATTATTGGTTGAGCCATGG - Intergenic
965009765 3:163073138-163073160 GCAAAGTTGTGGTAGAGCCTGGG + Intergenic
966569305 3:181423373-181423395 GCTAGTAAGTGGTAGAGCTGAGG - Intergenic
967318920 3:188176911-188176933 GCCATTTAGTGGCAAAGCTGGGG - Intronic
970944801 4:21678425-21678447 ACAATTAAGTTGTAGAGCAGAGG - Intronic
974508567 4:62807841-62807863 TCCATTTAGTGGGAGAGCAGAGG + Intergenic
976472762 4:85448634-85448656 AAAATTTAGTGGTGGAGGCGGGG + Intergenic
977044030 4:92046794-92046816 GAAATTTAGTAGTAGGGCTGAGG - Intergenic
980757007 4:137177888-137177910 TCATTTTAGTGGTGGAGTCGTGG - Intergenic
982331667 4:154187682-154187704 GCTATTTAGAGGTAGGGCCTTGG + Intergenic
988402808 5:30783658-30783680 GAAATTTAGAGCTAGAGCTGGGG + Intergenic
990274313 5:54179243-54179265 GCTATTAAGTGGCAGAGCTGGGG + Intronic
990551871 5:56889660-56889682 GCCATTAAGGGGTAGAGCCAGGG - Intronic
999425504 5:151484800-151484822 GCCACTGAGTGGTAGAGCTGAGG + Intronic
999696595 5:154192506-154192528 GTAAGTTAGTGGTAGAGCTGAGG - Intronic
1000181404 5:158815139-158815161 GCAATTAAGTAGTAGACCCAGGG - Intronic
1001581108 5:172799083-172799105 GCAAGTGAGTGGCAGAGCTGGGG - Intergenic
1005888660 6:30117783-30117805 GGAATCTAGTGGTAGAGGCCAGG - Intergenic
1007859489 6:44892753-44892775 ACAGATTAGTGGTAGAGCCCAGG + Intronic
1010150888 6:72731099-72731121 GGAATTTGGAGGTAGAGCCAGGG - Intronic
1014308769 6:119772457-119772479 GCAAGTTGGTGGTAGAGGTGGGG + Intergenic
1014580704 6:123133978-123134000 GCAATTTAGTTTTTGAGCAGAGG + Intergenic
1014952816 6:127578325-127578347 GCTAGTAAGTGGTAGAGCAGGGG + Intronic
1019573299 7:1724041-1724063 GCAACTAAGTGGTGGGGCCGGGG - Intronic
1021107688 7:16657541-16657563 GCAATTTAGTGGAAGGGCAGAGG - Intronic
1021416754 7:20395124-20395146 GCTAGTTAGTGGTAGGGCCAGGG - Intronic
1021687637 7:23202684-23202706 GCAATTTAGAGGTAGTGTAGGGG - Intergenic
1029375557 7:100175067-100175089 GCCAGTAAGTGGCAGAGCCGTGG - Intronic
1030174283 7:106634851-106634873 GCAATTCAGTGGTTCAGCAGTGG - Intergenic
1031774980 7:125897019-125897041 ACAATTTAGTGATAGATCTGAGG - Intergenic
1032539484 7:132691516-132691538 GCAATTCAGTGGCAGATCAGGGG + Intronic
1032751946 7:134850404-134850426 GCTAGTAAGTGGTAGAGCTGGGG - Intronic
1036959411 8:13227475-13227497 GTACATTAGTGGTAGGGCCGAGG + Intronic
1037719371 8:21429850-21429872 GCTAGTTAGTGGAAGACCCGGGG - Intergenic
1039702982 8:39980287-39980309 GCAAATTAGTGGAAAAGCCAAGG + Intronic
1041237837 8:55822396-55822418 GCAAATTATTGGTAGAACTGGGG + Intronic
1047672742 8:127166053-127166075 GCTATTTGGTGTTAGAGCCAGGG - Intergenic
1059406442 9:114100635-114100657 GCAAGTTAGTGGCAGAGCTGGGG - Intergenic
1059860620 9:118456787-118456809 GCAATTTAGAGGTAGATCAAGGG - Intergenic
1185702066 X:2238179-2238201 AAAATTTTTTGGTAGAGCCGAGG - Intronic
1187106564 X:16249262-16249284 GCTAGTTAGTGGCAGAGCTGAGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1188682992 X:33034512-33034534 GCAAGTTAGTGTTAGAGCCAGGG - Intronic
1189195647 X:39149968-39149990 GCAATTTAGAGGGTGAGCCAAGG - Intergenic
1190436762 X:50433340-50433362 GCAAATTAGTTGTAGAGCACTGG + Intronic
1197772032 X:130095218-130095240 GCCAGTAAGTGGCAGAGCCGGGG + Intronic