ID: 1145909627

View in Genome Browser
Species Human (GRCh38)
Location 17:28534949-28534971
Sequence GGTCCAGGAGGGGCCAGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 1, 2: 4, 3: 89, 4: 782}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145909627_1145909639 7 Left 1145909627 17:28534949-28534971 CCAGGCCTGGCCCCTCCTGGACC 0: 1
1: 1
2: 4
3: 89
4: 782
Right 1145909639 17:28534979-28535001 CCATTGTTCCCACAGCCGGACGG 0: 1
1: 0
2: 0
3: 7
4: 110
1145909627_1145909637 3 Left 1145909627 17:28534949-28534971 CCAGGCCTGGCCCCTCCTGGACC 0: 1
1: 1
2: 4
3: 89
4: 782
Right 1145909637 17:28534975-28534997 GCAGCCATTGTTCCCACAGCCGG 0: 1
1: 0
2: 1
3: 18
4: 177
1145909627_1145909645 24 Left 1145909627 17:28534949-28534971 CCAGGCCTGGCCCCTCCTGGACC 0: 1
1: 1
2: 4
3: 89
4: 782
Right 1145909645 17:28534996-28535018 GGACGGGCACCTTGAGCTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 176
1145909627_1145909640 8 Left 1145909627 17:28534949-28534971 CCAGGCCTGGCCCCTCCTGGACC 0: 1
1: 1
2: 4
3: 89
4: 782
Right 1145909640 17:28534980-28535002 CATTGTTCCCACAGCCGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 76
1145909627_1145909644 23 Left 1145909627 17:28534949-28534971 CCAGGCCTGGCCCCTCCTGGACC 0: 1
1: 1
2: 4
3: 89
4: 782
Right 1145909644 17:28534995-28535017 CGGACGGGCACCTTGAGCTGCGG 0: 1
1: 0
2: 1
3: 10
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145909627 Original CRISPR GGTCCAGGAGGGGCCAGGCC TGG (reversed) Exonic
900126298 1:1070342-1070364 CGGCCAGGAGGGCCCAGGCCAGG - Intergenic
900144082 1:1150482-1150504 GGTCTGGCAGGGGGCAGGCCAGG + Intergenic
900151916 1:1182574-1182596 GGTCAGGAAGGGGCCAGGGCTGG + Intronic
900187614 1:1339695-1339717 GGAGCGGGAGGGGCCAGGCAGGG - Intronic
900370076 1:2328349-2328371 GGTGCAGTAAGGGCCATGCCTGG + Intronic
900583934 1:3423457-3423479 TGTACAGGAGGGGCCTGGGCTGG - Intronic
900585171 1:3429150-3429172 GATCCAGGCGAGGGCAGGCCGGG - Intronic
900620971 1:3587843-3587865 GGGACAGGAGGGGCCAGGAGGGG + Intronic
900620973 1:3587853-3587875 GGGCCAGGAGGGGACAGGAGTGG + Intronic
900621048 1:3588033-3588055 TGGCCAGGAGGGGGCAGGACAGG + Intronic
900621236 1:3588483-3588505 TGGCCAGGAGGGGGCAGGACAGG + Intronic
900658714 1:3772580-3772602 GGTCCAGAAGGGGCCGGGGGCGG - Intergenic
900703811 1:4063601-4063623 ACTGCAGGAGGGGCCAGCCCGGG + Intergenic
900782796 1:4628885-4628907 GGTGGAGGAGGGGCCAGGCCAGG + Intergenic
900783286 1:4631679-4631701 GGGTGAGGAGGGGCCAGCCCAGG - Intergenic
901023549 1:6267303-6267325 GGACCAGGAGGGGCCAAGAGAGG + Intronic
901416341 1:9119472-9119494 GGTCCAGGTGAGGGCAGGACTGG - Intronic
901652054 1:10748652-10748674 GTTCCAGGCAGGGGCAGGCCTGG + Intronic
901704056 1:11060208-11060230 GGGCCACGTGGGGCCCGGCCGGG + Intergenic
901828093 1:11875558-11875580 GGAACAGGAGGGGACTGGCCAGG - Intergenic
902197700 1:14810041-14810063 GGTCTAGTAGGGTACAGGCCAGG - Intronic
902206011 1:14868686-14868708 GGGCCAAGAGGAGCCAGGCATGG + Intronic
902403842 1:16172517-16172539 GGGCCAGGAGGGGCTAGGGACGG - Intergenic
902567427 1:17321328-17321350 GGACCACTGGGGGCCAGGCCAGG + Intronic
902869698 1:19306720-19306742 AGCCCAGGATGGGCCAGGCATGG - Intronic
902985176 1:20150386-20150408 GGCCAAGGAGGGGCCAGCCATGG - Exonic
903177567 1:21590089-21590111 GGCCACGGCGGGGCCAGGCCAGG - Intergenic
903326130 1:22569624-22569646 GATTCATGAGGTGCCAGGCCAGG + Intronic
903470135 1:23581250-23581272 GGTTCAGGAGGGGACAATCCAGG + Intergenic
903539058 1:24086602-24086624 GGTCGGGGAGGAGGCAGGCCAGG - Intronic
903564538 1:24254888-24254910 GGTCACCCAGGGGCCAGGCCTGG - Intergenic
903700999 1:25247940-25247962 GGTCCAGGGAGGCTCAGGCCGGG - Intronic
904042097 1:27591029-27591051 GGCCCTGGAGGGACCAGGCTGGG - Intronic
904364104 1:29999632-29999654 GGTCAAGGAGGGGCCAAGGCTGG - Intergenic
904460748 1:30678342-30678364 GGTTCAGGATGGGCCAATCCAGG - Intergenic
904563346 1:31413178-31413200 GGCCGGGGAGGGGCCAGGCCCGG + Intronic
904606242 1:31699418-31699440 AGGCAAGCAGGGGCCAGGCCAGG + Intronic
904613822 1:31739250-31739272 GGTCCAGGAAGGCCCAGGTAAGG - Intronic
905033902 1:34904932-34904954 GGGCCAGCAGGGGCAGGGCCCGG - Exonic
905069631 1:35213947-35213969 GCTCCAGGAGGGGCAAGAACAGG + Intergenic
905205904 1:36342753-36342775 GGACCAGGAGGGGCCGTGCCTGG - Intronic
905298306 1:36968696-36968718 GCTCCACGTGGGGCAAGGCCAGG + Intronic
905442405 1:38003974-38003996 TGTCCAGGAGGACCCTGGCCAGG + Intronic
905675452 1:39821570-39821592 GGTTCTGAAGGGGCCAGGCATGG + Intergenic
905790003 1:40784592-40784614 GGTCAAGCAGGGGTCAGGCCTGG - Intronic
905896345 1:41548153-41548175 AGTCCAGGAGGTGCCAGAACTGG + Intronic
906784300 1:48600904-48600926 GATCCAGGAAGAGCCAGGTCTGG + Intronic
907022353 1:51080692-51080714 GGTGAAGGAGAGGCCAGGCGTGG + Intergenic
907241805 1:53085134-53085156 GGAGCAGGGTGGGCCAGGCCAGG - Exonic
907280949 1:53346757-53346779 AATCAAGGAGGAGCCAGGCCAGG - Intergenic
907513376 1:54978813-54978835 GGACCAGAAGGGGCTGGGCCTGG - Intergenic
907788116 1:57634012-57634034 GGTCCAGGATGCGCCAGCCATGG - Intronic
907996610 1:59639051-59639073 GGTAGAGGAGGGGCCAGGTGAGG + Intronic
910607277 1:89100547-89100569 GGAAGAGGAGGGGCCAGGCTCGG + Intergenic
912442824 1:109712229-109712251 GGCCCAGGAGGGGACAGGCGGGG - Intergenic
912637563 1:111312227-111312249 GGCCCAGTACCGGCCAGGCCTGG + Exonic
912710082 1:111943848-111943870 GGCCCAGGAGTGGCATGGCCAGG + Intronic
913091469 1:115479223-115479245 GCTCCAGGAGCGGCCTGGCAGGG + Intergenic
913126528 1:115795454-115795476 GGTGCAGCAGGGGTCAGCCCTGG - Intergenic
914243435 1:145868160-145868182 GGTCCAGGATGGGCCAGTGATGG - Intronic
914783423 1:150806655-150806677 GGTCCTGGAGGGGGCATGGCAGG - Intronic
914857879 1:151365401-151365423 GGCCCAGGACTGTCCAGGCCAGG - Intronic
915117490 1:153609835-153609857 GGACCAGGAGGGAACAGGCCAGG + Intronic
915142399 1:153775695-153775717 GTTCCGCGAGGCGCCAGGCCAGG - Exonic
915331011 1:155112344-155112366 GTCCCAGGAGGGGCCATGGCAGG + Intergenic
915432736 1:155879124-155879146 GTTCTTGGAGGGGCCAGGCACGG + Intronic
915444978 1:155969467-155969489 TGTCCGGGAGTGACCAGGCCAGG + Intronic
915564712 1:156706952-156706974 TGGCGAGGAGGGGCCAGGGCAGG - Intergenic
915902411 1:159856144-159856166 GCACCAGGAGGTGCCAGGTCAGG + Intronic
915940767 1:160116814-160116836 GGCCCAGGAGGAGTCAGGCAAGG + Intronic
915943877 1:160136006-160136028 GGTGGAGGAGGGGACAGGCAAGG + Intronic
916479482 1:165202196-165202218 CATCCAGGAGGGGCCAGGATAGG - Exonic
916510675 1:165469992-165470014 ACTCCAGGAGTGGCAAGGCCTGG + Intergenic
916582738 1:166123221-166123243 GGTCCAGGGTGGGGGAGGCCTGG - Intronic
916792601 1:168136970-168136992 GGGGCCGGAGGGGCCCGGCCGGG - Intronic
917931385 1:179824926-179824948 GGGACATGAGGGGCCAGGCAGGG - Intergenic
918104478 1:181404796-181404818 TGACCAGAAGGGGCCAGGCCTGG + Intergenic
919753095 1:201050444-201050466 GGCCCAGGATGGACCAGTCCCGG + Exonic
919827911 1:201516895-201516917 GCTCCTGGAGTGGCCAGGTCAGG - Intergenic
919905085 1:202072867-202072889 GATACAGGAGGTGCCTGGCCAGG + Intergenic
919977189 1:202620282-202620304 GGTCCAGGAGGAACCATGCTTGG + Intronic
920183250 1:204145555-204145577 GGTCAAAGAGAGGGCAGGCCTGG + Intronic
920306880 1:205024166-205024188 ATTTCAGGAGGAGCCAGGCCTGG - Intergenic
920535837 1:206736027-206736049 GGGCCAGGAGGGGTCTGGCATGG + Intergenic
920630379 1:207645848-207645870 GGGCGAGCAGGGGCCTGGCCAGG + Intronic
920641171 1:207752806-207752828 GGGCGAGCAGGGGCCTGGCCAGG + Intronic
921177727 1:212608597-212608619 GGTGGAGGAGGGGCCAAGGCGGG - Intronic
921178717 1:212615082-212615104 GACCCAGGAGGGGACAGGCAGGG - Exonic
921944400 1:220877061-220877083 GGGCCTGCAGGGGCCAGGCTTGG + Intergenic
922427179 1:225509510-225509532 GTTTCAGGAGGGGCAAGGCTGGG + Intronic
922712827 1:227845893-227845915 GGTGCAGGAGGCGGCAGGCCTGG + Intronic
922727121 1:227927755-227927777 GGTCCTGGCGGGTCCAGGCCTGG - Intronic
922801618 1:228367211-228367233 GGGGCAGGCAGGGCCAGGCCGGG + Intronic
923490240 1:234478278-234478300 GGTGCAGGCGGGGCTGGGCCAGG - Exonic
923686643 1:236158078-236158100 GCACCAGGAGGGGGCAGGCTGGG + Intronic
924194426 1:241590880-241590902 AGAACAGGAGGGGCCAGGACAGG + Intronic
924624803 1:245688989-245689011 GGGAAAGGAGAGGCCAGGCCTGG - Intronic
1062835877 10:635468-635490 GGGCCAGCAGGGGCGAGGCCGGG + Intronic
1062876046 10:943746-943768 GGTGCAGGGGGGCCCAGGTCAGG + Intergenic
1062934275 10:1374577-1374599 TGTGCGGGTGGGGCCAGGCCGGG + Intronic
1063085956 10:2817942-2817964 GGGCCAGGAGGACCCAGGGCTGG - Intergenic
1063465652 10:6242384-6242406 TGCCCAGGACGGGCCTGGCCAGG + Intergenic
1063631208 10:7735199-7735221 GGCACAGGAGGGCCCAGGGCTGG - Intronic
1063773849 10:9237985-9238007 GGACCAGGCCAGGCCAGGCCAGG + Intergenic
1064000972 10:11663494-11663516 AGTCCAGGAGGGCCCAGGGATGG + Intergenic
1064461979 10:15544002-15544024 AAGCTAGGAGGGGCCAGGCCTGG + Intronic
1065390164 10:25174947-25174969 GGTCGAGGAGGAGCCAGTGCCGG + Intergenic
1065802004 10:29360775-29360797 AGGCCAGGCGGGCCCAGGCCTGG + Intergenic
1065831487 10:29618521-29618543 CGTCCAGGCTGGGCCAGGCATGG - Intronic
1066382317 10:34912078-34912100 AGGCCAGGAAGGGCAAGGCCAGG - Intergenic
1066602599 10:37124834-37124856 GGTCGAGGAGGGGCCACGGGCGG + Intergenic
1066602716 10:37125405-37125427 GGTCGAGGAGGGGCCAGGGGCGG + Intergenic
1067081065 10:43212455-43212477 GTGCCAGGAGGGGAGAGGCCAGG + Intronic
1067088047 10:43253143-43253165 CCTGCAGGAGGGGCCTGGCCAGG + Intronic
1067318841 10:45198668-45198690 GGTCGAGGAGGGGCCAGGGGCGG - Intergenic
1067343093 10:45419788-45419810 GGCTGCGGAGGGGCCAGGCCAGG + Intronic
1068868419 10:61918740-61918762 GGTACATTAGGGGCCAGGCACGG + Intronic
1070201270 10:74208117-74208139 GATCGAGGAGAGGCCAGGCATGG + Intronic
1070590556 10:77797674-77797696 GGTCCATGAGAGGCTTGGCCTGG + Intronic
1070658617 10:78288981-78289003 TGTCCAGGAGAGGCCATGCGTGG - Intergenic
1070720321 10:78752468-78752490 TGACCAGGAGGAGCCGGGCCAGG + Intergenic
1071288634 10:84172327-84172349 AGTCCAGGCAGGCCCAGGCCTGG + Intergenic
1071545038 10:86522231-86522253 GGGCCAGGACCGACCAGGCCAGG - Intergenic
1072724821 10:97806157-97806179 GGCCCAGGAGTGCCCAGGGCTGG - Intergenic
1072725041 10:97807480-97807502 GCTCCAGGAGGGGCCACTCAGGG + Intergenic
1072943136 10:99785352-99785374 GGCCCAGGAGGGGCCAGGAGGGG + Intronic
1073060631 10:100731397-100731419 GCTCCAGGAGGAGCCGGCCCAGG - Intergenic
1073103851 10:101021256-101021278 GGTAGAGCAGGGGCCAGGGCTGG + Intronic
1073132677 10:101200352-101200374 GTTCCAGGATTGTCCAGGCCTGG - Intergenic
1073499612 10:103924003-103924025 GAGCCTGGAGAGGCCAGGCCAGG - Intergenic
1074312039 10:112330318-112330340 GGACCGGGAGGGGCCTGGCTGGG + Intergenic
1074682486 10:115922064-115922086 GGTCAAGGAGGTGCCAGACCAGG + Intronic
1074938961 10:118216199-118216221 GGGGGAGGAGGGGGCAGGCCAGG - Intergenic
1075084364 10:119404729-119404751 TGTCCATGAAGGACCAGGCCTGG - Intronic
1076096283 10:127737021-127737043 GGTCCAGGACGTGTCAGGCCTGG + Intergenic
1076154681 10:128194548-128194570 AGTAAAGGAGGGGCCAGGCGCGG - Intergenic
1076699775 10:132265383-132265405 TGTCCAGGAAGAGCCAGTCCTGG + Intronic
1076784573 10:132743384-132743406 GCCCCAGCAGGGACCAGGCCCGG + Intronic
1076784591 10:132743443-132743465 GCCCCAGCAGGGACCAGGCCTGG + Intronic
1076889158 10:133275552-133275574 GCTCCATGAGGGCCCAGGGCCGG + Exonic
1076988729 11:257907-257929 GGGCCAGGATGGGCCAGGATGGG - Intergenic
1076988765 11:258037-258059 GAGCCAGGATGGGCCAGGACGGG - Intergenic
1077014084 11:392373-392395 GGCCCTGCAGGGGCCAGGCTGGG - Intergenic
1077014796 11:394738-394760 GGCACAGGTGGGGCCTGGCCAGG - Intronic
1077155228 11:1088143-1088165 TGGCCAGGAGGGGGCAGGGCAGG - Intergenic
1077266303 11:1652412-1652434 GGTCCAGACGGGGGCAGGCGGGG - Intergenic
1077336502 11:2007265-2007287 GGGCAAGGAGGGGCCACGCTAGG - Intergenic
1077359522 11:2134460-2134482 GGCACAGGAGAGGCCAGGGCGGG + Intronic
1077500895 11:2909376-2909398 AGTCCAGGTGGGGCCGGGTCGGG + Intronic
1077527641 11:3077158-3077180 GGCCCAGCAGTGGCCAGGCTGGG - Intergenic
1078094361 11:8287583-8287605 GGCCCAGGAGGCTCCTGGCCTGG + Intergenic
1078296496 11:10076516-10076538 GGACCAGGAGGGGTGTGGCCTGG + Intronic
1079128111 11:17733055-17733077 GGGCCAGGATGGGCCACACCAGG + Intergenic
1079635541 11:22735245-22735267 GGTCCATTAGTGGCCAGGCTTGG + Intronic
1080659055 11:34281139-34281161 GGGCCAGGAGGGACCACGCTGGG - Intronic
1081637783 11:44732173-44732195 GGCTTGGGAGGGGCCAGGCCAGG + Intronic
1081693222 11:45092344-45092366 GGTCCTGGAGGAGTCAGGGCTGG - Intergenic
1082003579 11:47408122-47408144 GCTCATGGAGGAGCCAGGCCGGG + Intronic
1082059579 11:47848652-47848674 CGACCAGGAGGGGCGAGGTCCGG + Intergenic
1083355660 11:62064219-62064241 AGCCAAGGAGGGGCCAGGCGTGG - Intergenic
1083383318 11:62286815-62286837 AGGCCAGGCGGGCCCAGGCCTGG + Intergenic
1083417473 11:62535042-62535064 GGTCCAGGTCTGGCCAGGCTCGG + Exonic
1083678845 11:64342216-64342238 GCTACGGGAGGGGTCAGGCCTGG + Intronic
1083708521 11:64532906-64532928 GGTACAAGAGGTGCCAGTCCGGG - Intergenic
1083750605 11:64758762-64758784 GGTCCAGGCGTGGCTGGGCCTGG - Intronic
1083771678 11:64871090-64871112 GGGCCAGGCGGGGCCAGACGGGG + Intronic
1083889505 11:65588906-65588928 GGCTCAGGAGGGTCCAGGTCTGG + Intronic
1083952526 11:65964979-65965001 GGGCCAGAAGGGGTCAGGACAGG - Intronic
1084033110 11:66492556-66492578 GACCCAGTAGGGCCCAGGCCTGG + Intronic
1084053296 11:66615215-66615237 GAGCCAGTATGGGCCAGGCCCGG - Intergenic
1084106997 11:66986698-66986720 GGACCAGGAAGGGCCTGGCGTGG + Intergenic
1084118641 11:67056411-67056433 GCTGCGGGAGGGGGCAGGCCAGG + Intergenic
1084120540 11:67066479-67066501 CCTCCAGGCGGTGCCAGGCCTGG + Intronic
1084156265 11:67314461-67314483 GCTGCAGGAGGGGCAGGGCCTGG - Intergenic
1084256452 11:67946315-67946337 CCTCCTGGAGGGGCCTGGCCAGG - Intergenic
1084273166 11:68039566-68039588 GTTCCTGGAGGGGCCAGGAAAGG + Intronic
1084309943 11:68311276-68311298 GGTACAGGAGAGGCCAGCCAGGG - Intergenic
1084389011 11:68862697-68862719 GTTCCTGGAGGGGCCAGCCCAGG + Intergenic
1084478253 11:69400980-69401002 GGCTCAGGATGGGGCAGGCCTGG - Intergenic
1084617488 11:70246234-70246256 GAGCCAGGAAGGGCCAGGCGTGG - Intergenic
1084674304 11:70625157-70625179 AGTCCAGGAGGGTCCAGACATGG + Intronic
1084947386 11:72645730-72645752 CGGCCAGTAGGGGCCAGCCCTGG - Intronic
1084953260 11:72678247-72678269 GCTCCAGGTGGGGCCAGGTCTGG + Intergenic
1084978220 11:72814748-72814770 GGACCAGGAGGGGCTCGTCCAGG - Intronic
1085130213 11:74031842-74031864 GATCCAGGATGGGCAAGGCCAGG + Intronic
1085240450 11:75049731-75049753 AGGCCAGGTGGGCCCAGGCCTGG + Intergenic
1085472639 11:76768008-76768030 GGTCCAGGCCTGGCCTGGCCAGG - Intergenic
1085526321 11:77166292-77166314 GCTCCAGGAGGGGCCTGGAGGGG + Intronic
1085560973 11:77473259-77473281 GGGCGGGGCGGGGCCAGGCCAGG - Intronic
1085736736 11:79045571-79045593 GCTCCAGTAGCAGCCAGGCCAGG - Intronic
1088738989 11:112751488-112751510 GTTCCAGGCCAGGCCAGGCCTGG - Intergenic
1088833774 11:113560081-113560103 GCTTCAGGATGGCCCAGGCCAGG - Intergenic
1089351455 11:117823851-117823873 GGGCCAGGAAAGGACAGGCCAGG + Intronic
1089394117 11:118124094-118124116 ACTTCAGGAGGGGCCAGGCATGG + Intergenic
1089573337 11:119423838-119423860 GGACCAGAAGGTGCCAGCCCAGG - Exonic
1090738113 11:129630182-129630204 GTTCCATAAGGGGCCAGGCATGG + Intergenic
1091215018 11:133895674-133895696 GGACGAGGACGGGCCAGGGCAGG + Intergenic
1091219051 11:133919844-133919866 GGCCCAGCAGGGGCGGGGCCGGG + Exonic
1202819486 11_KI270721v1_random:62447-62469 GGGCAAGGAGGGGCCACGCTAGG - Intergenic
1092158765 12:6303435-6303457 GGTCCAGGAGGGTCTGGGCAGGG + Intergenic
1092172805 12:6384201-6384223 GGGCCGGGAGCGGCCAGGCCGGG - Exonic
1092751485 12:11723692-11723714 GGTCAAGGAGAGGCCAGGATAGG - Intronic
1092818516 12:12331714-12331736 GGAGGAGGAGGGGCCAGGCAGGG + Intronic
1094041515 12:26125123-26125145 GGGGGAGGAGGGGCCGGGCCGGG + Exonic
1094048938 12:26197913-26197935 GGTCTCTGAGGAGCCAGGCCAGG + Intronic
1096500417 12:52061121-52061143 GCTCAGGGAGGGGCCAGGGCTGG + Intergenic
1096561098 12:52436595-52436617 GGTCTTGGAGGGTCCAGGCGTGG + Intergenic
1096672974 12:53211150-53211172 GGTCAAGGTGGGGGCAGGCTGGG - Exonic
1097037036 12:56130799-56130821 GGCCCAGGAAGGGCCAGACCTGG - Exonic
1097053338 12:56236626-56236648 TGCCCAGGAGGGGCCAGAGCTGG - Exonic
1097663384 12:62454590-62454612 GAGCCAGGAAGGGCCAGGCATGG + Intergenic
1097798586 12:63888960-63888982 GGTCGATGAGGGTGCAGGCCTGG + Intronic
1098676365 12:73294477-73294499 TCTCCATGAGGGGCCAGCCCCGG - Intergenic
1101538400 12:105641815-105641837 AGTCCAGAAGGAGGCAGGCCAGG + Intergenic
1101865630 12:108517671-108517693 TGGCCAAGAGGGGCCAGGACAGG + Intronic
1101910532 12:108857566-108857588 GCTCCAGGAGGCCCCGGGCCCGG - Exonic
1101966775 12:109287370-109287392 GGTCCAGGGTGGGCCGGGTCAGG - Intronic
1102037010 12:109776507-109776529 GGCTCAGGAGAGGCCAGGCTGGG - Intergenic
1102218841 12:111180673-111180695 GGTCCAGGAGAGGAGAGGACTGG - Intronic
1102259951 12:111437628-111437650 TGTGAAGGAGGGGCCAGGCTTGG + Intronic
1102455027 12:113065776-113065798 TGACGAGGAGGGGCCAGGACGGG + Intronic
1102921292 12:116793525-116793547 GGTGGAGTAGGAGCCAGGCCAGG - Intronic
1103008274 12:117438958-117438980 GGCCAAGGAGGGCCCTGGCCAGG - Intronic
1103392454 12:120584539-120584561 GGGCCAGAAGGGGCCGGGCCTGG - Intergenic
1103706197 12:122874342-122874364 TCTTCAGGAGGGGCCAGGCATGG + Intronic
1104505502 12:129328078-129328100 GCTCCAGGAAGGGCCCAGCCTGG - Intronic
1104623882 12:130337745-130337767 TGTCCGGGAGGGGCCAGACGGGG + Intergenic
1104623893 12:130337766-130337788 GGTCTTGGAGGGGCGGGGCCGGG + Intergenic
1104767651 12:131340829-131340851 GGCTCAGGATGTGCCAGGCCTGG + Intergenic
1104862316 12:131929972-131929994 GGTCCTGCAGCGGCCGGGCCGGG + Exonic
1104910581 12:132238347-132238369 GCTTCAGGAGGGGCCGGGCAGGG + Intronic
1104943613 12:132406037-132406059 GGTCCTCCAGGGGCCAGGACTGG - Intergenic
1104952848 12:132450238-132450260 AGCCCAGGAAGGCCCAGGCCCGG + Intergenic
1104981688 12:132575835-132575857 GGACCAGGAGGGGCCGGCCCAGG + Intronic
1105030290 12:132878090-132878112 GGTTCAGGATGGGCCGGGCGCGG - Intronic
1105210081 13:18252539-18252561 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1105210570 13:18254544-18254566 GGACCAGGCTGGGCCAGGCAAGG - Intergenic
1105223709 13:18408382-18408404 GGTTGAGGAGGGGCCAGGGGCGG + Intergenic
1105423388 13:20272802-20272824 GGTGGAGGAGGGGCCAGTGCTGG - Intergenic
1105630186 13:22156231-22156253 GGGCCAGGAGGTGACAGGCCAGG - Intergenic
1105650736 13:22374195-22374217 TTTCCAGGAGAGGCCAGCCCTGG - Intergenic
1105883733 13:24624944-24624966 GGTCCAGGTTGGACCAGGTCAGG + Intergenic
1106248669 13:27968326-27968348 GCGCCAGGAGGGGCACGGCCCGG - Intronic
1106401689 13:29437121-29437143 CGTCCAGCAGGGGCCATGACAGG + Intronic
1106564742 13:30874397-30874419 GCTCCTGGAGGGGCAAGGCTGGG - Intergenic
1108350230 13:49585243-49585265 GGTGCTGGCGGGGCCGGGCCGGG + Intronic
1108384947 13:49890632-49890654 GGTCCTGGAGGAGCCACGCAGGG + Intergenic
1109126866 13:58528656-58528678 GGTCCTGGAGGAGCCACGCAGGG + Intergenic
1109994544 13:70107287-70107309 GGTCCAGGAAAGTCCATGCCTGG + Exonic
1110168313 13:72470124-72470146 TGTTAAGGAGGGGCTAGGCCAGG + Intergenic
1112469272 13:99673121-99673143 GGTGCAACAGGGGCCAGGCATGG + Intronic
1112824951 13:103381668-103381690 GATTCAGGAGGGGCCAGGTGAGG - Intergenic
1113368425 13:109700276-109700298 GGCCCAGGAGGGGCGTGGGCAGG + Intergenic
1113721703 13:112562397-112562419 GGTCCAGGAGGGCCCAACACAGG + Intronic
1113892549 13:113744012-113744034 GCTCCAGGAGGGGCAGGCCCAGG - Intergenic
1113926828 13:113946472-113946494 GGCGCAGGAGGACCCAGGCCAGG + Intergenic
1114163034 14:20190329-20190351 GGCCCAGGAGAGGCCAGAGCAGG - Intergenic
1115822116 14:37223789-37223811 CACCCAGGAGGGGCCAGGCAGGG - Intronic
1116041164 14:39687771-39687793 GGTCTCGTAAGGGCCAGGCCTGG + Intergenic
1117772608 14:59150078-59150100 GGGCTAGGAGTGGCCAGGCACGG - Intergenic
1118256694 14:64211590-64211612 GCCCCCTGAGGGGCCAGGCCAGG - Intronic
1119070537 14:71578361-71578383 GGTAAAGGAGTGGTCAGGCCAGG - Intronic
1119400594 14:74359730-74359752 GGACCAGGTGGGGCAAGGCTGGG + Exonic
1119769473 14:77211486-77211508 GGTCCAGGAGGGCCCAGGGAGGG - Intronic
1119932590 14:78562605-78562627 GGCCCAGGAGGTCCCAGGCATGG + Intronic
1120623741 14:86798363-86798385 GGACCAGGAGGGAGCAAGCCAGG + Intergenic
1121098535 14:91234100-91234122 GCTCCAGGACCGGCCGGGCCAGG - Exonic
1121433416 14:93903225-93903247 GGTCCAGGAGTGCTCAGGACTGG + Intergenic
1121505676 14:94474749-94474771 GGTCCAGAAGAGGCAAGCCCTGG - Intronic
1122023809 14:98859991-98860013 GGGGCAGCAGGGGCCAGGCTTGG + Intergenic
1122191960 14:100052459-100052481 TATGCAGGAGGGGCCAGGCACGG + Intronic
1122208392 14:100159689-100159711 GGTCCCGGCGGGGCGGGGCCAGG + Exonic
1122275072 14:100587069-100587091 GGCCCGGGAGGAGCCGGGCCGGG - Intronic
1122307800 14:100776711-100776733 GGTGCAGGAGGGGCTGGGGCAGG - Intergenic
1122842113 14:104471061-104471083 TGTCCAAGAGGAGACAGGCCAGG - Intergenic
1122865612 14:104602711-104602733 GCTCAAGGTGGGGTCAGGCCGGG - Intronic
1122887953 14:104718923-104718945 GCTCCAGGAGGGCCCCGGCTGGG - Exonic
1122890931 14:104731909-104731931 GGGCCAGCAGGGGCCAGGAAAGG + Intronic
1123036692 14:105474627-105474649 GGGCCCGGGGGCGCCAGGCCTGG + Intronic
1123059452 14:105587923-105587945 AGGCCAGGAGGGGCGAGGCGGGG - Intergenic
1123083787 14:105708193-105708215 AGGCCAGGAGGGGCGAGGCGGGG - Intergenic
1124349316 15:28943769-28943791 GCCCAAGGAGGGGCCAGGGCTGG - Intronic
1124370273 15:29100723-29100745 GGCCCAAGAGTGGCCTGGCCTGG - Intronic
1124492851 15:30168666-30168688 GGTCCAGGAGGAACCATGCTTGG + Intergenic
1124750683 15:32369659-32369681 GGTCCAGGAGGAACCATGCTTGG - Intergenic
1124794143 15:32760450-32760472 TGCCCAGGATGGGCCAGGCACGG - Intergenic
1125727840 15:41877124-41877146 TGTCCAGGTGCAGCCAGGCCTGG + Exonic
1125879935 15:43185264-43185286 GGAGGAGGCGGGGCCAGGCCTGG + Exonic
1127771107 15:62231542-62231564 GTACCAGGAGAGGCCATGCCTGG - Intergenic
1128453298 15:67819608-67819630 GGTCCTGGTGGGCCCAGACCCGG - Intergenic
1128511059 15:68314124-68314146 GGTCCAGTCCGTGCCAGGCCAGG - Intronic
1128525551 15:68409978-68410000 GGTGTAGGAGGGGACAAGCCTGG - Intronic
1128698978 15:69790073-69790095 GGTCCAGGTAGGGCCAGCCTGGG + Intergenic
1128699478 15:69793876-69793898 GGTGCAGGAGGGGTCAGGGAGGG + Intergenic
1128778447 15:70341817-70341839 TGTCCTGCAGGGCCCAGGCCAGG - Intergenic
1128790253 15:70427994-70428016 GGCCTGGGAGGGGACAGGCCTGG - Intergenic
1129028941 15:72604799-72604821 GGCACAGGAGGGTCCAGGGCAGG + Intergenic
1129185707 15:73905046-73905068 GGCCCAGGAGGGTGCAGCCCAGG + Intergenic
1129219295 15:74122117-74122139 GGTCAAGGACGTGCCAAGCCTGG - Intronic
1129260190 15:74361986-74362008 GGTCCAGGAATGGCAAGACCAGG + Intronic
1129319680 15:74767682-74767704 GGACTAGGAGGGGACTGGCCTGG - Intergenic
1129389865 15:75215092-75215114 GATACAGGAGGGGCCTGCCCTGG - Intergenic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1129604641 15:77018922-77018944 GGTCCAGGAGGGGACACACCTGG + Intronic
1129662016 15:77558169-77558191 GGGTAAGGAGGGGCCTGGCCTGG + Intergenic
1129671017 15:77607715-77607737 GGCCCAGCAGGGACCAGGCCAGG + Intergenic
1129676464 15:77634606-77634628 GGACCAGCAGGGGGCAGGCTCGG + Intronic
1131063128 15:89416688-89416710 GTTCCCGGCGGGGCCTGGCCTGG + Intergenic
1131080058 15:89527141-89527163 GGGTGAGGAGAGGCCAGGCCTGG + Intergenic
1131360354 15:91785075-91785097 GCTCCAGGGAGGGCCAGGGCAGG + Intergenic
1132237493 15:100233036-100233058 GGTACAGAAGAGGCCAGGCGCGG + Intronic
1132737607 16:1394694-1394716 GGAGCAGGAGGGGCTGGGCCAGG - Intronic
1132769971 16:1556377-1556399 GGCAGAGGAGGCGCCAGGCCAGG - Intronic
1132780966 16:1625246-1625268 GGTCTCGGAGGAGCCTGGCCAGG + Intronic
1132870114 16:2112173-2112195 GGTGAGGGAGGGGCCAGGCGTGG - Intronic
1132876958 16:2144242-2144264 GGGGCAGGAGGAGCCAGGGCAGG + Intronic
1132877796 16:2148158-2148180 GGTCCAGGAAGCTCCAGCCCTGG - Intronic
1132892051 16:2209336-2209358 GGGCCAGGCTGGGCCAGGTCGGG + Exonic
1132946730 16:2535887-2535909 AATCCAGGAGAGGCCAGGCTGGG - Intergenic
1132957720 16:2604358-2604380 TGTCCAGGAAGGGCCAGGTAAGG + Intergenic
1132988949 16:2783316-2783338 GGTCACGGCTGGGCCAGGCCAGG - Intergenic
1133027992 16:2996968-2996990 GGACCAGGAAGGGGCAGGGCTGG + Intergenic
1133190726 16:4131812-4131834 GGTCCAGGAAGGGCCGGCACTGG + Intergenic
1133257395 16:4525599-4525621 AGTCCATGTGGGACCAGGCCAGG + Intronic
1133332991 16:4987872-4987894 GGCCCAGGAGGGGCGAGGGCTGG + Intronic
1133371586 16:5249344-5249366 CCTCCTGGAGGGGCCTGGCCGGG + Intergenic
1133758527 16:8780208-8780230 GGGGGAGGAGAGGCCAGGCCCGG + Intronic
1134457785 16:14407196-14407218 GGTCCAGGAGTGCACTGGCCAGG + Intergenic
1134522431 16:14924783-14924805 GGTGAGGGAGGGGCCAGGCGTGG + Intronic
1134710101 16:16323434-16323456 GGTGAGGGAGGGGCCAGGCGTGG + Intergenic
1134717313 16:16363434-16363456 GGTGAGGGAGGGGCCAGGCGTGG + Intergenic
1134949502 16:18345211-18345233 GGTGAGGGAGGGGCCAGGCGTGG - Intergenic
1134957439 16:18388725-18388747 GGTGAGGGAGGGGCCAGGCGTGG - Intergenic
1135546158 16:23368106-23368128 GTGCCAGGGGAGGCCAGGCCAGG + Intronic
1136276699 16:29183008-29183030 GGGTCAGGAGGGGCTGGGCCTGG + Intergenic
1136296554 16:29307329-29307351 GGTGCAGGAGGTGCCAGGAGTGG + Intergenic
1136318705 16:29468684-29468706 GGTCAAGCTGGGGCCAGGCATGG - Intergenic
1136433277 16:30208028-30208050 GGTCAAGCTGGGGCCAGGCATGG - Intronic
1136718373 16:32302169-32302191 GGTCAAGGTAGGGCCAGGGCAGG + Intergenic
1136836748 16:33508439-33508461 GGTCAAGGTAGGGCCAGGGCAGG + Intergenic
1137613256 16:49833099-49833121 GTCCCATGAGGGGCCAGGCCTGG - Intronic
1138416451 16:56874314-56874336 GGTGCAGGAGGCGCCAGAGCTGG + Intronic
1138438591 16:57020697-57020719 GGTCCATGAGGAGCCAGCCCTGG - Exonic
1138457868 16:57131713-57131735 GGGCCAGGAGGGGCCAGGCCTGG - Intronic
1138659938 16:58510960-58510982 GGCTCAGGCAGGGCCAGGCCTGG - Intronic
1139340715 16:66266266-66266288 GGTCCAGCAGGGGAGAGGACAGG - Intergenic
1139504464 16:67392148-67392170 GGCCCAGGGGGTGGCAGGCCAGG - Intronic
1139544781 16:67645075-67645097 GGGCGGGGAGGGGCCGGGCCGGG + Exonic
1139549128 16:67663808-67663830 TGTCCTGCAGGAGCCAGGCCTGG - Exonic
1139592385 16:67940510-67940532 GGGCCAGGGGTAGCCAGGCCTGG - Intronic
1139682241 16:68574058-68574080 GGTCCAGGATGTCCCAGGCATGG - Intronic
1139973526 16:70791145-70791167 GGTGCAGCATGGGCCAGGCAGGG - Intronic
1140219409 16:73033065-73033087 GGTCAAGGAGGGCCCAGGCTTGG - Intronic
1140224596 16:73067390-73067412 GTACCTGGAGGGGCCAGGCTGGG - Intergenic
1140406402 16:74714136-74714158 GGTCGGGAAGGGGCCAGGGCCGG + Exonic
1140412008 16:74746846-74746868 GGCCCAGGTGGGGTCAGGGCAGG + Intronic
1141172812 16:81701840-81701862 AGGCCAGGGGGGGCCAGGGCGGG + Intronic
1141602744 16:85136441-85136463 GGCCCAGCTGAGGCCAGGCCAGG - Intergenic
1141665704 16:85464091-85464113 CAGCCAGGAGGGGCCAGGCATGG - Intergenic
1141699609 16:85636375-85636397 GGGCGACGAGGGCCCAGGCCTGG - Intronic
1141768616 16:86075000-86075022 CGTGGAGGAGGAGCCAGGCCCGG - Intergenic
1142081081 16:88149069-88149091 GGGTCAGGAGGGGCTGGGCCTGG + Intergenic
1142126089 16:88411387-88411409 GGGGCAGCAGGGGCAAGGCCAGG + Intergenic
1142280732 16:89146346-89146368 GATCCCGGATGAGCCAGGCCAGG + Intronic
1142315764 16:89344040-89344062 GGAGCAGGAGGGGCGGGGCCGGG - Intronic
1203008055 16_KI270728v1_random:215596-215618 GGTCAAGGTAGGGCCAGGGCAGG - Intergenic
1203146928 16_KI270728v1_random:1808718-1808740 GGTCAAGGTAGGGCCAGGGCAGG + Intergenic
1142716148 17:1748007-1748029 GATCCAGGAGGGGCTGGGCGCGG + Intronic
1142979513 17:3663564-3663586 GGTCCCAGAGGCCCCAGGCCAGG + Exonic
1143148034 17:4789320-4789342 GCTCCAGGAGGGACCAGAACAGG + Intronic
1143346123 17:6250564-6250586 GGAAGAGGAGGGGCCAGGCGCGG - Intergenic
1143503820 17:7353134-7353156 CGTCCAGGAGGGGCCGGATCTGG - Exonic
1144452669 17:15394072-15394094 GGTCCAGGATGGGCCAGGTGTGG + Intergenic
1145235535 17:21205452-21205474 GCTGCAGGAGGAGGCAGGCCAGG + Intronic
1145259644 17:21347109-21347131 GCTCCAGGGGAGTCCAGGCCAGG - Intergenic
1145316971 17:21740839-21740861 GCTCCAGGGGAGCCCAGGCCAGG + Intergenic
1145904300 17:28507877-28507899 GGTCCAGGGTGAGCCAGGCAGGG + Intronic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1145931209 17:28687132-28687154 GGTCCTGGATGCGCCGGGCCAGG - Exonic
1145977692 17:28993714-28993736 GGGCCATGAGGTGCCAGGGCCGG + Intronic
1146581222 17:34040181-34040203 GGCGCAGGAGGGCCCAGGCCAGG + Intronic
1146937785 17:36823492-36823514 GGGCCAGGCTGGGCCAGGCTGGG - Intergenic
1147122067 17:38341458-38341480 GGTCCAGGCAGTGCCAGGTCAGG - Intronic
1147562990 17:41520347-41520369 GATCCAGGAGGGGGCAGGATGGG - Exonic
1147567084 17:41544382-41544404 GCTCCTGCAGGGCCCAGGCCTGG - Intergenic
1147673775 17:42191405-42191427 GGTCCTGGAGGGGGCAGACTTGG + Intronic
1147769330 17:42856789-42856811 GCTCCAGGCTGGGCCATGCCTGG - Exonic
1147916740 17:43892189-43892211 AGTGTAGGAGGGGCCAGGCTGGG - Intronic
1147985944 17:44308076-44308098 GGTGCAGGCGGGTCCAGCCCAGG + Intergenic
1148286743 17:46400162-46400184 GGGCCAGCAGGGGCCAGGAAAGG - Intergenic
1148308909 17:46617752-46617774 GGGCCAGCAGGGGCCAGGAAAGG - Intronic
1148549600 17:48542586-48542608 GGTCCTGGAGGGGTGAGGACCGG + Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148804613 17:50257886-50257908 GGGGCAGGCGGGGCCTGGCCGGG + Intergenic
1150108537 17:62478956-62478978 GGCGCAGGAGGGCCCAGGCCGGG - Intronic
1150249942 17:63699797-63699819 GGTCCTCGCGGGGCCAGGTCGGG - Intronic
1150280554 17:63927702-63927724 GGGCCAGGCTGGGCCAAGCCAGG - Intergenic
1151396500 17:73826628-73826650 GGTCCAGGAGAGGACAGTCCTGG - Intergenic
1151671575 17:75574163-75574185 GGCCGAGGAGGGCCCAGGCGGGG + Intronic
1151763660 17:76121573-76121595 GGGCCGGGCCGGGCCAGGCCGGG + Intronic
1151924319 17:77182992-77183014 GGTCGAGGTGGTGGCAGGCCTGG - Intronic
1151965008 17:77426549-77426571 GTTCCAGGAGCAGCCAGGCCAGG - Intronic
1152101064 17:78301986-78302008 GGTGCAGGGCAGGCCAGGCCTGG - Intergenic
1152110512 17:78355207-78355229 TGACGAGAAGGGGCCAGGCCAGG - Intergenic
1152162470 17:78677383-78677405 GGGCCAGGCAGGGCCGGGCCTGG - Intronic
1152278126 17:79369839-79369861 GGGACAGGAGGGACAAGGCCAGG - Intronic
1152299017 17:79484659-79484681 GCTCCAGGAAGGGGCTGGCCTGG + Intronic
1152538204 17:80962400-80962422 GCCCCATGAGGGGCCTGGCCAGG - Intronic
1152561735 17:81082047-81082069 GGGCCAGGAGGGAGCAGGACAGG - Intronic
1152641966 17:81452979-81453001 GGTCTAGGAAGGGCAGGGCCAGG - Intronic
1152675963 17:81641424-81641446 GGTCCATGAGGTGACAGGGCTGG - Intronic
1152739907 17:82014312-82014334 GGTCCAGGTGGGGTAGGGCCTGG - Intronic
1153705046 18:7736798-7736820 AGGCCAGGCAGGGCCAGGCCTGG + Intronic
1154001236 18:10483913-10483935 GGTGCAGGAGGAGGCAGCCCGGG + Intronic
1154021029 18:10664032-10664054 GCTGCAGGAGGGCCGAGGCCCGG + Intergenic
1154152018 18:11913782-11913804 GGCCCAGGAAGGGGCAGTCCTGG - Intergenic
1154194390 18:12254881-12254903 CTTCCAGGAGGGGCCAAGCCTGG - Intronic
1154415580 18:14173804-14173826 GGCCCAGGCTGGGCCAGGGCAGG + Intergenic
1154475125 18:14747982-14748004 GGTCGAGGAGGGGCCAGGGGCGG + Intronic
1154529595 18:15330691-15330713 GGTTGAGGAGGGGCCAGGGGCGG - Intergenic
1155174646 18:23291630-23291652 TGTGCAGGAGAGGCCAGGCATGG - Intronic
1155939277 18:31787306-31787328 TGTCCAGGACGGGCCGGGCGCGG - Intergenic
1157613612 18:48974641-48974663 GGGTCAGGAGGGGAGAGGCCCGG - Intergenic
1157719364 18:49912022-49912044 GCTCCAGGAGAGGCCTGACCAGG - Intronic
1160393520 18:78555667-78555689 GGTCCTGCAGGGACCATGCCCGG - Intergenic
1160492214 18:79347963-79347985 GGTCCAGGAAGGGCAGGGTCCGG + Intronic
1160511607 18:79456308-79456330 GGTGCAGGAAGCGCCAGGCAAGG + Intronic
1160559881 18:79749520-79749542 AGTCCAGGAGGGGGCGGGCCTGG - Intronic
1160691994 19:464417-464439 GGGCCATGGGGAGCCAGGCCGGG - Intronic
1160787488 19:907742-907764 GGCCAAGGGGGAGCCAGGCCTGG - Intronic
1160790374 19:920209-920231 GGTCCAGGAGGGGCGGTGCGAGG + Intronic
1160989726 19:1855558-1855580 GGGGCAGGATGGGCGAGGCCCGG - Intronic
1161025552 19:2035092-2035114 GGGCCTGGAGGGGCGAGGCTTGG - Intergenic
1161066503 19:2241093-2241115 GGTCCAGGAGAGGCCACGACAGG + Intronic
1161237096 19:3203688-3203710 GGTGGAGGAGGGACCAGGCCAGG - Intronic
1161400355 19:4064516-4064538 GGTCCCGGGGAGGCCAGGCTGGG - Intronic
1161602579 19:5193517-5193539 GTTTCAGGAGAGGCCAGGGCAGG - Intronic
1162020952 19:7868427-7868449 GGTGCAGGAGGGGCCTGGCAGGG - Intergenic
1162070021 19:8147763-8147785 GGGCCAGGTGGGGCCAGGTGGGG + Intronic
1162117563 19:8440407-8440429 AGTCCAGCATGGGCCAGGCCTGG + Intronic
1163116576 19:15192295-15192317 GGGCCTGGAGGGACCAGGACAGG + Exonic
1163314305 19:16531867-16531889 GGCACACGAGGCGCCAGGCCAGG + Intronic
1163472301 19:17504725-17504747 AGTCCAGGATGGGCCGTGCCAGG - Exonic
1163683900 19:18699887-18699909 GGCCTAGGAGGGGCCAGGGCAGG + Intronic
1163699593 19:18780668-18780690 AGCCCATGGGGGGCCAGGCCGGG + Exonic
1163700739 19:18785386-18785408 GGGCCAGAAGGGGGCTGGCCCGG - Intronic
1163861935 19:19747371-19747393 GTCCCAGCAGGGGCCAGACCTGG + Intergenic
1163907711 19:20161548-20161570 AGGCCAGGTGGGCCCAGGCCTGG - Intergenic
1164149052 19:22532847-22532869 GGCGCAGGAGGGTCCAGGGCAGG - Intergenic
1164155703 19:22595833-22595855 GGCGCAGGAGGGTCCAGGGCAGG + Intergenic
1164534667 19:29076270-29076292 GGCTCAGCAGGGCCCAGGCCTGG + Intergenic
1164620723 19:29694706-29694728 GGTCCCGGCCAGGCCAGGCCAGG - Intergenic
1164840308 19:31388120-31388142 GCTCCAGGAGGGCTGAGGCCAGG - Intergenic
1164840494 19:31389212-31389234 GGCCCAGCAGGGGCCAGGGCTGG + Intergenic
1165060524 19:33202903-33202925 GGTAGTTGAGGGGCCAGGCCGGG - Exonic
1165060870 19:33204677-33204699 GGCCCAGCAGGAGCCAGTCCAGG - Exonic
1165095333 19:33406966-33406988 GGCCCAGCAGGGGTGAGGCCTGG + Intronic
1165145706 19:33728723-33728745 GGTGCAGGGGAGCCCAGGCCAGG + Intronic
1165255802 19:34576762-34576784 TGTCCCGCAGGGGACAGGCCTGG + Intergenic
1165386520 19:35513436-35513458 GGGCCAGCAGGAGGCAGGCCAGG + Exonic
1165446722 19:35860734-35860756 GGGCCTGGAGGGGCGGGGCCGGG + Intronic
1165459559 19:35936584-35936606 GGGCCGGGTGGGGCGAGGCCTGG - Intronic
1165745701 19:38228754-38228776 GGGTCAGGAGGGGCCAGGCTCGG + Intronic
1165805853 19:38580214-38580236 GGCTGAGGAGGGGCAAGGCCAGG + Intronic
1165855875 19:38879078-38879100 GGTTAAGAGGGGGCCAGGCCCGG + Exonic
1166340628 19:42134705-42134727 GGTACAGGGGAGGCCAGGCTGGG + Intronic
1167015476 19:46838406-46838428 AGTCCAGGAGGGGCCGGGGCCGG + Exonic
1167077621 19:47258916-47258938 GACCCTGGAGGGGGCAGGCCTGG - Intronic
1167279492 19:48558547-48558569 GGGCGAGGAGGGGCCAGCTCTGG + Intronic
1167291852 19:48629096-48629118 GAGCCAGGAGAGGCCAGGGCAGG - Exonic
1167379055 19:49128170-49128192 GGTCCGGAAGGGGCCGGGCTTGG + Intronic
1167426894 19:49434178-49434200 GAGCGAGGAGGGGCTAGGCCTGG - Intronic
1167708987 19:51098729-51098751 CGTCCAGGAGCGCGCAGGCCTGG + Exonic
1167781450 19:51601559-51601581 CGTCCAGGAGGGAGCAGGCCTGG - Intergenic
1167979344 19:53260156-53260178 GGTGCAGATGGGGCCAGGCATGG + Intronic
1168059135 19:53881856-53881878 GGTCCAGCAGTGGACAGGCAGGG - Intronic
1168246822 19:55116783-55116805 GGTTCAGGAGAGGGCAGGGCAGG + Intronic
1168641472 19:58034303-58034325 GGCCCGGGAGGGGGCGGGCCGGG + Intronic
925023226 2:588016-588038 CTTCCAGGAGGGGCAGGGCCAGG + Intergenic
925132140 2:1501731-1501753 GGTCCTGGGGGGCCCATGCCTGG - Intronic
925300796 2:2810704-2810726 GGTGCAGCAGGAGCAAGGCCAGG - Intergenic
926226048 2:10967645-10967667 GGAGGAGGAGGGGCCAGGCAAGG - Intergenic
926699845 2:15796345-15796367 GATCCAGGAGGGGACAGGGGAGG + Intergenic
927703821 2:25285102-25285124 GTTCCAGAAGTGGTCAGGCCGGG + Intronic
927704181 2:25286825-25286847 GGGGCAGAAGAGGCCAGGCCTGG - Intronic
927847933 2:26480872-26480894 GGCCCAGCAGGAGCCGGGCCCGG + Exonic
927855888 2:26527796-26527818 GGGGCAGGAGGGGCTGGGCCTGG - Intronic
928167448 2:28981410-28981432 GGGCCAGGGTGGGCCAGGCCTGG + Exonic
929446537 2:42006110-42006132 GGCCCAGGAGGGGACATGGCAGG - Intergenic
929606231 2:43236097-43236119 GGTGCAAGATGGGCCAGGCGTGG - Intronic
930753552 2:54954348-54954370 GGGCCAGGAGGAGGCTGGCCAGG + Intronic
931257203 2:60584088-60584110 TGAACAGGAGGGGCCTGGCCGGG + Intergenic
931516447 2:63053038-63053060 GGTCCATGGCGGGCCCGGCCAGG - Exonic
932493950 2:72137535-72137557 TGGCCAGGAGGGGCCATCCCAGG + Intronic
932995214 2:76843715-76843737 GGTTGAGGATGGGCCAGGTCTGG + Intronic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
933721220 2:85398779-85398801 GGACCTGCAGGGGCCAGGGCAGG + Exonic
933767279 2:85718848-85718870 GGACCAGGACAGGCCAGGCAAGG - Intergenic
933780515 2:85797436-85797458 GGTCAGGGAGGTGCCAGGGCAGG - Intergenic
934079190 2:88452730-88452752 GGCCCAGGAGGAGCCGCGCCGGG - Intergenic
934729531 2:96647895-96647917 GGCCCAGGAAGGCCCAGGCAGGG + Intergenic
934849769 2:97690669-97690691 GGAAAAGGAGGGGCCAGGCCCGG - Intergenic
937364172 2:121248949-121248971 TGGCCAGGAGAGGCCAGGCAAGG - Intronic
937853453 2:126656206-126656228 TGGCCAGGCCGGGCCAGGCCGGG - Exonic
937980007 2:127609266-127609288 GGGCCAGGAGGGGAGAGGGCAGG + Intronic
938228364 2:129636891-129636913 GGGCCAGCAGGGGACAGGCCGGG - Intergenic
941932161 2:170953058-170953080 GGTAAAGGAGGAGCTAGGCCTGG + Intronic
944837557 2:203594981-203595003 GGTTCAGGAAGGGGTAGGCCTGG + Intergenic
946156523 2:217810174-217810196 CGTGCAGGAGGGGTCAGGGCAGG + Intronic
946231231 2:218292335-218292357 GGCCCAGGAGCGGGCAAGCCGGG + Intronic
946335156 2:219031060-219031082 GGTGCAGGAGGGGCCAGTCTGGG + Intronic
946428518 2:219612738-219612760 GGGCCGGCAGGGGCCAGGTCAGG + Intronic
947335628 2:229079957-229079979 GGTCCAGGAGGGAGCTTGCCTGG + Intronic
947389872 2:229628057-229628079 GGTCCAGGAAGGCCCTCGCCTGG + Intronic
947399097 2:229714532-229714554 GCTGCAGGAGGCGCCCGGCCCGG - Exonic
947501831 2:230676484-230676506 GGTCCAAGAAGGGCAAGGCAGGG + Intergenic
948019915 2:234723622-234723644 ACTCCAGGAGGGGCCAGTCTTGG + Intergenic
948100620 2:235369962-235369984 AGTAGAGGAAGGGCCAGGCCAGG + Intergenic
948206579 2:236165890-236165912 GGTCCAGAAGGGCCAGGGCCTGG - Exonic
948216593 2:236237439-236237461 GGGCCGGGAGGTGCCAGGTCTGG + Intronic
948725374 2:239930791-239930813 GGTCCAGGAGGGGTGTGGCAGGG + Intronic
948725406 2:239930877-239930899 GGTCCAGGAGGGGTGTGGCAGGG + Intronic
948725438 2:239930963-239930985 GGTCCAGGAGGGGTGTGGCAGGG + Intronic
948794597 2:240395755-240395777 GCTGCGGGAGGAGCCAGGCCAGG + Intergenic
948894656 2:240922495-240922517 GGTTCAGGAGCAGCCAGACCAGG + Intronic
948896368 2:240929784-240929806 GCCCCAGCAGGGGCCAGGCCTGG + Intronic
948999785 2:241606689-241606711 GATCCAACAGGGGCCAGGCAGGG + Intronic
1168994782 20:2125023-2125045 CATCCATGAGGGGACAGGCCTGG + Intronic
1169330770 20:4714381-4714403 GACCCAGCAGGGGCCAGGCATGG + Intergenic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1170799951 20:19582845-19582867 GGACCATGAGGTGGCAGGCCTGG + Intronic
1170827649 20:19810106-19810128 GTGCCAAGAGGGGCCAGGCGTGG + Intergenic
1171291227 20:23984229-23984251 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1171291708 20:23986235-23986257 GGACCAGGCTGGGCCAGGCAAGG - Intronic
1171383111 20:24748071-24748093 GGTCCAGGTGTGGGCAGGGCTGG - Intergenic
1172061998 20:32193029-32193051 GTTCCAGGAGAGGCCAGGGTGGG + Exonic
1172436166 20:34930381-34930403 GGTCCAGGAGGGGCAGGTTCAGG - Intronic
1172457944 20:35092581-35092603 GGACCAGGAGGGGCGGGGCGGGG - Intronic
1173056218 20:39615836-39615858 GGCCCAGGAGGGGTCAGGGTAGG + Intergenic
1173500291 20:43548251-43548273 GCTGCAGGAGGGCCCAGCCCTGG - Intronic
1173918197 20:46725327-46725349 GGCCCAGGACCAGCCAGGCCAGG - Exonic
1174282153 20:49447164-49447186 GGCCCAGGAGGGGGCAGCCAGGG + Intronic
1174359665 20:50020156-50020178 GGTCCAGCGGCGGCCAGGGCAGG + Intergenic
1175248934 20:57597354-57597376 TGTACAGGTGGGGCTAGGCCGGG - Intergenic
1175284714 20:57830339-57830361 GGTACAGGTGGGGCCAGGGGAGG + Intergenic
1175598669 20:60255485-60255507 GGTCCAGGAGGGGCTGGGTCTGG + Intergenic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1175973188 20:62697438-62697460 AGTCCAGGAGGGTCCAGGCATGG - Intergenic
1175999896 20:62827086-62827108 ACTCCTGGAGGGCCCAGGCCTGG + Intronic
1176147673 20:63572685-63572707 GGCCCAGGGAGGGGCAGGCCGGG - Intronic
1176200351 20:63857654-63857676 AGCCCTGCAGGGGCCAGGCCTGG - Intergenic
1176219007 20:63961249-63961271 AGCCCAGGAGGGGACAGGGCTGG - Intronic
1176240022 20:64071620-64071642 GGACCAGGAGGGCCCAGACTTGG - Intronic
1176241847 20:64079112-64079134 TTCCCTGGAGGGGCCAGGCCAGG - Intronic
1176241906 20:64079315-64079337 GGGGCAGGAGGGGCCAGGTTGGG + Exonic
1176301772 21:5102069-5102091 GTTGCAGGAGGGGCCAGCACAGG - Intergenic
1176767812 21:13037781-13037803 GGTTGAGGAGGGGCCAGGAGCGG + Intergenic
1176866851 21:14058727-14058749 GGTCCAGGCTGGGCCAGGACAGG + Intergenic
1178224377 21:30698997-30699019 GGTCTAGGAGGGGCCAGTGGTGG - Intergenic
1179164681 21:38926168-38926190 GGTCCAGGATGGGCTGGGGCAGG + Intergenic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1179725365 21:43338792-43338814 GGAACAGGAGAGGCCAGCCCAGG - Intergenic
1179855259 21:44159831-44159853 GTTGCAGGAGGGGCCAGCACAGG + Intergenic
1180205488 21:46256826-46256848 GGTCCAGGAGGCCCCTGGCCAGG + Exonic
1180549635 22:16529463-16529485 GGCCAAGGAGGGGTCAGGGCAGG - Intergenic
1180765684 22:18344858-18344880 GGACCAGGCTGGGCCAGGCAAGG + Intergenic
1180766176 22:18346865-18346887 GGGCCAGGTGAGGCCAGGTCGGG + Intergenic
1180780137 22:18515513-18515535 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1180780625 22:18517521-18517543 GGACCAGGCTGGGCCAGGCAAGG - Intronic
1180812853 22:18772834-18772856 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1180813345 22:18774841-18774863 GGACCAGGCTGGGCCAGGCAAGG - Intergenic
1181030038 22:20145278-20145300 GGTCCCAGCCGGGCCAGGCCCGG - Intronic
1181035302 22:20167059-20167081 GGTCCTGATGGGGCCAGGCACGG + Intergenic
1181199011 22:21207082-21207104 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1181199520 22:21209158-21209180 GGACCAGGCTGGGCCAGGCAAGG - Intronic
1181268427 22:21644325-21644347 TGACCAGGAGGTGCCAGCCCAGG + Intergenic
1181400241 22:22646700-22646722 GGACCAGGCTGGGCCAGGCAAGG + Intronic
1181400733 22:22648706-22648728 GGGCCAGGTGAGGCCAGGTCGGG + Intergenic
1181403424 22:22665602-22665624 GAACCAGCAGGAGCCAGGCCAGG + Intergenic
1181403944 22:22668626-22668648 GTTCCAGCAGAAGCCAGGCCAGG + Intergenic
1181408427 22:22701587-22701609 GAACCAGCAGGAGCCAGGCCAGG + Intergenic
1181413750 22:22745086-22745108 GAACCAGCAGGAGCCAGGCCAGG + Intronic
1181439880 22:22930289-22930311 GGGCCAGGCACGGCCAGGCCTGG - Intergenic
1181496338 22:23289307-23289329 GGCCCTGGAGAGCCCAGGCCTGG - Intronic
1181648658 22:24247172-24247194 GGCCCAGGTGAGGCCAGGTCGGG - Intergenic
1181649125 22:24249090-24249112 GGACCAGGCTGGGCCAGGCAAGG - Intergenic
1181702214 22:24627798-24627820 GGACCAGGCTGGGCCAGGCAAGG + Intronic
1181702713 22:24629804-24629826 GGGCCAGGTGAGGCCAGGTCGGG + Intergenic
1181788948 22:25248244-25248266 GGTGCAGGAGGGTTCAGGGCTGG - Intergenic
1182275818 22:29188043-29188065 GGCCGAGGAGCAGCCAGGCCTGG + Intergenic
1182362142 22:29752952-29752974 GGTCAGGGAGGGGCCTGCCCAGG - Intronic
1183179534 22:36250356-36250378 AGGCCAGGCGGGCCCAGGCCTGG - Intergenic
1183404973 22:37625949-37625971 GGTGAGGAAGGGGCCAGGCCTGG + Exonic
1183439191 22:37813603-37813625 GGCCCAGGTGGGGCGACGCCTGG + Exonic
1183492170 22:38122522-38122544 GGCCTAGGAGGTGCCAGGCTGGG + Intronic
1183622987 22:38985722-38985744 GGGAGAGGAGGGGCCAGGACAGG - Intronic
1183629535 22:39024981-39025003 GGGGGAGGAGGGGCCAGGACAGG - Intronic
1183632992 22:39044851-39044873 GGGAGAGGAGGGGCCAGGACAGG - Intronic
1183638750 22:39080844-39080866 GGGGGAGGAGGGGCCAGGACAGG - Intronic
1184042454 22:41952190-41952212 GGGCCAGGAGGGGGCAGTCCTGG - Intergenic
1184073744 22:42163088-42163110 GCTCAAGGAGGGGACAGGGCAGG + Intronic
1184116626 22:42426316-42426338 GGTGGAGGAGGGGCAGGGCCTGG - Intronic
1184306374 22:43605352-43605374 ACTCCACAAGGGGCCAGGCCTGG + Intronic
1184335165 22:43848608-43848630 GGGCCAGGTGGGGCCAAGGCAGG + Intronic
1184388157 22:44187923-44187945 GGCCCTGGAGGGGCCAGGTCAGG - Intronic
1184454191 22:44599759-44599781 GTTCCAGGGGTGCCCAGGCCCGG + Intergenic
1184651802 22:45922707-45922729 GGTGCAGGAGGGCACCGGCCGGG - Exonic
1184691503 22:46119400-46119422 AGTCCAGGAAGGGCCCAGCCAGG + Intergenic
1184805551 22:46792931-46792953 GGGCCAGGACAGGCCAGGGCCGG - Intronic
1185032120 22:48449644-48449666 GGCCAAGGAGGAGGCAGGCCTGG + Intergenic
1185089035 22:48755678-48755700 TGTGCAGGAGGTGCCAGGCCTGG - Intronic
1185351638 22:50342841-50342863 GGACGGGGAGGGGCCAGGCCTGG + Intergenic
1185382771 22:50517816-50517838 AGCCTAAGAGGGGCCAGGCCAGG - Intronic
1203227306 22_KI270731v1_random:85748-85770 GGACCAGGCTGGGCCAGGCAAGG + Intergenic
1203227794 22_KI270731v1_random:87756-87778 GGGCCAGGTGAGGCCAGGTCGGG + Intergenic
1203263447 22_KI270734v1_random:523-545 GGACCAGGCTGGGCCAGGCAAGG - Intergenic
950091827 3:10301202-10301224 GGCCCAGGAAGGGGCAGTCCTGG + Exonic
950185164 3:10940238-10940260 GACCCAGGAAGGGCCAGGCTGGG + Exonic
950534423 3:13571000-13571022 GGTCCAGGCGGGTGCAGTCCAGG + Exonic
950703755 3:14767446-14767468 GGCCCAGCAAGGGCAAGGCCAGG - Intronic
951091217 3:18576231-18576253 GGTCCAGGATAGGCCAGATCTGG - Intergenic
951906878 3:27715021-27715043 GGTCCAGGAGGGGGCTGGAAAGG + Intergenic
953413185 3:42701577-42701599 GGGCCAGGCGGGGCCAGGCGGGG + Intronic
953413190 3:42701587-42701609 GGGCCAGGCGGGGCCAGGGAGGG + Intronic
953577050 3:44121167-44121189 TGTCCTGGAGGGGCCTGGCCCGG - Intergenic
953699660 3:45185890-45185912 GTACCCGGAGGGGCCAGGCAGGG + Intergenic
953981081 3:47413304-47413326 GGTGCAGGCTGGGCCAGGCAGGG - Exonic
954008198 3:47610158-47610180 GCTCCAAGTGGGGCCAGGCCAGG + Exonic
954145525 3:48632541-48632563 GGTTCAGGTTTGGCCAGGCCAGG + Intronic
954615606 3:51967519-51967541 GGGCGGGGAGGGGCCGGGCCGGG - Intronic
955317875 3:57953785-57953807 GAACCAGGAGGGGTCAGGCCCGG + Intergenic
955408691 3:58642189-58642211 AGCCCAGGAAGGGCCAGGGCAGG - Intronic
955886078 3:63600324-63600346 GTGCCAGGAGGGGACAGGCATGG + Intronic
955893849 3:63678048-63678070 GGTATATCAGGGGCCAGGCCTGG - Intronic
956499006 3:69861532-69861554 AGGTCAGGAGGCGCCAGGCCAGG + Intronic
958269069 3:91476015-91476037 GGTCTTGGAGGGGCCAGGCATGG + Intergenic
959818425 3:110703587-110703609 GATTCAGGAGGGGCCAGGGGTGG - Intergenic
960394247 3:117117033-117117055 GGTCCAGGAGGCCCCAGGGGAGG - Intronic
960556276 3:119034488-119034510 CTTCCCGGTGGGGCCAGGCCGGG - Intronic
960947695 3:122978187-122978209 GGCCCAGGTGGGGCCAGGCCTGG - Intronic
961383352 3:126510023-126510045 TCTCCAGCAGGTGCCAGGCCCGG + Intronic
961722956 3:128908306-128908328 TGCCCAGCAGGGGCCAGTCCAGG + Intronic
961745033 3:129059331-129059353 GGTGCTGGAGCTGCCAGGCCAGG - Intergenic
961754864 3:129121689-129121711 GGTCCGGGCGGGGCCGAGCCGGG - Exonic
962916966 3:139912899-139912921 CGCCCAGGCGGGGCCAGGCAAGG - Intergenic
963769881 3:149378881-149378903 TGGCCGGGTGGGGCCAGGCCTGG + Intergenic
964751666 3:160059351-160059373 GAGGCATGAGGGGCCAGGCCAGG + Intergenic
965803946 3:172523348-172523370 GGTCCAGGGGGGACCCAGCCTGG - Exonic
966187096 3:177237354-177237376 GTTCCATGAGGAGACAGGCCAGG - Intergenic
966863149 3:184241705-184241727 GGGCTCTGAGGGGCCAGGCCAGG + Exonic
968047157 3:195630900-195630922 AGTCCAGGAGGAGCCTGGCCAGG + Intergenic
968047416 3:195631939-195631961 GGCCCAGGAGGAGCCTGGCCAGG - Intergenic
968307197 3:197657985-197658007 GGCCCAGGAGGAGCCTGGCCAGG + Intergenic
968307490 3:197659144-197659166 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
968578511 4:1378979-1379001 GGTCCAGGCGGCCCCAGGGCAGG + Intronic
969014967 4:4098004-4098026 CCTCCTGGAGGGGCCTGGCCAGG - Intergenic
969689156 4:8694733-8694755 GGAACAGGGTGGGCCAGGCCAGG + Intergenic
969912204 4:10457200-10457222 GGGCCTGACGGGGCCAGGCCGGG - Intronic
970027005 4:11634399-11634421 GGGACAGGTGGGGCCAGGCTTGG - Intergenic
970376319 4:15460857-15460879 GCTCCAGGAGGGTCCATTCCTGG + Intergenic
972436335 4:39038949-39038971 GTTCCAGGATGGGCCGGGCGCGG - Intergenic
972475640 4:39446886-39446908 GGTCGTAGAGGCGCCAGGCCAGG - Exonic
972716918 4:41655817-41655839 GCTGCAGGAAGGGCCAGGCATGG - Intronic
976874500 4:89837051-89837073 GCTCTCGGAGGGGCCGGGCCGGG + Intronic
979624159 4:122827152-122827174 GGTCCCTGCGGGGCCCGGCCGGG - Exonic
980550598 4:134328924-134328946 GGAGCATGAGGGGCCAGGCCTGG - Intergenic
980571118 4:134621893-134621915 AGTCCAGGCAGGCCCAGGCCTGG - Intergenic
982091488 4:151883615-151883637 GTTCCAGCAGAGGCCAGGCCTGG - Intergenic
983348938 4:166562151-166562173 GGTCCAGGATGGTCCTAGCCTGG + Intergenic
984700104 4:182813780-182813802 TGTCCAGGGTGGGCCAGGGCCGG + Intergenic
985570246 5:640874-640896 GGTGCTGCAGGAGCCAGGCCTGG + Intronic
985575063 5:670125-670147 GCTCCTGGAGGCCCCAGGCCGGG - Intronic
985629127 5:1005641-1005663 GGCCCAGGAGAGGACACGCCGGG + Intergenic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
985676201 5:1232451-1232473 GGTACGGAAGCGGCCAGGCCAGG + Intronic
985677759 5:1241055-1241077 GGCTCAGGAGGGGCGCGGCCTGG + Intronic
985744193 5:1637225-1637247 AGGCCAGGAGGAGCCTGGCCAGG + Intergenic
985744447 5:1638233-1638255 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
985771643 5:1815490-1815512 AGCCCAGGAGGGGACATGCCGGG - Intronic
988893614 5:35647677-35647699 GGTACAGCAGGGGCCAGTCAAGG + Intronic
989560164 5:42841272-42841294 TGTCCAGGATGGGCAAGACCTGG + Intronic
991088186 5:62667646-62667668 GGTCCTGGTGGGGCCAGAGCTGG + Intergenic
991724973 5:69526985-69527007 GGTGAAGCAGGGGCCAGGCGCGG + Intronic
992233517 5:74685514-74685536 GGTGCAGGAGGGGCCCGCCGTGG - Exonic
992774380 5:80076979-80077001 GGTCCAGGGGGCACCAGGTCTGG - Exonic
995872305 5:116756144-116756166 GGTCAAGGAGGGGCCGGGCACGG + Intergenic
996416533 5:123216832-123216854 GATCCATGAAGGGCCAGGCCAGG + Intergenic
996756340 5:126939356-126939378 GGTCCAGGAGCGGCTGGGCTGGG + Intronic
997425681 5:133801149-133801171 GGGTCAGGATGGACCAGGCCTGG - Intergenic
997434137 5:133862035-133862057 GAAGCAGGAGGGGCCAGGCGCGG + Intergenic
997697389 5:135872419-135872441 GGTCAGGGAAGGGCCAGGCATGG - Intronic
998552148 5:143087937-143087959 GGGCCAGGATAGGCCAGGCGTGG - Intronic
998849329 5:146338780-146338802 GGACTGGGAGAGGCCAGGCCAGG + Intronic
999314505 5:150575258-150575280 GGGCCAGGATGGGCCAGGTGGGG - Intergenic
999500411 5:152141476-152141498 GGTCCACTTGGGGCCAGGCTGGG - Intergenic
1000043222 5:157500704-157500726 GTTCCAGAAAGGTCCAGGCCAGG - Intronic
1001296866 5:170504519-170504541 GGTAGGGGAGGGGCCGGGCCCGG + Intronic
1001794278 5:174489074-174489096 GGTGCAGGAGGTGCTTGGCCAGG + Intergenic
1002272245 5:178080208-178080230 TCTCCAGGAGGGGCCAGGCCTGG - Intergenic
1002365022 5:178703129-178703151 AGAACAGGAGAGGCCAGGCCAGG + Intergenic
1002516462 5:179762507-179762529 GTTCCAGGAGGACCCAGTCCTGG - Intronic
1002639405 5:180623623-180623645 GGACCAGGAGGGGACAGGGCTGG - Intronic
1002851953 6:1004099-1004121 GACCCAGGAGGGGCCTGGCAGGG - Intergenic
1003222543 6:4174092-4174114 AGTCAATGTGGGGCCAGGCCCGG - Intergenic
1006021327 6:31119448-31119470 GGTCCAGGGGTTGCCCGGCCTGG + Intronic
1006080084 6:31560020-31560042 GGTGCAGGAGGGGGAAGGGCTGG + Intergenic
1006153213 6:32000408-32000430 GCACGAGGAGGGGTCAGGCCTGG + Intronic
1006159521 6:32033145-32033167 GCACGAGGAGGGGTCAGGCCTGG + Intronic
1006742706 6:36320805-36320827 GGGCCAGGAGTGGCCAGGTGTGG + Intronic
1006809420 6:36810411-36810433 GATTCATGAGGGGCCAGGGCTGG - Intronic
1007336924 6:41160948-41160970 GGGCAAGGAGGGCCAAGGCCAGG + Intronic
1007390394 6:41547010-41547032 GCGCCAGGAGGAGCCGGGCCCGG + Intronic
1007473867 6:42106710-42106732 GGTGCAGGAGGGGGCAGGGGAGG + Exonic
1007605283 6:43113590-43113612 CTTCCAGAAAGGGCCAGGCCCGG - Intronic
1007793298 6:44326526-44326548 GGTGGAGGCGGGGCCTGGCCAGG + Intronic
1008273863 6:49520723-49520745 AGACCAGGAAGGGCCAGGCATGG + Intronic
1008986161 6:57545722-57545744 GGTCTTGGAGGGGCCAGGCATGG - Intronic
1009174119 6:60438277-60438299 GGTCTTGGAGGGGCCAGGCATGG - Intergenic
1011629537 6:89310788-89310810 GGACAAGCAGAGGCCAGGCCAGG + Intronic
1012866323 6:104622608-104622630 GGTGCAGGAGAGGCCAATCCAGG + Intergenic
1017406917 6:154129370-154129392 AGGCCAGGCGGGCCCAGGCCTGG + Intronic
1018033351 6:159861777-159861799 GGTCTAGGAGTGGCTGGGCCAGG - Intergenic
1018812606 6:167308562-167308584 GGTGCAGGAGGAACCAGGGCAGG + Intronic
1018848127 6:167569250-167569272 GGTCCCGGAAGGGTCGGGCCCGG + Intergenic
1019020409 6:168913203-168913225 AGTGCAGGAGGGGCCTGTCCTGG - Intergenic
1019168771 6:170117001-170117023 GGCCCAGGAGAGGCCAGTCCTGG + Intergenic
1019266636 7:120854-120876 CGTCCAGCAGAGGCCAGTCCAGG - Intergenic
1019338634 7:496902-496924 GGTGGTGGAGGGGCCAGCCCGGG + Intergenic
1019542515 7:1557966-1557988 GCTCCAGGAGGGCCCAGCCAGGG - Intronic
1019680794 7:2347930-2347952 GGTCCAGTGTGGGCCAGGCGTGG - Intronic
1019696830 7:2450920-2450942 GGTCCAGGAGATGCCAGGCCAGG - Intergenic
1019713202 7:2526721-2526743 GGTCCAAGGGAGGCCAGGGCAGG + Intronic
1019735171 7:2646879-2646901 GGTCCAGGGCGAGGCAGGCCAGG - Exonic
1019925180 7:4186909-4186931 GGTCTAGTAGTGGCCAGACCTGG + Intronic
1020094514 7:5361151-5361173 GTGCCAGAAGGGGCCAGCCCTGG + Intronic
1020187521 7:5970483-5970505 GGGCGAGGAGGGCCTAGGCCGGG - Intronic
1020295397 7:6754287-6754309 GGGCGAGGAGGGCCTAGGCCGGG + Intronic
1021717045 7:23469907-23469929 AGCCCGGGTGGGGCCAGGCCCGG + Intronic
1021877116 7:25059500-25059522 GGTCAAGATGAGGCCAGGCCAGG - Intergenic
1022141828 7:27499583-27499605 GGTCCAGGAGGGGCAGGCACGGG - Intergenic
1022175659 7:27869639-27869661 CATCCAGGACGGGGCAGGCCAGG + Intronic
1023617796 7:42038199-42038221 AGTGCAGGAGCAGCCAGGCCAGG + Intronic
1023820760 7:43979385-43979407 GGTCAAGGGGGGGCCAGGACTGG + Intergenic
1024337140 7:48220595-48220617 TGTCCAGGATGGGGCAGGGCTGG + Intronic
1025190744 7:56893687-56893709 GGAGCAGGAGGGGCCAGCTCTGG + Intergenic
1025261980 7:57425838-57425860 GGGCCAGACGGGGACAGGCCCGG - Intergenic
1025615468 7:63113447-63113469 GGACCAGCCGGGGGCAGGCCTGG + Intergenic
1025681199 7:63683237-63683259 GGAGCAGGAGGGGCCAGCTCTGG - Intergenic
1025739305 7:64183055-64183077 GGGCCAGCCGGGGACAGGCCTGG - Intronic
1025950657 7:66142785-66142807 GGGCCAGGAGAAGCCAGGCACGG - Intronic
1026377601 7:69767622-69767644 GAACCAATAGGGGCCAGGCCAGG + Intronic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1026787984 7:73313639-73313661 GGTCTAGAAGGGGCCAGTACAGG + Intronic
1028774075 7:94658228-94658250 GGCCCAGGAGAGGCGGGGCCTGG - Intronic
1028774104 7:94658318-94658340 GGCCCAGGAGAGGCGGGGCCTGG - Intronic
1028774119 7:94658363-94658385 GGCCCAGGAGAGGCGGGGCCTGG - Intronic
1029227415 7:99038177-99038199 GGCCCTGATGGGGCCAGGCCTGG - Intronic
1029272513 7:99385540-99385562 GGAGCAGCAGGGGCCAGCCCTGG - Intronic
1029339159 7:99929164-99929186 TGTCCTGGAGGGGGCAGCCCTGG - Exonic
1029348023 7:99992837-99992859 GGTCCTGGAGGGGACAGCGCCGG + Intergenic
1029360967 7:100088579-100088601 GGGCTAGAAGAGGCCAGGCCGGG + Intergenic
1032037573 7:128531497-128531519 GGCGCAGAAGGGCCCAGGCCGGG - Intergenic
1032165309 7:129540429-129540451 GTTCACGGAGAGGCCAGGCCTGG + Intergenic
1032408196 7:131673139-131673161 GGTCAAAGAGGTCCCAGGCCAGG + Intergenic
1034908582 7:154973148-154973170 GGTCCAAGAGCTGCAAGGCCAGG - Intronic
1034939392 7:155220569-155220591 TGTGGAGGAGGGGCCAGGCTGGG - Intergenic
1035011858 7:155725616-155725638 GTTTCAGGAGGGGCCATGGCAGG + Intronic
1035254045 7:157614830-157614852 GGTCCAGGATGTGGCAGGGCTGG - Intronic
1035264776 7:157684839-157684861 GGCCCAGGAGGGCACAGGGCGGG - Intronic
1035287275 7:157814461-157814483 GGGACAGGAGGGGGCAGGACAGG + Intronic
1035354635 7:158269634-158269656 GGTCCAGGATGGCACAGGACGGG + Intronic
1035393859 7:158523136-158523158 GGTCCAGGAGGGGACATCACAGG + Intronic
1035596326 8:860956-860978 TGTCCAGCAGGGGACAGGCACGG - Intergenic
1035705500 8:1671510-1671532 GCTCCAGGAGGGTCCTGTCCCGG + Intronic
1036495595 8:9267416-9267438 TGTCCAGGAGGTCCCAGGACAGG - Intergenic
1036588866 8:10149461-10149483 GGCCCTGGAGGGGCCTGGGCAGG - Intronic
1036629674 8:10502236-10502258 AGTCTATGAGGGGCCAGGCGCGG + Intergenic
1037050440 8:14366531-14366553 GATCTAGGAGGGGCCAGGGGTGG - Intronic
1037317038 8:17608926-17608948 AGCCAAGGAGGGGCCAGGCAAGG + Intronic
1037876631 8:22551866-22551888 GGGTCAGGACGGGCCGGGCCGGG - Exonic
1037964162 8:23120321-23120343 GGTCCAGGAGGAACAAGGCAAGG + Intergenic
1037967719 8:23146802-23146824 GGACCAGGAGGGGCCAACGCAGG + Intronic
1038165370 8:25080689-25080711 GGGCCAGGTGGGGCCAGGTGGGG + Intergenic
1038429719 8:27490816-27490838 CGTCCAGGAAGGCCCGGGCCTGG + Exonic
1038525245 8:28267544-28267566 AGGCCTGGAGGGGCCAGGGCAGG + Intergenic
1039424918 8:37477726-37477748 GGTGCAGGAGAGGCCAGTGCTGG - Intergenic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1041107814 8:54458973-54458995 CGTCCAGGTGGGGCCAGGTGGGG + Intronic
1043497415 8:80817503-80817525 GGGACAGGAGGGGCAAGGACAGG - Intronic
1043542522 8:81280222-81280244 GGTGCAGGAGAGGCGGGGCCAGG + Intergenic
1044384414 8:91570453-91570475 GCTCCTGAAGGGGCCAGGCATGG - Intergenic
1044730585 8:95225807-95225829 GGGACAGAAGGGGCCAGGCAGGG - Intergenic
1045189899 8:99872057-99872079 GGTTCAGGAAGGGCCAGGATTGG + Intronic
1046745239 8:117868971-117868993 GGTCCTGGGGGCCCCAGGCCAGG - Intronic
1047022012 8:120785273-120785295 GGACCAGGAGGGGTATGGCCTGG + Intronic
1047222701 8:122931226-122931248 GCTCCTGGAGGCGCCAGGCGTGG - Intronic
1047255194 8:123208703-123208725 CATACAGGAGGGGCCAGGCGTGG + Exonic
1047304224 8:123640098-123640120 GGTACTGGAGGTTCCAGGCCGGG + Intergenic
1047304906 8:123644781-123644803 GGTCCAGGACTAGCCAGTCCTGG + Intergenic
1047376456 8:124301651-124301673 GGTCCCGGAGGTCCCCGGCCTGG - Intergenic
1048072759 8:131039706-131039728 GGTCCATGGGGGCCGAGGCCAGG + Exonic
1048285423 8:133137544-133137566 TGTCCAGGAGGGGCGGGGGCTGG + Intergenic
1048302239 8:133260245-133260267 GGGCCAGGAGGAGCCCAGCCAGG + Intronic
1048308068 8:133297301-133297323 GGTCTGGGAGGGGCGAGGCGCGG - Exonic
1048432267 8:134381553-134381575 GGGCCAGGTGGGGCCATGCATGG + Intergenic
1048878804 8:138857042-138857064 AGGCCAGGAGGGGACAGGCAGGG - Intronic
1048990406 8:139757192-139757214 GGTGCAGGAGGAGCCAGGGTTGG + Intronic
1048994940 8:139788459-139788481 GCACCAGGAAGGGCCAGGCTGGG - Intronic
1049205711 8:141362567-141362589 GTTTCAGAGGGGGCCAGGCCAGG - Intronic
1049228118 8:141467359-141467381 GGGCCAGGAAGGGCCAGGAAGGG - Intergenic
1049389540 8:142360777-142360799 GGCCCAGGAGGAGGGAGGCCTGG + Intronic
1049400362 8:142423979-142424001 GGTCCAGGAGGGGCTGGGTTTGG + Intergenic
1049414568 8:142489275-142489297 GGGCCAGGAGGAGCCTGGGCTGG + Intronic
1049427558 8:142544181-142544203 GGTGCAGGAGGGGTGGGGCCCGG - Intronic
1049460289 8:142724154-142724176 GGCCAAGGAAGGGCCAGGTCTGG + Intergenic
1049496962 8:142940035-142940057 GGTCCAGCAAGGACCAAGCCTGG - Intergenic
1049553188 8:143270108-143270130 GGGCCACGAGGGCCGAGGCCAGG - Intronic
1049623170 8:143608220-143608242 GGCCCAGGATGGGCCAGGCGTGG - Intronic
1049624532 8:143614092-143614114 AGCCCAGCAGGGGCCAGCCCAGG + Intronic
1049643842 8:143727474-143727496 GGGCCCGGAGGAGCCTGGCCTGG - Exonic
1049672062 8:143874270-143874292 GGTGCAGAAGGGGACAGGCCTGG - Intronic
1050171016 9:2816669-2816691 GGTAAATGAGTGGCCAGGCCAGG - Intronic
1050498398 9:6268212-6268234 GTGGCAGGAGGGGCCCGGCCAGG + Intergenic
1052856232 9:33408241-33408263 GGTGCAGGCTGGGCCAGGCTGGG + Intergenic
1053167628 9:35855682-35855704 GATTCAGGAGAGGCCAGGCGCGG - Intergenic
1053707309 9:40768473-40768495 GGTTGAGGAGGGGCCAGGGGCGG - Intergenic
1054417225 9:64889241-64889263 GGTTGAGGAGGGGCCAGGGGCGG - Intergenic
1056660493 9:88539475-88539497 GGTCCGGCTGGGGCCAGACCAGG - Intronic
1057488608 9:95506037-95506059 GGGCCGGGAGAGGCCAGCCCCGG + Intronic
1057896318 9:98911963-98911985 GGGTCAGGATGGGCCAGGCATGG + Intergenic
1058434797 9:104952422-104952444 GGTCCAGGAAGGGCCAGGTGTGG - Intergenic
1058699117 9:107586595-107586617 GGCCCAGAAATGGCCAGGCCTGG + Intergenic
1060163413 9:121388021-121388043 GGTCCAAAAGGGGACTGGCCGGG - Intergenic
1060200130 9:121647482-121647504 GGTACATCATGGGCCAGGCCAGG - Intronic
1060770201 9:126326898-126326920 GGCGCGGGAGGGGCCGGGCCCGG - Exonic
1060931871 9:127494243-127494265 GGTCCAGGAGGGGCCCGCAAAGG + Intronic
1060971354 9:127739962-127739984 GGTGCAGGAGGGAACGGGCCTGG + Intronic
1061030556 9:128079700-128079722 AACCCAGGAGGGGCCAGGCGCGG + Intronic
1061133373 9:128720505-128720527 GGTGCAGGTGGGGTCAGGGCAGG - Exonic
1061308728 9:129748616-129748638 TGGCCAGGTGTGGCCAGGCCAGG + Intronic
1061389814 9:130311237-130311259 GGGCCAGGCTGGGCCAGGGCTGG + Intronic
1061426359 9:130500809-130500831 AGGGCAGGAGGGGCCAGGGCGGG + Intronic
1061586020 9:131569114-131569136 AGTGCATGAGGGGCCAGGCACGG - Intergenic
1061729461 9:132602294-132602316 GGACCAGGTTGGGCCAGGCTGGG + Intronic
1061778646 9:132983094-132983116 AGTCTTGGTGGGGCCAGGCCAGG - Intronic
1061779378 9:132986790-132986812 GGTGCAGCAGGCGCCAGCCCGGG - Intronic
1062193677 9:135260768-135260790 GGCCAAGGAGGGGCAAGGCAGGG + Intergenic
1062281491 9:135753891-135753913 GGTGCTAGAGGGGCCAGGGCCGG + Intronic
1062502778 9:136858440-136858462 CGCCCAGGCCGGGCCAGGCCAGG - Exonic
1062546122 9:137064478-137064500 GGACCAGCCGGGGGCAGGCCTGG + Exonic
1062560802 9:137141035-137141057 AATCCAGGAGGGGCCATTCCTGG + Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1203770396 EBV:47218-47240 GGTGGAGGAGGTCCCAGGCCTGG + Intergenic
1188897919 X:35693411-35693433 AGTCCAGGCGGGCCCAGGCCTGG - Intergenic
1190278456 X:48914107-48914129 GGGCCAGGCCAGGCCAGGCCAGG + Exonic
1190335282 X:49258262-49258284 GGCCCAGGATGGGGCAGGCAGGG - Intronic
1190366025 X:49695657-49695679 GGTCGTGAAGGGGCCAGGACAGG - Intronic
1190427415 X:50346064-50346086 AGACAAGGAAGGGCCAGGCCAGG - Intronic
1192436847 X:71148412-71148434 TTGCCAGGAGGGGCCTGGCCCGG + Intronic
1192915756 X:75649479-75649501 GGGCCAGGCAGGCCCAGGCCTGG + Intergenic
1193174659 X:78378221-78378243 GGTCAAAGATGGGCCAGGCGTGG - Intergenic
1194206673 X:91018995-91019017 AGTCCAGAAGGGGCTAGACCAGG + Intergenic
1195067752 X:101252903-101252925 GGGCCAGCTGTGGCCAGGCCTGG - Intronic
1196020985 X:110990835-110990857 AGTCAAGGTGGGGCCAGGCACGG + Intronic
1198125726 X:133641680-133641702 GGTCCAGGAAGCACCAGGCGTGG - Intronic
1199720421 X:150539542-150539564 GGTCATGGAGAGGCCAGACCAGG + Intergenic
1199792949 X:151171936-151171958 GGAGCAGGAGGGGCAGGGCCTGG + Intergenic
1200063404 X:153493785-153493807 GGTCTGGGAGGTCCCAGGCCAGG - Intronic
1200108972 X:153729425-153729447 GCTCCAAGAGGATCCAGGCCAGG + Intronic
1200134371 X:153867736-153867758 ACCCCAGGAGGGGCCAGGGCTGG + Intronic
1200156715 X:153980459-153980481 GGGCCAGGAGGCGGCATGCCTGG + Intronic
1200157670 X:153985880-153985902 GGGCCAGGAGGCGGCATGCCTGG - Intergenic
1200552420 Y:4593784-4593806 AGTCCAGAAGGGGCTAGACCAGG + Intergenic
1201075115 Y:10181062-10181084 GGTCCAGGCGAGGCGAGGCAAGG + Intergenic
1201696341 Y:16831467-16831489 AGGCCAGGTGGGCCCAGGCCTGG - Intergenic
1201697309 Y:16840219-16840241 AGGCCAGGTGGGCCCAGGCCTGG - Intergenic
1201730144 Y:17193662-17193684 GGCCCAGGCTGGGCCAGGCCAGG - Intergenic