ID: 1145908459

View in Genome Browser
Species Human (GRCh38)
Location 17:28529014-28529036
Sequence ATGTATATAAATGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145908450_1145908459 -5 Left 1145908450 17:28528996-28529018 CCTGAGCCCCTTCTCTGGATGTA 0: 1
1: 0
2: 1
3: 16
4: 202
Right 1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 353
1145908444_1145908459 22 Left 1145908444 17:28528969-28528991 CCCATGACCCAGGAGGGAAGAAT 0: 1
1: 0
2: 5
3: 37
4: 429
Right 1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 353
1145908448_1145908459 14 Left 1145908448 17:28528977-28528999 CCAGGAGGGAAGAATCTGGCCTG 0: 1
1: 0
2: 0
3: 23
4: 238
Right 1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 353
1145908447_1145908459 15 Left 1145908447 17:28528976-28528998 CCCAGGAGGGAAGAATCTGGCCT 0: 1
1: 0
2: 2
3: 27
4: 214
Right 1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 353
1145908445_1145908459 21 Left 1145908445 17:28528970-28528992 CCATGACCCAGGAGGGAAGAATC 0: 1
1: 0
2: 0
3: 23
4: 222
Right 1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145908459 Original CRISPR ATGTATATAAATGGGGAGGA GGG Intronic
900279835 1:1859629-1859651 ATGTAAAGAAAGGGGGAGCAGGG + Intronic
900619256 1:3579533-3579555 CTGTTTATAAATGGGGACGCTGG - Intronic
900891705 1:5454440-5454462 AAGTAGAGAAATGGGGAGGGGGG - Intergenic
902294767 1:15459458-15459480 AAGTATATAAATTGTGAGGCTGG - Intronic
903727684 1:25463315-25463337 AGGTAAAGAAATGTGGAGGAAGG + Intronic
903908671 1:26705727-26705749 ATCCATTTAAATGGAGAGGAGGG - Intronic
904187457 1:28716524-28716546 ATGAATCTAAAAGGGGACGAAGG - Intronic
904835241 1:33331468-33331490 AAGTATAGAAATGGGTAGGGTGG + Intronic
905127135 1:35723571-35723593 ATGTAAATGAATGGGTGGGAAGG - Intronic
906464433 1:46063701-46063723 ATGTAAATAAAGGGAGGGGAAGG - Intronic
908084799 1:60619988-60620010 AAGTAGTTAAATGGGGAAGATGG - Intergenic
908490127 1:64635145-64635167 ATCTAAATAAAGGGGCAGGAAGG - Intronic
909490889 1:76225274-76225296 ATATATAGAAATGGGGACTAGGG - Intronic
910116745 1:83739735-83739757 AGCTATAGACATGGGGAGGAGGG - Intergenic
911884897 1:103285835-103285857 ATTTAAATATATGGGGTGGAGGG - Intergenic
912408616 1:109464389-109464411 ATGGATATTTCTGGGGAGGAAGG + Intergenic
913387155 1:118270741-118270763 ACCTATATTAATGGAGAGGATGG + Intergenic
914840394 1:151243471-151243493 CTGTACATAAAAGGGGAGAATGG + Intronic
914984603 1:152445412-152445434 ATTTATATAAAGGGGCAGAACGG - Intergenic
916202770 1:162287695-162287717 AGGTATGAAAATGGGGAGGGGGG - Intronic
916710086 1:167397527-167397549 ATATATATATATTGGGGGGATGG + Intronic
918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG + Intronic
918651627 1:186971428-186971450 AAGTATATAAATTTGGAGAAAGG - Intronic
918738186 1:188093650-188093672 ATGTTTATATATGGGAAAGAAGG + Intergenic
918923258 1:190744186-190744208 ATGAATATAAATGAGTTGGAAGG - Intergenic
919171033 1:193954366-193954388 ATTGAGATAAATGGGGAGAACGG + Intergenic
919394270 1:197024644-197024666 ATGTACATAAATGGAGAAGATGG - Intergenic
921528418 1:216247238-216247260 ATATATTTAAAAGGTGAGGATGG + Intronic
921707006 1:218333838-218333860 GTTTAAATAAATGGGGAGGCAGG - Exonic
922129041 1:222758566-222758588 CTGTATAAACATGGGGTGGAGGG - Intergenic
922628012 1:227071718-227071740 ATGTATAAAAATTGGGGGGGGGG - Intronic
923298099 1:232614398-232614420 ATGTATATAAATTCTGAGGATGG - Intergenic
923585474 1:235266030-235266052 GTGTATATACGTGGGGAAGAGGG + Intronic
924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG + Intergenic
924662975 1:246039281-246039303 ATGCATGTATATGGGGATGAGGG - Intronic
1064583219 10:16814901-16814923 ATATTTATAAATGGGGAGAATGG - Intronic
1065882971 10:30052861-30052883 ATTTTTATAAATGGAAAGGAAGG - Intronic
1066326934 10:34369808-34369830 ATGCCTAGAAATGGGGAGGAGGG - Intronic
1067321214 10:45223000-45223022 ATATTTATAAATGGGGAGAATGG - Intergenic
1068819166 10:61353125-61353147 CTGGATAAAAGTGGGGAGGAAGG - Intergenic
1069699524 10:70411822-70411844 AAGTATATACATTGGGAGAAGGG - Intronic
1069970536 10:72164260-72164282 ATTTATTTAAATGGGTATGAGGG - Intronic
1070234745 10:74611657-74611679 ATGGACATAAAGGGGGAGGCAGG - Intronic
1070364200 10:75720213-75720235 AATTATATACATGGGAAGGAAGG + Intronic
1070985915 10:80689755-80689777 ATGTTTATGAATGGGCAAGAAGG + Intergenic
1071798797 10:89034851-89034873 ATTTATATAATATGGGAGGAAGG + Intergenic
1072022323 10:91414385-91414407 TTGTGTATAAATGGGGTTGATGG + Intronic
1072560720 10:96571267-96571289 ATGTACATAAATGGGTTAGATGG + Intronic
1073642206 10:105264131-105264153 ATGTATATAAAGGGGGGTGGGGG + Exonic
1073642287 10:105264879-105264901 ATGTATATATATGGGAGGAAAGG + Exonic
1073753380 10:106555280-106555302 ATGTGTATAAATATGGAGGGAGG + Intergenic
1073969825 10:109034709-109034731 ATGTCTATAGTTGGGGAGTAGGG - Intergenic
1076439088 10:130467304-130467326 ATGTATAGAGATGGAGAGGAAGG + Intergenic
1079427715 11:20359460-20359482 AGGTAGATAAATGAGGAGAATGG - Intergenic
1081061537 11:38484177-38484199 ATGTTCATAAATGGGGTGCAGGG + Intergenic
1081751739 11:45516076-45516098 ATTGATATAAATGGGCAAGAAGG - Intergenic
1082231254 11:49769567-49769589 ATCTAGATAAATGTTGAGGATGG + Intergenic
1083010731 11:59396082-59396104 ATTAATATGAAAGGGGAGGATGG + Intergenic
1084019170 11:66407511-66407533 ATATTGATAATTGGGGAGGAGGG + Intergenic
1085440201 11:76554807-76554829 TAGCATATAAATGGGGAGGTTGG + Intergenic
1086531150 11:87786714-87786736 ATGGTGATAAATTGGGAGGAAGG + Intergenic
1086618789 11:88859407-88859429 ATCTAGATAAATGTTGAGGATGG - Intronic
1087711172 11:101554506-101554528 ATATATATAAATTGGGAATATGG + Intronic
1088830935 11:113536321-113536343 ATATATATATATGGACAGGAAGG - Intergenic
1089734448 11:120540048-120540070 ATGTATATAAATGACAAGAAAGG + Intronic
1089864001 11:121616114-121616136 AGGTATATAAATGGAAAGAAAGG - Intronic
1089910195 11:122090882-122090904 ATTTAGATAAATGGAAAGGAAGG - Intergenic
1090128392 11:124114432-124114454 ATGTATATAAATGTGTATGTGGG + Intergenic
1090199165 11:124842041-124842063 GTGTTTGCAAATGGGGAGGAAGG - Intergenic
1090783502 11:130028201-130028223 AAGTCTATAAATTGGGTGGATGG - Intergenic
1091148748 11:133305649-133305671 GTCTACATAAATGGGGTGGAGGG - Intronic
1091336056 11:134767180-134767202 ATGTATTGAAGTGGGTAGGAAGG + Intergenic
1091390590 12:123854-123876 ATTTATAAAAATGGGGAGGTTGG + Intronic
1091967609 12:4758321-4758343 ATGTGTGTAAATGGAGATGATGG + Intronic
1092976472 12:13749902-13749924 ATGTATTTGGATGGAGAGGAAGG + Intronic
1093385562 12:18548943-18548965 ATGAATATACATGGAGAGAATGG - Intronic
1093402184 12:18760246-18760268 ATGTAGATAGATGAGCAGGAAGG - Intergenic
1094680011 12:32659605-32659627 ATTTTTAAAAATGGGGATGAGGG - Intergenic
1095438465 12:42217671-42217693 ATGAATATAAATGTCAAGGAGGG + Intronic
1096253163 12:50046317-50046339 ATGCATAAATAAGGGGAGGAAGG + Intergenic
1096417007 12:51423388-51423410 ATGGACAAAAATGGGGATGAGGG + Intronic
1097742427 12:63259264-63259286 ATGTAAATGAATGGGGGGCATGG - Intergenic
1098113072 12:67144645-67144667 ACATAGATAAATGGGGAAGAAGG + Intergenic
1098191672 12:67955674-67955696 ATGGATATAAAGGAAGAGGAAGG - Intergenic
1099908957 12:88806301-88806323 ATCTATACAATTGGGGTGGAGGG + Intergenic
1102208685 12:111108520-111108542 AGATAAATAAATGGGGAAGAAGG - Intronic
1102290618 12:111696510-111696532 ATGTAAACAAATGGGCAAGATGG - Intronic
1102369345 12:112369081-112369103 ATGTCTATATATAGGCAGGAGGG - Intronic
1102840804 12:116119010-116119032 CTACATATAAATGGGGAGGTGGG + Intronic
1103260345 12:119582808-119582830 ATTAATAAAAATTGGGAGGAAGG - Intergenic
1104436324 12:128759781-128759803 ATGTATAAAAATAAGGATGATGG - Intergenic
1104740861 12:131172724-131172746 ATGTAGTGAAATGGGTAGGAAGG + Intergenic
1106302624 13:28483286-28483308 ATGTAAACAGATGGGGAGGCAGG - Intronic
1107273521 13:38649571-38649593 ATGAATATAAATAGAGGGGAGGG + Intergenic
1107275646 13:38675926-38675948 ATGGATATAAAGGAAGAGGAAGG + Intergenic
1108478038 13:50840771-50840793 ATGAATATACATGGGGATGGGGG + Intronic
1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG + Intergenic
1109907732 13:68866514-68866536 ATATATATAAATTGGCAGAATGG + Intergenic
1110412442 13:75219496-75219518 ATATATATATATGGGCAGCAAGG + Intergenic
1114261324 14:21038722-21038744 CTGTAGATAAATGGGGAGCTGGG + Intronic
1114812942 14:25921693-25921715 GTGGTTACAAATGGGGAGGATGG + Intergenic
1115230358 14:31153765-31153787 ATATATATACATGGGTAGTAAGG + Intronic
1115752631 14:36506690-36506712 ATGTCAGTAGATGGGGAGGAGGG - Intronic
1117046364 14:51817059-51817081 TTGGATATAACTGGGGAGGGAGG + Intergenic
1117168830 14:53068984-53069006 AAGCAAATAAATGGGGAGAAAGG - Intronic
1118067996 14:62213025-62213047 ATGTATGTGAATGTGGAGGTGGG - Intergenic
1118068010 14:62213147-62213169 ATGTATGTGAATGTGGAGGTGGG - Intergenic
1118125401 14:62897122-62897144 CTGGCTATTAATGGGGAGGAGGG - Intronic
1118237504 14:64022434-64022456 ATCTAAATAAATAGGGAGGCCGG + Intronic
1118437388 14:65784232-65784254 ATGTATATCAATGGGGTGTGTGG + Intergenic
1118805316 14:69231433-69231455 ATTTACCTAAATTGGGAGGATGG - Intronic
1120039873 14:79740147-79740169 CTGAATATAAAGGGGGAGGGAGG - Intronic
1120086327 14:80278312-80278334 TTGGATATAGATGGGGAAGAGGG + Intronic
1120120255 14:80670403-80670425 ATGTATATAAATAGGTAGGTAGG - Intronic
1120683485 14:87509613-87509635 ATATATGTATATGAGGAGGAAGG - Intergenic
1121631682 14:95425660-95425682 ATGTTAATTAATGGGGAAGATGG + Intronic
1121686425 14:95838651-95838673 ATGGATATAAGAGGGGGGGACGG - Intergenic
1122105337 14:99449110-99449132 AAGTAAATAAATGTGGAAGAAGG + Intronic
1122155345 14:99747271-99747293 ATGTATAGAAATGGCGAGGAGGG + Intronic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1125303885 15:38288320-38288342 ATGTTAATAAATTGAGAGGAAGG + Intronic
1125792648 15:42380718-42380740 ATATATATATATGGGGAAGGTGG - Intronic
1126410454 15:48368124-48368146 ATGTAGAGAAAGGGGGAGAAAGG - Intergenic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1127401819 15:58594667-58594689 ATTTATAAAACTGGGGAGGGAGG + Exonic
1128981832 15:72193848-72193870 ATGTATAGTAGTGGGAAGGAGGG + Intronic
1129278333 15:74462301-74462323 ATATCTAAAAATGGGTAGGATGG - Intergenic
1129483775 15:75848562-75848584 AGGTATAAAAATGGGGATGAGGG - Intronic
1130207656 15:81892561-81892583 CTGTCTGTAAATGGGCAGGATGG - Intergenic
1130277045 15:82485690-82485712 GGGTATAAAAATGGGGATGAGGG + Intergenic
1130311480 15:82759458-82759480 ATGTATATAGATGCTGAGAAAGG + Exonic
1130469409 15:84213041-84213063 GGGTATAAAAATGGGGATGAGGG + Intergenic
1130476899 15:84327605-84327627 GGGTATAAAAATGGGGATGAGGG + Intergenic
1130494866 15:84460525-84460547 GGGTATAAAAATGGGGATGAGGG - Intergenic
1130591703 15:85217670-85217692 GGGTATAAAAATGGGGATGAGGG + Intergenic
1131487854 15:92836955-92836977 ATTTATATTAATGGGAAGGGTGG - Intergenic
1131621330 15:94071161-94071183 ATGGAAATAAATGAGGATGAAGG + Intergenic
1132204539 15:99977339-99977361 ATATATATATATGAAGAGGAGGG - Intronic
1132229358 15:100170192-100170214 AGGTAACTAAAAGGGGAGGACGG - Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1133812494 16:9171499-9171521 ATACATATAAATAGGTAGGATGG + Intergenic
1134884189 16:17775395-17775417 AGGAAGATGAATGGGGAGGAGGG - Intergenic
1135023628 16:18982919-18982941 ATATAAATAAATGGGGAAAATGG - Intergenic
1136524490 16:30820336-30820358 ATGTATATATATGGGCATGGTGG - Intergenic
1137412276 16:48239013-48239035 AAGTAAATAAATGGGGGAGATGG + Intronic
1137935059 16:52627035-52627057 ATGCATAAAAATGGTGAGGGAGG + Intergenic
1137973998 16:53015003-53015025 ATCTTGATACATGGGGAGGAAGG - Intergenic
1138788766 16:59877480-59877502 ACCTTTATAAATGGGGAAGATGG - Intergenic
1138925908 16:61591179-61591201 ATTTATAAAAATGTGAAGGAGGG + Intergenic
1139743204 16:69053269-69053291 ATGTAACTAAATAGGGAGAATGG - Intronic
1139951186 16:70671507-70671529 ATATAAATAAATGGGGGAGAAGG + Intronic
1141182928 16:81766565-81766587 ATGAATATAATGGGGGAGGAAGG - Intronic
1142834271 17:2573251-2573273 AAATATATAAATGGGGGGGATGG + Intergenic
1144255940 17:13467175-13467197 ATATATATATATAGGAAGGAAGG - Intergenic
1144387536 17:14763345-14763367 CTCTATATAAATGGGGTGGCAGG + Intergenic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1146495448 17:33318199-33318221 ATGTCTGGAAATGGGAAGGAAGG - Intronic
1148939629 17:51197104-51197126 ATATATATATATATGGAGGACGG + Intronic
1148982960 17:51595145-51595167 ATGTATAGAAAATGGAAGGAAGG + Intergenic
1151088204 17:71405533-71405555 ATTTATATTAATGGAGATGAAGG + Intergenic
1151516435 17:74599146-74599168 ATGTGCAGAGATGGGGAGGAAGG + Intergenic
1154228466 18:12530614-12530636 ATCTTTAAAAATGGGGAGGAAGG - Intronic
1154235365 18:12600635-12600657 ACGTGAATAAATGGGGAGAAAGG - Intronic
1155240125 18:23856857-23856879 AGGTATCCAGATGGGGAGGAGGG - Intronic
1156051351 18:32938532-32938554 ATTTATATAAATAGGGAAAAAGG + Intronic
1156210964 18:34942258-34942280 ATTTTTATAGATTGGGAGGAAGG - Intergenic
1156424595 18:36996626-36996648 AAGTGAATAAATGGGGATGAGGG + Intronic
1157381187 18:47219306-47219328 ATGTATCTACATGGGGACAAAGG + Intronic
1158064809 18:53393926-53393948 ATGGATATATAGGGGGAGGGAGG - Intronic
1158223602 18:55177056-55177078 ATATATATAAATGAAGATGAAGG + Intergenic
1158962103 18:62596090-62596112 AAATATATATTTGGGGAGGAGGG - Intergenic
1159388264 18:67755611-67755633 ATTTTAATAAATGGGGAGGGGGG - Intergenic
1159475762 18:68918960-68918982 TTGTATATAAAAGGGAAAGAAGG + Intronic
1166581890 19:43908302-43908324 ACTTATATAACTGGGGAGAAAGG + Intergenic
1167950921 19:53027019-53027041 AAGTGTAAAAATGGGGAGGTTGG + Intergenic
1168015153 19:53566942-53566964 ATGTATATATATGGAGAGAGAGG - Intronic
925494111 2:4426677-4426699 ATGGTTCTAAATGGGGAGGCAGG - Intergenic
926359963 2:12077717-12077739 ATGGCTATACATGGTGAGGATGG + Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
927081071 2:19631103-19631125 ATTTCTCTACATGGGGAGGAGGG - Intergenic
928003938 2:27546398-27546420 AGATATCTATATGGGGAGGAGGG - Intronic
928350671 2:30550846-30550868 AATTAAATAAATGGGGAGTAGGG - Intronic
928913135 2:36443015-36443037 CTGTATATAGATAGGGAGGCAGG + Intronic
929031502 2:37653820-37653842 ATGTATAAAAATGGGCAGGTGGG + Intronic
929168899 2:38911490-38911512 ATGTGTGTATATGGGGAGGAGGG + Intronic
930086888 2:47503963-47503985 GTATAAATAACTGGGGAGGAAGG - Intronic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
930817721 2:55616797-55616819 AAGTAAATAAAGGGGGAGGAAGG + Intronic
931041159 2:58302427-58302449 ATATATATAAATTGGAAGGAAGG - Intergenic
931229125 2:60359161-60359183 ATTCATATTGATGGGGAGGAAGG + Intergenic
932479691 2:72031754-72031776 ATGTGTATGAGTGGGCAGGAGGG - Intergenic
932650784 2:73553780-73553802 AAGGATATATATGGGTAGGAGGG + Intronic
933127406 2:78626511-78626533 ATGAATAAAAAATGGGAGGAAGG + Intergenic
935746052 2:106191285-106191307 GTGTATATAATTGGGAAGTATGG + Intronic
936225722 2:110648634-110648656 GTGTGTATATATGGGGAGGTAGG + Intronic
936672070 2:114668235-114668257 TTGTGTATAACTGGGGAGGCTGG + Intronic
936680961 2:114770640-114770662 ATTTGTATAACTGGGGTGGAGGG + Intronic
937641072 2:124212340-124212362 GTGTTAATAGATGGGGAGGAGGG + Intronic
938629121 2:133146330-133146352 ATCTAGATAAAATGGGAGGAGGG + Intronic
939917804 2:148069185-148069207 GTGTGTATAAATGGAGAGAAAGG + Intronic
939958877 2:148548902-148548924 ATGCATCTAAATGGGGAGTGAGG + Intergenic
940668589 2:156639693-156639715 ATGACTTTAATTGGGGAGGAGGG - Intergenic
942121106 2:172778444-172778466 GTATATTTAAATGGGGAGGGGGG - Intronic
944208578 2:197183396-197183418 ATGTATTTAAATGTCAAGGAAGG - Intronic
946623337 2:221583026-221583048 ATTTATATAAAGGAGGGGGAAGG + Intergenic
947017030 2:225632401-225632423 ATGTATATCAGTGTGGAGGGGGG - Intronic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1169867263 20:10215506-10215528 CTATATATAAATGGGGTGGGGGG + Intergenic
1170031369 20:11947699-11947721 ATTTTTAAAAAGGGGGAGGAGGG - Intergenic
1170159921 20:13300403-13300425 ATAAATATAAAAGGGGGGGAGGG + Exonic
1170444351 20:16409928-16409950 ATGTAGGTAAGTGGGTAGGAAGG - Intronic
1172420965 20:34817161-34817183 ATGTATATAAATGGGTACTACGG + Intronic
1172473282 20:35217101-35217123 ATGTATATGAGTGAGGAGGTTGG - Intergenic
1173697935 20:45037300-45037322 ATGTGTGCAAAAGGGGAGGAAGG + Intronic
1174408209 20:50316708-50316730 ATGTATATAGCTGGGCATGATGG - Intergenic
1175356815 20:58375231-58375253 ATATATATATTTGGGGAGGGAGG - Intergenic
1177194523 21:17889150-17889172 ATGTGTATATATGGGTACGATGG + Intergenic
1178478485 21:32958201-32958223 AACTGTACAAATGGGGAGGAGGG - Intergenic
1179827461 21:43974571-43974593 GTGTATATAAATCGTGAGGGTGG + Intronic
1181298348 22:21860377-21860399 AGGTATATAAATTGTGAGCAAGG + Intronic
949339980 3:3019066-3019088 ATATAAATAAATGGGGGAGAGGG + Intronic
949792318 3:7806611-7806633 ATGTAAATGAATTGGAAGGATGG - Intergenic
950720539 3:14879443-14879465 ATGTCTATAAACAGGAAGGATGG - Intronic
951257410 3:20466406-20466428 GTATATATAAATGGGGGAGAGGG - Intergenic
951634590 3:24759216-24759238 ATGTAAATAAATGAGCAGTATGG - Intergenic
951714010 3:25619457-25619479 ATTTATACAACTGGGGAGGAAGG - Intronic
951799444 3:26578893-26578915 ATGAATATAAATGGGGAAGAGGG - Intergenic
952308066 3:32162709-32162731 AAGCATATTAATTGGGAGGAGGG + Intronic
953902703 3:46852203-46852225 ATGTATGGAACAGGGGAGGAGGG - Intergenic
955177765 3:56633840-56633862 GTGTCTGTAAATGGAGAGGATGG + Exonic
955645478 3:61132914-61132936 ATGGATAGAAATGGGGTGTAGGG + Intronic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957299869 3:78378071-78378093 AAGTACATAAATGTGGAGAATGG + Intergenic
958266438 3:91443151-91443173 ACATAAATAAATGGGGAGAAAGG + Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
958880881 3:99667760-99667782 ATGTCCATAAATGGGCAGGTGGG + Intronic
960427846 3:117531061-117531083 ATAAATATAAATGAAGAGGAGGG - Intergenic
961578626 3:127859310-127859332 ATGATTATATCTGGGGAGGAGGG + Intergenic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
962914671 3:139888981-139889003 ATGTAGATAAATGATGAAGAAGG - Intergenic
964519630 3:157550467-157550489 AAGTGTCAAAATGGGGAGGAGGG - Intronic
966258916 3:177951607-177951629 AAGTATGTAAAGGGCGAGGATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967705596 3:192646355-192646377 ATTTATATTAATTGGGAGAAAGG - Intronic
969519565 4:7668050-7668072 CAGTAAATAAATGTGGAGGAAGG - Intronic
970621457 4:17824392-17824414 GTGTATATATAAGGAGAGGATGG - Intronic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971797337 4:31244604-31244626 ATGTAGACAAAGGGGGAGGTGGG + Intergenic
972002113 4:34050598-34050620 ATGTATATAAAGGAAGAGCAAGG + Intergenic
973833081 4:54781362-54781384 AAGTATTTAAATGTGGAGGTGGG - Intergenic
974145538 4:57943110-57943132 AAGAATATAGATGGGGATGAAGG + Intergenic
974347669 4:60702607-60702629 ATGTAGACTAATAGGGAGGAAGG + Intergenic
974521761 4:62989898-62989920 ATGTATATACATGTGGACTAAGG - Intergenic
974747379 4:66093087-66093109 GTGTATATATATGGAGAGAAAGG + Intergenic
974863010 4:67546009-67546031 ATGTATAATAATGGTGATGATGG + Intergenic
978166722 4:105618286-105618308 ATATAAATAAATGTGGAGAAAGG + Intronic
981797026 4:148606972-148606994 ATGAATATTAATGCAGAGGAAGG + Intergenic
982602128 4:157465412-157465434 ATGAATATATGTGGAGAGGATGG - Intergenic
982662335 4:158222131-158222153 ATGTATACAAGTGGGTAGGTAGG - Intronic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
984732792 4:183084019-183084041 AAATAAATAAATGGGGAGAAAGG - Intergenic
985245187 4:187973384-187973406 ATGTATACAAATGGAAAGGTTGG + Intergenic
985949399 5:3211790-3211812 ATGTATATATGTGTGGAGGTGGG + Intergenic
987893416 5:23913620-23913642 ACGTATATATTTGGGGAGAAAGG - Intergenic
988659517 5:33250135-33250157 ATATATTTAAGTGTGGAGGATGG + Intergenic
989404151 5:41041661-41041683 GTATATATAAATGTGGAGGAAGG - Intronic
990090740 5:52044349-52044371 ATATATATAATGGGGGAGAAAGG - Intronic
995264968 5:110148594-110148616 ATATATATAAAAGGTGAGGTTGG + Intergenic
995989368 5:118217725-118217747 ATATATACAAATTTGGAGGAAGG + Intergenic
996658736 5:125973191-125973213 ATGAATATATATGGGGACGAAGG - Intergenic
996960757 5:129246393-129246415 ATGGCTAAAAATGGGGAGAAGGG - Intergenic
997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG + Intergenic
997297205 5:132776022-132776044 ACATATATAAATTGGGATGACGG + Intronic
997593513 5:135091042-135091064 ATGTATATAGAGGAGGAGGTAGG + Intronic
998670537 5:144348345-144348367 ATCTATAAAAATTGGGATGATGG - Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
999368334 5:151037453-151037475 ATGTACATAAGTGTTGAGGATGG - Intronic
999422691 5:151458556-151458578 ACGTATACCAATGGGAAGGATGG + Intronic
1000903960 5:166940540-166940562 GCGTAAATAAATGGGGATGACGG - Intergenic
1002067591 5:176659888-176659910 ATGTAAATGAATGGGCAGGTGGG - Intergenic
1003166954 6:3687989-3688011 ATGTAAATAAATGGGGATCAGGG - Intergenic
1003784062 6:9463963-9463985 AAGGAGATAAATGGGGAGGGAGG - Intergenic
1005131221 6:22510820-22510842 CTGTATATAGATGGGAAGGCAGG - Intergenic
1005131227 6:22510861-22510883 CTGTATATAGATGGGAAGGCAGG - Intergenic
1005270929 6:24162670-24162692 ATGTATCTAAAAAGAGAGGAAGG + Intergenic
1005605986 6:27477914-27477936 AAGTAGATAAATGAGGAAGAGGG - Intergenic
1006043890 6:31277325-31277347 AAGTGAAGAAATGGGGAGGATGG + Intronic
1007358701 6:41340667-41340689 AAGTATAAAAATTGGGAGTAGGG - Intronic
1007671013 6:43553870-43553892 AAGATTATAAAGGGGGAGGAGGG - Intronic
1008666134 6:53718325-53718347 TTGTATAAAAATGGGGAAGATGG + Intergenic
1008902740 6:56640752-56640774 ATGTAAATAACAGGGGAAGAGGG + Intronic
1009501734 6:64421943-64421965 ATGTTTCTTGATGGGGAGGATGG - Intronic
1009771504 6:68148548-68148570 ATGTATTTAAATAAGGAGGCAGG - Intergenic
1010369651 6:75092669-75092691 ATGTAGCAAAATGGGGAGAAGGG - Intronic
1010996783 6:82542762-82542784 ATATAAATAAATGAGGAAGAAGG + Intergenic
1012557807 6:100536934-100536956 AAGTAAATAAATGGGGGAGAAGG + Intronic
1012889437 6:104881846-104881868 ATGTATAAATATGGGGGAGATGG - Intergenic
1015022866 6:128497667-128497689 ATGTATAATAATGGGAAAGAAGG - Intronic
1015636339 6:135278722-135278744 ATGAAAATAAATGGTGGGGAGGG + Intergenic
1016104474 6:140145249-140145271 TACTATAAAAATGGGGAGGAAGG + Intergenic
1016403100 6:143701596-143701618 CTGTACAAAAATGGGGAGGAGGG - Intronic
1016824321 6:148374282-148374304 AGGAATATGAATGGGAAGGAGGG + Intronic
1017542607 6:155418154-155418176 GTGTGTATGAATGGGGAGGGAGG - Intronic
1017646221 6:156542116-156542138 CTGCAGATAGATGGGGAGGATGG + Intergenic
1017736633 6:157370794-157370816 TGGTACATAAATGGGGAGAAGGG + Intergenic
1018209627 6:161468488-161468510 ATGTCAATAAATGGGGAGTGAGG - Intronic
1018792854 6:167162682-167162704 ATGTAAATGTATGGGCAGGAGGG + Intronic
1019769183 7:2872704-2872726 ATGCATGCAAATGGGAAGGAAGG - Intergenic
1020053946 7:5103891-5103913 ATGTATAAGAATGGGGAAAATGG + Intergenic
1021009180 7:15440901-15440923 ATGGATACAAATGGGAATGATGG - Intronic
1021010090 7:15451832-15451854 ACGTACAGAAATGGGAAGGAAGG + Intronic
1021227358 7:18043662-18043684 ATATATATAAATGAGGGGTATGG + Intergenic
1022296469 7:29059814-29059836 ATGGAAACAAATGGTGAGGAAGG - Intronic
1022380092 7:29851489-29851511 ATGTAAGTCAATGGTGAGGAGGG - Intronic
1022759062 7:33327354-33327376 ATGTATAGAAGTGGAGAGGCTGG + Intronic
1023114772 7:36851864-36851886 AGTAATAGAAATGGGGAGGAGGG - Intergenic
1023206320 7:37753913-37753935 ATGTAGATAAAAGGGGAAAAGGG - Intronic
1024979613 7:55146352-55146374 ATTTAGAAATATGGGGAGGAAGG - Intronic
1026373797 7:69729420-69729442 AAGTATAAAAATGGGGGGGGGGG - Intronic
1027622559 7:80508158-80508180 ATATATATAAATGTGGCAGAGGG + Intronic
1027997292 7:85440254-85440276 ATGTATAGAAATTGGTAGGAAGG + Intergenic
1028534685 7:91879374-91879396 ATGTATATTAAAGGCGGGGAGGG + Intronic
1028567322 7:92246752-92246774 ATGCATCCAGATGGGGAGGATGG - Intronic
1028746280 7:94330352-94330374 AAGTATATAGTTGGGGAGGAAGG - Intergenic
1028833131 7:95346967-95346989 ACAAATATAAATTGGGAGGATGG - Intergenic
1029989566 7:104950705-104950727 ATGTATTAATATGGGGAGGGGGG + Intergenic
1031806211 7:126309770-126309792 ATATAAATAAATGGCCAGGAAGG + Intergenic
1031806639 7:126315848-126315870 GTGAATATAAATGGAAAGGAAGG - Intergenic
1032868407 7:135953150-135953172 ATTTAAATTAATGGGAAGGAAGG - Intronic
1032898907 7:136284008-136284030 ATGTAAATAACTGAGGATGATGG + Intergenic
1033676767 7:143548732-143548754 ATGTTTATAAATGACTAGGAAGG + Intergenic
1033695068 7:143780703-143780725 ATGTTTATAAATGACTAGGAAGG - Intergenic
1034362916 7:150516816-150516838 ATTTATATGAATGGGGAGGTTGG + Intronic
1034408105 7:150919601-150919623 ATGTAAATAAAATGGGAAGACGG - Intergenic
1034893727 7:154861879-154861901 ATGTAAATAAATGGAGAGAGAGG + Intronic
1035965661 8:4188796-4188818 ATGAATATTATGGGGGAGGATGG + Intronic
1037260806 8:17005803-17005825 ATGGATATGAATGGAGTGGAAGG + Intergenic
1038067042 8:23974169-23974191 AGGGATAGAAATGGAGAGGAGGG + Intergenic
1041402649 8:57461500-57461522 ATGTGTCTAAATGGGAAAGAGGG + Intergenic
1042293797 8:67198523-67198545 ATGTTTATAATTGGGGAGTGGGG - Exonic
1042410147 8:68456409-68456431 TTCTATATAAATGGGGATTAAGG - Intronic
1042433981 8:68742538-68742560 ATTTTTAGAAATGGGGAGAAAGG - Intronic
1043325696 8:79048163-79048185 ATGTAAATAAATGAGGGAGAAGG + Intergenic
1043497118 8:80813979-80814001 TTCTATAAAAATGGGAAGGAAGG - Intronic
1044631824 8:94287665-94287687 ATAGATATAGATGGAGAGGAAGG + Intergenic
1045142050 8:99297010-99297032 ATATATATATATGAGGGGGAGGG + Intronic
1045639240 8:104229324-104229346 ATGTTTTTGATTGGGGAGGAGGG + Intronic
1045704151 8:104900618-104900640 GTCTATAGGAATGGGGAGGACGG - Intronic
1045971821 8:108086987-108087009 ATGTATATTGATAGGGAGGCTGG - Intergenic
1046425938 8:114049464-114049486 ATATCTACAAATGGGTAGGATGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047834773 8:128676806-128676828 ATGTAAATTATTGGGTAGGATGG - Intergenic
1048979706 8:139696791-139696813 ATGGATATAAATGGGTAAGTGGG + Intronic
1050516549 9:6450305-6450327 ATTTAAATAAATGGGGGGGGGGG - Intronic
1050725187 9:8641325-8641347 AGGTATAAAGATGGGGAGAAAGG + Intronic
1051310452 9:15765444-15765466 ATGCACAGAAGTGGGGAGGAAGG + Intronic
1051378040 9:16424637-16424659 ATATATGTATATGGGGAGAATGG + Intronic
1052159847 9:25244183-25244205 AATTATTTAAATGTGGAGGATGG + Intergenic
1052377859 9:27738256-27738278 AAATAAATAAATGAGGAGGAGGG - Intergenic
1052560616 9:30078892-30078914 ATGTATTAAAATGAGGAGCAGGG + Intergenic
1052903425 9:33814905-33814927 CAGTATAGAAAAGGGGAGGAAGG + Intergenic
1053053253 9:34978371-34978393 ATGTATATAAGTGTGGTGGCAGG - Exonic
1055163305 9:73158443-73158465 ATGTATGTAAGAGGTGAGGAAGG + Exonic
1055612608 9:78038448-78038470 ATGAATACAAATGTGGAGGTCGG - Intergenic
1055861096 9:80750041-80750063 CTATATTTAAATGGTGAGGATGG - Intergenic
1056243847 9:84674605-84674627 ATGTATTTAAATTTGGAGCACGG + Intronic
1056640650 9:88367685-88367707 ATGTATGGACATGGGGTGGAAGG + Intergenic
1057907959 9:98996976-98996998 ATGTCTTCAAAGGGGGAGGATGG - Exonic
1061327199 9:129871105-129871127 CTGGAGATGAATGGGGAGGATGG - Intronic
1061644477 9:131989562-131989584 ATGTTTAAAAATGGTGAAGATGG - Intronic
1062245357 9:135563252-135563274 ATGTATACAGGTGGGCAGGAGGG + Intronic
1186164857 X:6815901-6815923 ATGGGTTTAAATGGCGAGGAAGG - Intergenic
1186582258 X:10832932-10832954 ATTTATATATATGGCGAGAACGG - Intronic
1186633091 X:11371986-11372008 ATATATTTAAATGGAGAAGAGGG + Intronic
1189822595 X:44884820-44884842 ATGTATGTAAATTGGGAACAGGG - Intronic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1192057231 X:67785335-67785357 AGGTAGATATATGGGAAGGAAGG - Intergenic
1192387640 X:70688815-70688837 ATATATATAATTTGGGAGGTTGG + Intronic
1193114337 X:77761815-77761837 AAGTAGTTAAATGGGTAGGAAGG - Intronic
1194733948 X:97489476-97489498 TTGAATATAAATGGTGAGGGTGG + Intronic
1196919696 X:120573132-120573154 ATGTACATAAATGCTGAGGAAGG - Intronic
1197189861 X:123634167-123634189 TTGTATATAAATATGGGGGAAGG + Intronic
1197280766 X:124533308-124533330 GTTTATATAAATGGGAGGGAAGG - Intronic
1197972191 X:132126473-132126495 ATCCATTTAAATGGGGTGGAGGG - Intronic
1199514701 X:148663343-148663365 ATGTAGATACCTGTGGAGGAAGG - Intronic
1201663803 Y:16426801-16426823 ATCTATATATATAGGGAAGAAGG - Intergenic