ID: 1145910012

View in Genome Browser
Species Human (GRCh38)
Location 17:28537035-28537057
Sequence GTGAAGATTGACAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 486}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145910007_1145910012 -6 Left 1145910007 17:28537018-28537040 CCTGCTCTCTGCAGCATGTGAAG 0: 1
1: 0
2: 1
3: 19
4: 276
Right 1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 486
1145910003_1145910012 2 Left 1145910003 17:28537010-28537032 CCCTGACCCCTGCTCTCTGCAGC 0: 1
1: 1
2: 6
3: 69
4: 737
Right 1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 486
1145910000_1145910012 28 Left 1145910000 17:28536984-28537006 CCAGGCTCTGTTCCCAGCACATG 0: 1
1: 0
2: 6
3: 68
4: 554
Right 1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 486
1145910004_1145910012 1 Left 1145910004 17:28537011-28537033 CCTGACCCCTGCTCTCTGCAGCA 0: 1
1: 0
2: 6
3: 60
4: 625
Right 1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 486
1145910001_1145910012 16 Left 1145910001 17:28536996-28537018 CCCAGCACATGTCACCCTGACCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 486
1145910005_1145910012 -4 Left 1145910005 17:28537016-28537038 CCCCTGCTCTCTGCAGCATGTGA 0: 1
1: 0
2: 2
3: 131
4: 2724
Right 1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 486
1145910002_1145910012 15 Left 1145910002 17:28536997-28537019 CCAGCACATGTCACCCTGACCCC 0: 1
1: 1
2: 7
3: 70
4: 901
Right 1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 486
1145910006_1145910012 -5 Left 1145910006 17:28537017-28537039 CCCTGCTCTCTGCAGCATGTGAA 0: 1
1: 0
2: 4
3: 37
4: 1008
Right 1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145910012 Original CRISPR GTGAAGATTGACAGGGAGGA GGG Intronic
901128067 1:6943214-6943236 GTGAGGACGGTCAGGGAGGAGGG - Intronic
902648021 1:17817550-17817572 GTGAGAATGGCCAGGGAGGAGGG - Intronic
903224995 1:21889613-21889635 GTGAAGACTGACCCGGAGGCTGG + Intronic
903229107 1:21911253-21911275 GGGAAGATGTACTGGGAGGAGGG + Intronic
903826287 1:26147854-26147876 GTGCATCTGGACAGGGAGGATGG + Intergenic
904478994 1:30782547-30782569 GGGGAGACGGACAGGGAGGAAGG + Intergenic
904631657 1:31847345-31847367 GAGCAGAGTGGCAGGGAGGAGGG + Intergenic
905150973 1:35927399-35927421 GTGAGGATAAACATGGAGGATGG - Exonic
905678955 1:39852815-39852837 GTGGAGCTTGAAAAGGAGGATGG - Exonic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
906670862 1:47653636-47653658 GAGAAGCTTGAGAGGGAGCACGG - Intergenic
907528241 1:55067064-55067086 ATGAAGCTTTACAGTGAGGACGG + Exonic
908100862 1:60789717-60789739 GTAAGCATTGACAGAGAGGAGGG + Intergenic
908390910 1:63682804-63682826 GAGAATATTGACAGGGGGCAGGG - Intergenic
908929744 1:69304235-69304257 GTGAGCATTGCCAGGGAAGAAGG - Intergenic
910125921 1:83842160-83842182 ATAAAGATTGACAGACAGGAAGG - Intergenic
910617754 1:89218149-89218171 ATGAGGATTGCCAGGGAAGAAGG + Intergenic
911368664 1:96971036-96971058 GCGAAGGTTTACAGGCAGGAGGG - Intergenic
912145040 1:106783326-106783348 ATGAAGATCGAAAGGTAGGATGG + Intergenic
912338846 1:108889893-108889915 GTGAAGAATGGCAGGAAGTAAGG - Intronic
912504855 1:110149646-110149668 GTGAAGTTAGACAGGGAGGCAGG - Intergenic
912620933 1:111157151-111157173 GTGCAGATTCACAGGAAGAAAGG + Intronic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
913327580 1:117639991-117640013 GGGTAGATTGACAGGCTGGAGGG + Intergenic
913561844 1:120029103-120029125 GTGTAGATTGAGGGGGAGCAGGG - Intronic
913636282 1:120764491-120764513 GTGTAGATTGAGGGGGAGCAGGG + Intergenic
914282427 1:146188499-146188521 GTGTAGATTGAGGGGGAGCAGGG - Intronic
914543456 1:148639215-148639237 GTGTAGATTGAGGGGGAGCAGGG - Intronic
914623166 1:149431794-149431816 GTGTAGATTGAGGGGGAGCAGGG + Intergenic
915460141 1:156065560-156065582 GTGAATATGGACAGGGATGGTGG - Intronic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915815749 1:158963009-158963031 CTGAGGATTCATAGGGAGGAGGG - Intronic
917521729 1:175753352-175753374 GTGAAGATTAACTGAGATGATGG + Intergenic
917635406 1:176930943-176930965 GTGAAGATTAAAATGGAGGAGGG + Intronic
917844525 1:179009396-179009418 CTGAAGCTAGAAAGGGAGGAGGG + Intergenic
918183348 1:182105573-182105595 TTGAAGAGTTACAGGGAGGGAGG - Intergenic
918630532 1:186712221-186712243 GTGGAGATTGACTGGGAAGAGGG - Intergenic
919813192 1:201421822-201421844 GTGAAGGGTGGGAGGGAGGAGGG - Intronic
920266380 1:204726553-204726575 GTGAAGAATGACAGAGGGCAGGG - Intergenic
920490595 1:206411524-206411546 TTAAAAATTGACGGGGAGGAGGG + Intronic
920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG + Intergenic
921828408 1:219700088-219700110 GTGAGGACAGACAGGGAGTAAGG + Intronic
922478430 1:225922624-225922646 CAGAAGATTGGCAGGGAAGAAGG - Intronic
924251392 1:242136688-242136710 GTGAAGTTTGAAAGAGAGGTTGG - Intronic
1062800493 10:375966-375988 GTAAAGATTGCTGGGGAGGAGGG - Intronic
1063211083 10:3881943-3881965 GTGAAGCAAGACTGGGAGGAGGG + Intergenic
1063422993 10:5928502-5928524 CTAAAGAGTGAGAGGGAGGAAGG - Intronic
1064754072 10:18559037-18559059 GTGAAGAATGGAATGGAGGATGG + Intronic
1065552373 10:26881810-26881832 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1065660633 10:28001252-28001274 GTGAAGAGTGTCAGGAAGCAAGG - Intergenic
1066009279 10:31179363-31179385 GCGAAGTTTCACAGGGAGGAGGG - Intergenic
1066242183 10:33549071-33549093 GTGAACAGTGACAAGGAGGTTGG - Intergenic
1066296297 10:34056858-34056880 GTGAAGAGTGCCTGGGGGGAGGG - Intergenic
1066403866 10:35100790-35100812 GTAAAAATTGACAGGGGAGAGGG + Intergenic
1066580871 10:36880609-36880631 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1070469683 10:76766484-76766506 GTGAAGAAAGGAAGGGAGGAAGG + Intergenic
1070769861 10:79075931-79075953 GGGATGACTGGCAGGGAGGATGG + Intronic
1071964507 10:90838489-90838511 GTGGAGAATGAAATGGAGGAGGG - Intronic
1072784446 10:98270107-98270129 GTGAACATAGCCAGGCAGGAGGG - Intergenic
1073662624 10:105493619-105493641 GAGTAGATGGAAAGGGAGGATGG + Intergenic
1073909189 10:108321108-108321130 GTTAAGACACACAGGGAGGATGG - Intergenic
1074620071 10:115109439-115109461 GTGAAGAGAGAAAGAGAGGAGGG + Intronic
1075417347 10:122274473-122274495 GTTAAGATTGATTGGAAGGATGG - Intronic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077156220 11:1092951-1092973 GTGAAGGTGGTCAGGGTGGACGG - Intergenic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077589725 11:3482112-3482134 GTGAAGAGTGGCTGGGATGAAGG + Intergenic
1078629552 11:12989808-12989830 GGGATGTGTGACAGGGAGGAGGG + Intergenic
1079536790 11:21524872-21524894 ATGAGGAATGACAGTGAGGAAGG + Intronic
1079756934 11:24275653-24275675 GTGAAGATTGACACAGAGATTGG - Intergenic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1081575775 11:44317813-44317835 TTGCAGAATGAAAGGGAGGAGGG - Intergenic
1081999784 11:47387950-47387972 TTGCAGAGTGACAGGGAGGCTGG + Intergenic
1082664381 11:55956700-55956722 GGGAAGTTACACAGGGAGGAAGG - Intergenic
1082805432 11:57446395-57446417 CTGAAGATGAACAGGGAGGCAGG + Intergenic
1082870802 11:57942794-57942816 GTGAAGAGAGACAGGTAGAAAGG + Intergenic
1083146951 11:60767148-60767170 CTGCAGATTGACAGGGTGGTGGG + Intronic
1083270464 11:61569714-61569736 GAGAGGAAGGACAGGGAGGAAGG + Intronic
1083326309 11:61874729-61874751 GTGAGCAGGGACAGGGAGGAGGG - Intronic
1083443531 11:62692130-62692152 GGGAAGATGAACAGGGATGATGG + Intronic
1083538344 11:63491937-63491959 GGGAACTTTCACAGGGAGGAGGG - Intergenic
1083737108 11:64687636-64687658 GGGAAGAGTGGCAAGGAGGAGGG + Intronic
1084438397 11:69157201-69157223 GGGAAGCTTGGCAGGGAGGCTGG - Intergenic
1085272852 11:75280593-75280615 GGGGAGAGTGACAGGGAGGTCGG - Intronic
1085618486 11:78020107-78020129 GGGAAGACTGAAAGGTAGGAGGG + Intronic
1089117706 11:116109487-116109509 GTGGTGCTTGACAGGGAGTAGGG + Intergenic
1089174386 11:116537805-116537827 GTGAAGCTGGACAGGCAGAAAGG - Intergenic
1089272955 11:117314734-117314756 TTGGAGATTGTCAGGAAGGATGG + Intronic
1089378427 11:118011277-118011299 GGGAATCTTGAAAGGGAGGATGG - Intergenic
1089480223 11:118798665-118798687 ATGAAGTTTGTCAGGGAGGGAGG - Intergenic
1089481029 11:118805224-118805246 GCCAAGAGAGACAGGGAGGAAGG - Intergenic
1089910405 11:122093561-122093583 GTGAACATTGACAGGGATGATGG + Intergenic
1089916166 11:122159078-122159100 GTAGAGATAGAAAGGGAGGAGGG + Intergenic
1090915087 11:131155952-131155974 GACAAGAGTGACAGGGAGAAAGG + Intergenic
1090990397 11:131812225-131812247 GGGGAGAATGAGAGGGAGGAAGG - Intronic
1092606529 12:10126163-10126185 AGGAAGAATGACAGGGAGAAAGG - Intronic
1094028280 12:25981851-25981873 GTTAAAGTTAACAGGGAGGATGG - Intronic
1094415948 12:30215117-30215139 GTGAGGATTGTCAGGGACTATGG + Intergenic
1094417927 12:30236826-30236848 GTGAACAATGACAGAGCGGAAGG + Intergenic
1095523405 12:43095413-43095435 GTGACATTTGGCAGGGAGGAGGG + Intergenic
1096569615 12:52514462-52514484 TTGATGATTCACAGGGAGAATGG - Intergenic
1096640122 12:52987714-52987736 GAGAAGAAAGAAAGGGAGGAAGG + Intergenic
1096707435 12:53431152-53431174 GGGGGGAATGACAGGGAGGAAGG - Intronic
1096909282 12:54966023-54966045 CTGAAGTTTGGCAGGGTGGAAGG - Intronic
1098008999 12:66030624-66030646 GGGAAGAAAGAAAGGGAGGAGGG - Intergenic
1098281835 12:68870051-68870073 TTGAAGAATCACAGGAAGGATGG + Intronic
1098429559 12:70404922-70404944 GTGAACATTTAGAGTGAGGAGGG + Intronic
1098472313 12:70859497-70859519 TTGAAGATTCTCAGGGAGGGGGG + Intronic
1100958977 12:99941897-99941919 AAGAAGGTGGACAGGGAGGACGG + Intronic
1101057635 12:100935429-100935451 ATTAAGAATGACAGGAAGGATGG - Intronic
1101736000 12:107463831-107463853 GCAAAGATTGAAAGGGAGGCTGG - Intronic
1101858609 12:108464492-108464514 GAGAAGAAAGGCAGGGAGGATGG + Intergenic
1102521879 12:113482696-113482718 AAGAAAATAGACAGGGAGGAGGG - Intergenic
1102556076 12:113727391-113727413 GAGAAGAAAGAAAGGGAGGAAGG - Intergenic
1102581569 12:113891537-113891559 GTCCAGGTGGACAGGGAGGAAGG + Intronic
1102623598 12:114216694-114216716 GGGAGGAATGAAAGGGAGGAAGG + Intergenic
1102657819 12:114497761-114497783 GAGAAGCTTGAGAGGGAAGAGGG - Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1103990464 12:124795643-124795665 GTGGAGGTTGAGAGGGAGCATGG - Intronic
1104088888 12:125498000-125498022 GTGAAGGATGACAGTCAGGATGG - Intronic
1106146156 13:27051676-27051698 GGGAAGAGTGAGAGGGAGCAAGG + Intergenic
1106598786 13:31169817-31169839 ATGAAGAGAGAAAGGGAGGAAGG - Intergenic
1106822700 13:33483787-33483809 GTGAGTATTGCCAGGGAAGAGGG - Intergenic
1107303362 13:38991305-38991327 GTGAGGCTGGAAAGGGAGGAAGG - Intergenic
1107798813 13:44083839-44083861 GGGAAGATTAGGAGGGAGGAGGG + Intergenic
1108305443 13:49127557-49127579 GTGAAGCATGTCAAGGAGGAAGG - Intronic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1108786640 13:53910965-53910987 ATGAAGATTGACAGGGCAGATGG + Intergenic
1109529586 13:63624337-63624359 GTGAAGGTTGAGAGGGTTGAAGG + Intergenic
1110751670 13:79122048-79122070 AGGAAGACTGACAGGGAGGATGG - Intergenic
1110809384 13:79794765-79794787 TTGGTGATTGACAAGGAGGAAGG + Intergenic
1111058562 13:82981876-82981898 GGGAACATTTGCAGGGAGGAAGG + Intergenic
1111235587 13:85404031-85404053 CTGGAGATAGACAGTGAGGATGG - Intergenic
1114084123 14:19226562-19226584 GGGAACATGCACAGGGAGGAGGG - Intergenic
1114586050 14:23814860-23814882 GCAAAGAATGACAAGGAGGAAGG + Intergenic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1115276455 14:31614979-31615001 TTGAGGATTGACAATGAGGATGG + Intronic
1115658780 14:35469684-35469706 GTGGATATTGACAGGGCAGATGG + Intergenic
1115732167 14:36282871-36282893 GTGAACATTGACTGTCAGGAAGG + Intergenic
1116545927 14:46165746-46165768 CTGAAAAGTGACAGGGAGAATGG - Intergenic
1116784805 14:49275931-49275953 GGGAAGAATGACAGGGAAGAAGG - Intergenic
1117480492 14:56139185-56139207 GTGGAGATAGAACGGGAGGAAGG + Intronic
1118226647 14:63906904-63906926 GTGAGGATAGACTGAGAGGATGG - Intronic
1118743274 14:68756588-68756610 GAGAAGGCTGACTGGGAGGAAGG - Intergenic
1120818527 14:88889786-88889808 CTGAAGATTGAAAAGGAGGCAGG + Intergenic
1121500281 14:94430408-94430430 ATGAGTATTGCCAGGGAGGAAGG + Intergenic
1121918627 14:97859411-97859433 GTCAAGATGGAAAGGAAGGAGGG - Intergenic
1122535166 14:102456883-102456905 CTTAAGAGTGACAGGGAGGCTGG - Intronic
1122722064 14:103727711-103727733 GGGAGGATTGGCAGTGAGGAGGG - Intronic
1124389819 15:29244413-29244435 GTGAGGATTTACAGGGAAAAAGG - Intronic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125364946 15:38903594-38903616 GTGAGGAATGCCTGGGAGGAGGG - Intergenic
1127619129 15:60716290-60716312 GGGAAGATTCACAGGGAATATGG - Intronic
1129118977 15:73383528-73383550 GTGAGGAGTGACAGAGAGGGAGG - Intergenic
1129221845 15:74135802-74135824 GTAGGGATTGAAAGGGAGGAGGG - Exonic
1130352188 15:83102390-83102412 GTGAAGATGGAGAGGGATCAGGG - Intergenic
1130839211 15:87682034-87682056 GTGAAAAATGGCAGGGAGGGAGG + Intergenic
1131067338 15:89442750-89442772 GTGAAGACTGAAGGGAAGGAAGG + Intergenic
1131434860 15:92414514-92414536 GCCAAGATTGACAGTGAGGAGGG - Intronic
1131762446 15:95639142-95639164 GTGCAGTTTGACAGCGAGCATGG + Intergenic
1132096579 15:98989513-98989535 CTGAAAAGTGACAGGGAGAATGG + Intronic
1133887647 16:9845579-9845601 GTGATGAGTTACAAGGAGGATGG - Intronic
1135118548 16:19745002-19745024 GTGAAGAATCACATGGAAGATGG + Intronic
1137342177 16:47619216-47619238 CTGAAGAATGAAAGGAAGGAGGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1139322155 16:66123608-66123630 GAGGAGGTTGAGAGGGAGGAAGG + Intergenic
1139717419 16:68824578-68824600 TTGAAAATTGACATGGAGTAGGG + Intronic
1140133586 16:72185342-72185364 GTAAAGAAGGGCAGGGAGGAGGG - Intergenic
1140138101 16:72226116-72226138 ATGTAGCTTGACAGAGAGGATGG - Intergenic
1140193201 16:72835641-72835663 ATCAAGACTGACACGGAGGATGG + Intronic
1141190829 16:81823423-81823445 GTGAAGATTGAGTGGGGGTAGGG + Intronic
1142003971 16:87680310-87680332 GTGACGATGGCCAGGGATGAAGG + Intronic
1142958237 17:3535425-3535447 GTGAGGAGGGAGAGGGAGGAAGG - Intronic
1144463680 17:15479371-15479393 GTGAAGCTGGGCTGGGAGGAAGG - Intronic
1144590597 17:16520603-16520625 GTGCAGGTTGATAGGGAGGCTGG + Intergenic
1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG + Intronic
1146301989 17:31696568-31696590 GAGAAGATTCAGAGGCAGGAGGG + Intergenic
1146522632 17:33538149-33538171 GTGATCATTTACAGGCAGGAAGG - Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1148227223 17:45907288-45907310 GGGAAGATGGACACTGAGGAAGG - Intronic
1148828392 17:50412015-50412037 GTGACCATGGAAAGGGAGGAAGG - Intergenic
1148857785 17:50588421-50588443 TGGCAGAGTGACAGGGAGGAGGG + Intronic
1148974821 17:51518450-51518472 GTGAAGAATGAATGGGTGGAAGG - Intergenic
1149093169 17:52808682-52808704 GTGAATATTGCCAGGGAAGAAGG + Intergenic
1149573965 17:57698097-57698119 GGGAAGAGTGACAGGAAGGTGGG - Intergenic
1150932288 17:69598133-69598155 GTGGAGATTGACAGGGGTGCTGG + Intergenic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1152579119 17:81158273-81158295 GGGATGAATGACGGGGAGGACGG - Intronic
1153417941 18:4870401-4870423 GAGTAGATTGGCAGGAAGGATGG - Intergenic
1154131294 18:11738866-11738888 GTGCAGGTTGCCAGGCAGGACGG + Intronic
1155071528 18:22321055-22321077 GGGAAGTTTGAGGGGGAGGAAGG + Intergenic
1157546112 18:48547614-48547636 GTGAAAATGGCCAGCGAGGAGGG - Intronic
1157983446 18:52409800-52409822 GAGGAGATTGTCAGGTAGGAAGG + Intronic
1157986020 18:52438157-52438179 GTGTATATTGAATGGGAGGATGG - Intronic
1158630444 18:59109405-59109427 GGGAGGATTGAAAGGAAGGAGGG + Intergenic
1158876085 18:61735874-61735896 GTGCAGCTTGGGAGGGAGGAGGG - Intergenic
1161372878 19:3923582-3923604 GTGAAGGTTGACTGTGTGGATGG + Intronic
1161719549 19:5895372-5895394 TTGAAGAGAGACAGGGAGGCTGG + Intronic
1161865529 19:6829596-6829618 GCGAAGACTGACAGGCAGTAGGG + Intronic
1163148180 19:15396507-15396529 GCCAAGATTGTCAGGGAGCAGGG - Intronic
1164441147 19:28281842-28281864 GAGAAGAGTGTCAGGGAAGAAGG - Intergenic
1165415963 19:35693724-35693746 GTGAAGGTTGATGGGGAGGGGGG - Intergenic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166457976 19:42960021-42960043 ATGAACATTGCCAGGGAAGAAGG + Intronic
1166474911 19:43115253-43115275 ATGAACATTGCCAGGGAAGAAGG + Intronic
1166710757 19:44935741-44935763 CAGAAGATTAGCAGGGAGGAGGG + Intergenic
1166729016 19:45047617-45047639 GTGCAGGTTGACAGGGATGGGGG + Intronic
1167598206 19:50438328-50438350 GTGCAGATAGACAGGTGGGAAGG + Intronic
1167852837 19:52215034-52215056 ATAAAGATTGACAGAAAGGAAGG - Intronic
1168319246 19:55499449-55499471 GTAAGAATTGACAGGGAGGTAGG + Intronic
925144692 2:1573116-1573138 GTGCAGATTGGCATGGAGAAGGG - Intergenic
925705932 2:6684772-6684794 GGGAAGCTGGAGAGGGAGGAGGG + Intergenic
926272459 2:11377041-11377063 GGGAAGGCAGACAGGGAGGAGGG - Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
928756043 2:34526816-34526838 GTGAAGAGGGGTAGGGAGGAAGG + Intergenic
929138612 2:38648052-38648074 GTGAGTATTGCCAGGGAAGAAGG + Intergenic
929617946 2:43327114-43327136 GTCATGATTGTCATGGAGGAAGG + Intronic
929694157 2:44099957-44099979 GTGAAGATGGACAGGCAAGAGGG - Intergenic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
930236184 2:48891021-48891043 ATAAAAATTGACAGGGAGGGAGG - Intergenic
932501316 2:72185327-72185349 GTGAAGACAGACATGGAGGAAGG - Intronic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933294348 2:80472358-80472380 GTGAAGACTGACTTGGAGGGAGG + Intronic
934035859 2:88088098-88088120 GAGGAGACAGACAGGGAGGATGG - Intronic
934768412 2:96893482-96893504 GTGAAAATGAACAGGGAGGCTGG + Intronic
934856198 2:97731915-97731937 GTGTAGCTTTACAGTGAGGAGGG - Intronic
935287423 2:101578099-101578121 GTGAGGAGAGACAGGGAGGAAGG + Intergenic
935874761 2:107494606-107494628 GAGAAGAGGGAAAGGGAGGAAGG + Intergenic
937311139 2:120904136-120904158 GCCAAGAGTGACTGGGAGGATGG + Intronic
937611207 2:123863818-123863840 GATAAGATTCCCAGGGAGGAAGG + Intergenic
938765381 2:134457717-134457739 ATGAAGACTGTCAGAGAGGAAGG + Intronic
939877651 2:147595943-147595965 GAGAAGATTGGAAGGAAGGATGG - Intergenic
940176677 2:150885197-150885219 GAGAAAATTGACAGGGTGGACGG - Intergenic
940280050 2:151979284-151979306 ATCAAGAATGGCAGGGAGGAGGG - Intronic
940629160 2:156215755-156215777 GAGAACACTGACAGGGAGCATGG + Intergenic
942573690 2:177339820-177339842 GGGAAGAGTGAGAGTGAGGAAGG - Intronic
942629236 2:177938119-177938141 GGGAAGGTTGGAAGGGAGGAGGG + Intronic
942799966 2:179863175-179863197 TTAAAAATAGACAGGGAGGAGGG - Intergenic
943697148 2:190949009-190949031 GGGAAGACTGACAGCAAGGAAGG + Intronic
944944791 2:204671141-204671163 GTCAGGAGTGACTGGGAGGAGGG + Intronic
945523772 2:210862689-210862711 CTGAAGATTGACACTGAGGGAGG + Intergenic
946079569 2:217106080-217106102 CTGAAGCTTGACAGGCAGGAAGG - Intergenic
946695577 2:222355149-222355171 GTGAAGACAGAGGGGGAGGACGG - Intergenic
947030038 2:225782966-225782988 GGGAAGATAGCAAGGGAGGAAGG - Intergenic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
948087242 2:235261727-235261749 GAGAAGATTGAGGGGAAGGAAGG - Intergenic
948485612 2:238279043-238279065 GTGAACAGAGACAGGGAGTAGGG + Intronic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171105957 20:22432551-22432573 GTGGAGAGTGCTAGGGAGGAAGG + Intergenic
1171133526 20:22676539-22676561 GTCAACACTGACAGGGAAGAGGG + Intergenic
1171239471 20:23553453-23553475 CTGAACATTGACAGGGGAGAGGG + Intergenic
1172428654 20:34873006-34873028 GTGTAGATGGACAGCCAGGAAGG + Intronic
1172477203 20:35247902-35247924 AAGAAGCTTGACAGGGAGGTGGG + Intronic
1172613159 20:36266527-36266549 GAGAAGAATGAGCGGGAGGATGG + Intronic
1172770332 20:37378835-37378857 CTGGAGATAGACAGGGTGGAGGG + Intronic
1173577188 20:44120082-44120104 GAGAAGAATGAGAGGCAGGATGG - Intronic
1173870496 20:46338978-46339000 GTGGAGATGGATGGGGAGGAGGG + Intergenic
1174220255 20:48948802-48948824 GGGAAGACGGACAGGGAGGGAGG - Intronic
1175588552 20:60168065-60168087 GTGAAAGTTGACAGGGAGCTTGG - Intergenic
1175596526 20:60239134-60239156 GGGAGGATTGATAGAGAGGAAGG - Intergenic
1175752616 20:61509520-61509542 GTGAATGTTGAGCGGGAGGAGGG + Intronic
1176545387 21:8195080-8195102 GGGAAGACTGAAAGTGAGGAGGG - Intergenic
1176564338 21:8378125-8378147 GGGAAGACTGAAAGTGAGGAGGG - Intergenic
1177393912 21:20509417-20509439 TTGAAGATTGACTTAGAGGAGGG - Intergenic
1177614630 21:23500834-23500856 GTGAAAAGTGAAAGGGAAGAAGG - Intergenic
1178777134 21:35562608-35562630 GAGAAGATTCACATGGTGGAAGG - Intronic
1178826703 21:36023601-36023623 GTGCAGAATGACAGGGAACAGGG - Intergenic
1178961658 21:37072098-37072120 GTGATGAGTGTCAGGGAGCACGG - Intronic
1178999868 21:37447123-37447145 TCATAGATTGACAGGGAGGAAGG - Intronic
1179059821 21:37969513-37969535 GTGAAGAATAAATGGGAGGATGG - Intronic
1179441439 21:41397400-41397422 GGGATGATAGAAAGGGAGGAGGG + Intronic
1179625297 21:42645849-42645871 CTGAGGATTAACTGGGAGGATGG - Intergenic
1180293848 22:10866641-10866663 GGGAACATGCACAGGGAGGAGGG + Intergenic
1180496655 22:15896056-15896078 GGGAACATGCACAGGGAGGAGGG + Intergenic
1181359621 22:22324366-22324388 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181369693 22:22406104-22406126 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181437192 22:22917851-22917873 GTCAGGAATGCCAGGGAGGAAGG - Intergenic
1181536804 22:23550504-23550526 ATGAAGAATGAATGGGAGGATGG - Intergenic
1182233704 22:28859164-28859186 CTGGAGATTGACAGTGATGATGG - Intergenic
1182266621 22:29120521-29120543 GTGATGATGGAAACGGAGGAGGG + Intronic
1182325551 22:29509939-29509961 GTGTAGACTGACAGGGAACAAGG + Intronic
1182954384 22:34407681-34407703 TTGAAGCTTGACAGAGATGAAGG + Intergenic
1183022364 22:35037640-35037662 ATGGAGGTTGACTGGGAGGAGGG - Intergenic
1183095252 22:35548093-35548115 GTGAGGAGGGACAGGGAGGTTGG + Intronic
1183225780 22:36548996-36549018 GTGAAGATCAACAGGGACGAGGG - Intergenic
1183387447 22:37523182-37523204 CAGAGGATTGACAGAGAGGATGG + Intergenic
1183756222 22:39768342-39768364 GTGTGGAGTGACAGGGAGAATGG - Intronic
1184632017 22:45789058-45789080 ATGCAGATTGACAGTAAGGATGG + Intronic
1184959338 22:47917807-47917829 GGGAGGAAGGACAGGGAGGAAGG - Intergenic
1184959351 22:47917854-47917876 GGGAAGAAGGAGAGGGAGGAGGG - Intergenic
1185253023 22:49815607-49815629 GTGCAGGCTGACAGGCAGGAGGG - Intronic
1203250257 22_KI270733v1_random:111318-111340 GGGAAGACTGAAAGTGAGGAGGG - Intergenic
949563304 3:5222463-5222485 GTGAAGATCAACAGTGAAGAAGG + Intergenic
950264491 3:11564035-11564057 GCTAAGACTGACAGAGAGGATGG - Intronic
950480182 3:13239055-13239077 GGGGAGATTCACAGGGAGCAGGG - Intergenic
950494241 3:13324235-13324257 CTGAGGGTGGACAGGGAGGAAGG - Intronic
950634325 3:14304244-14304266 TTGCAGAGTCACAGGGAGGACGG - Intergenic
951784699 3:26404557-26404579 GTGAAGAGAGAAAGGAAGGAAGG + Intergenic
952650900 3:35725583-35725605 GGGAACATTCCCAGGGAGGAAGG - Intronic
953207052 3:40840416-40840438 GTGAAGATTTGAAGGAAGGAGGG + Intergenic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
954086801 3:48251095-48251117 ATTAAGATTCACAGGGAGAATGG - Intronic
954710119 3:52501435-52501457 GTGGAGATAGGCGGGGAGGAAGG + Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955364766 3:58301446-58301468 ATGAATATTGCCAGGGAAGAAGG + Intergenic
955490185 3:59474053-59474075 GTGAATATTGAGAGGCAGAAAGG - Intergenic
955820873 3:62894328-62894350 ATGGATATTGACAGGGAAGAAGG + Intergenic
956161783 3:66362512-66362534 GTGAGGAAGGACAGGAAGGAGGG + Intronic
956368195 3:68529235-68529257 GTGAAGAAGGGCAGGGTGGAGGG - Intronic
957593778 3:82233913-82233935 GAAAAGAGTGATAGGGAGGAAGG + Intergenic
957863690 3:85994307-85994329 GTGAAGATTGAAAGACATGAAGG - Intronic
959421681 3:106136134-106136156 GTGAATACTGTCAGGGAGGCAGG + Intergenic
959594046 3:108109444-108109466 GTGAGGGATGACAGGGAGGAGGG - Intergenic
959622542 3:108413775-108413797 GTGAAGATGGACAGGGAAGCTGG - Intronic
960163763 3:114378801-114378823 CTGAAGATTGCCAGGCAAGAAGG + Intronic
960939571 3:122924644-122924666 GAGAAGAAAGACAGGAAGGAGGG - Intronic
961378469 3:126482294-126482316 GTGAGGATCGCCAGGGAGGAAGG + Exonic
961739680 3:129025313-129025335 GCGAAGAGTGCCAGGGAGGCAGG + Intronic
962128274 3:132645792-132645814 GATATGATTGCCAGGGAGGATGG - Intronic
962327770 3:134450062-134450084 GTGAAGATTGAAAGGGAAGAAGG - Intergenic
962844698 3:139263997-139264019 GGGAAGAGTGACAGGGTGAATGG + Intronic
964193253 3:154031125-154031147 TAGAAGTTAGACAGGGAGGAGGG - Intergenic
964612543 3:158629865-158629887 GAGAAGATAGAAAGGGAGGGAGG + Intergenic
965186439 3:165471367-165471389 GTGAAAATTCTGAGGGAGGAAGG + Intergenic
965534853 3:169813179-169813201 ATGAGAATTGCCAGGGAGGAAGG + Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
968930943 4:3578434-3578456 GTGATGAAAGAAAGGGAGGACGG - Intronic
969248922 4:5954507-5954529 GAAAAGATGGACTGGGAGGATGG + Intronic
970874940 4:20858285-20858307 GTGAAGATGGAGTGGGAAGATGG + Intronic
971174024 4:24263589-24263611 GTGGAGATGGACAAGGTGGAAGG - Intergenic
971718401 4:30211647-30211669 GTGAACATTTACACAGAGGAAGG + Intergenic
972234854 4:37120061-37120083 GTGAAAATGGAGAGTGAGGATGG - Intergenic
972681156 4:41308232-41308254 ATGAAGATTGGCAGGTAGGTAGG + Intergenic
973262699 4:48180862-48180884 GTGAGTGTTGACAGGGAGGCTGG + Intronic
973594581 4:52473635-52473657 ATGATGATGGACAGGGAGAATGG + Intergenic
974877139 4:67714598-67714620 GTGAAGAGTGACAGGCATGGTGG - Intergenic
974963679 4:68734665-68734687 ATGAAGAAAGACAGGAAGGAAGG - Intergenic
975345259 4:73286027-73286049 GTGTAGACTGACAGGTAGAAAGG - Intergenic
975818718 4:78247522-78247544 GTGAAGAAAGAAAGAGAGGAAGG - Intronic
975885151 4:78956506-78956528 ATCAAGATTGACAGTGAGGTAGG - Intergenic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
978234474 4:106442129-106442151 GTTAAAATTCACAGGGAAGACGG + Intergenic
978376698 4:108081598-108081620 GTGTCGACTGACAGTGAGGATGG + Exonic
979819216 4:125150461-125150483 CTGAAGGTTGACAGGGAGAATGG - Intergenic
979919710 4:126480851-126480873 GAGAAGCTGAACAGGGAGGACGG - Intergenic
980220428 4:129906332-129906354 ATGAAGAATGACAGGGAAGAAGG + Intergenic
980725199 4:136749656-136749678 GTGAATATTGCCAAGGAAGAAGG + Intergenic
981601263 4:146491638-146491660 GTGAAGAAAGAAAGGAAGGAGGG + Intronic
981932495 4:150206015-150206037 GTGAAGATGGACTAGGAAGACGG - Intronic
982346697 4:154367870-154367892 ATGAAGATTGTATGGGAGGAAGG + Intronic
982699169 4:158639919-158639941 GTGAAGACAGACAGAGAAGATGG + Intronic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984268105 4:177518282-177518304 GGGGAGATTGACAGGCAGAATGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984842101 4:184078314-184078336 GTGAAACTTGTCAGGGAGCATGG + Intergenic
985085442 4:186308279-186308301 GTGAAATGTGACAGGGATGAGGG + Intergenic
985829507 5:2217735-2217757 GTGAAGGTTGAAAGAGAAGACGG - Intergenic
986112154 5:4730279-4730301 GAGAAGATTGAGAGGCAGCATGG + Intergenic
986501133 5:8401041-8401063 GTGAAGATGGATGGTGAGGAGGG + Intergenic
986631861 5:9781836-9781858 GTGAGGATAGGCAGGGATGATGG - Intergenic
987187043 5:15432716-15432738 GAGAAGAGTGCCAGAGAGGAGGG + Intergenic
987372227 5:17203795-17203817 ATGAAGAATGATAGGGAAGAGGG - Intronic
987830240 5:23086216-23086238 GTGCATATTCACAGGGATGAAGG - Intergenic
987910430 5:24136864-24136886 CTCAAGATTGAGAGGCAGGAAGG + Intronic
988566240 5:32321732-32321754 GTGAGTATTGCCAGGGAAGAAGG + Intergenic
988617346 5:32787788-32787810 GAGAAGATAGACAGTGAGGGAGG + Exonic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990387674 5:55283203-55283225 GTGAAAATGGACCTGGAGGAAGG - Exonic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
992089490 5:73304316-73304338 GGGAAGATGGAGGGGGAGGAAGG + Intergenic
992626218 5:78637938-78637960 GTGAACAGTGTGAGGGAGGAAGG - Intronic
993239965 5:85369331-85369353 GTGAAGAGAGAAGGGGAGGATGG + Intergenic
993768448 5:91893182-91893204 TTGAAGATTGAGAGAGGGGAAGG + Intergenic
994791518 5:104232600-104232622 ATGAGTATTGCCAGGGAGGAAGG + Intergenic
995629261 5:114115699-114115721 GGTAAGATTGAAAGGGAAGAAGG + Intergenic
996522279 5:124440476-124440498 GTGAAGATTTATAGTGAGGTGGG + Intergenic
996763834 5:127015361-127015383 GGGAAGATGAGCAGGGAGGAGGG + Intronic
997422609 5:133781067-133781089 GTGAAGAGTCAGAGGAAGGAGGG - Intergenic
997452019 5:133991377-133991399 CTGAAGAGTTACAGGGAGGAAGG - Intronic
998693528 5:144613784-144613806 GTGAAGAGAGACTGGGATGAAGG + Intergenic
998755901 5:145379339-145379361 GTGAATACTGACAGGGAGTCAGG - Intergenic
1000147455 5:158467328-158467350 GTCAATATTGATGGGGAGGAGGG - Intergenic
1000688942 5:164290291-164290313 GCAAAGTTGGACAGGGAGGATGG - Intergenic
1000755824 5:165158375-165158397 TTGAAGATTTACAGGTAAGAAGG + Intergenic
1002052589 5:176579720-176579742 GTGGAGACTGGCTGGGAGGAAGG + Intronic
1002256075 5:177959315-177959337 GTGGAGGTTGACATGGAGAAAGG + Intergenic
1002508690 5:179698766-179698788 GTGAAGATTGGCCGGGAGTGAGG - Intronic
1002804773 6:562093-562115 GTGAAGGGTCACAGGGAAGAAGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004279660 6:14270059-14270081 GGAAAGATTGAAAGGAAGGAAGG + Intergenic
1004521883 6:16369090-16369112 GTGAAGATTGGGAGGGGGCACGG - Intronic
1005035150 6:21549147-21549169 ATGAATTTTGCCAGGGAGGAGGG + Intergenic
1005275226 6:24210075-24210097 GTGAAGACAGACAGGCAGGCAGG - Intronic
1006370646 6:33641705-33641727 GTGAGGAATGGCAGGGAGGCTGG - Intronic
1006790839 6:36700110-36700132 GTGAAGCTGGAAAGGGAGGTGGG + Intronic
1006798880 6:36747008-36747030 CTGGCGAGTGACAGGGAGGAGGG - Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007090163 6:39179229-39179251 GGGAAGATTGACAGAGACAAAGG - Intergenic
1011929175 6:92688732-92688754 ATGAATATTGACAGGGAAGAAGG - Intergenic
1013061633 6:106639691-106639713 GTGTATATTGACAGGAAGTAGGG - Intronic
1013291337 6:108721283-108721305 AAGATGATTGAGAGGGAGGATGG - Intergenic
1014949309 6:127536724-127536746 GAGAAGACAGACAGGGAGGGGGG + Intronic
1015835756 6:137418499-137418521 GATAAGATTGAAAGGGAGGCAGG - Intergenic
1016714551 6:147209782-147209804 ATTCAGAATGACAGGGAGGAAGG + Intronic
1017746577 6:157452128-157452150 GTCAAGTTTGACTGGAAGGAGGG - Intronic
1018394715 6:163369497-163369519 GAGAAGATTGACATGGAGACAGG - Intergenic
1019042706 6:169119805-169119827 GAGAAGCTGGATAGGGAGGATGG - Intergenic
1019196627 6:170286973-170286995 GTGAAGAGAGGCAGGGAGGAAGG + Intronic
1021562897 7:21986562-21986584 GTGAGAATTACCAGGGAGGAAGG - Intergenic
1022297202 7:29067301-29067323 GCAGAGAGTGACAGGGAGGAAGG + Intronic
1023052690 7:36267123-36267145 GAGTAGCTTGACTGGGAGGATGG - Intronic
1024395709 7:48864375-48864397 GTGAAGATTGACTGGGGAAAAGG - Intergenic
1024399524 7:48907901-48907923 GTGAAGATTGACTGGGGAAAAGG + Intergenic
1024559462 7:50631104-50631126 GCTAAGATTGACAGCAAGGAGGG - Intronic
1024632511 7:51261599-51261621 GTGATGCCTGACAGGGAGGATGG + Intronic
1026296907 7:69060723-69060745 GTGACTATTTACAGGGAGGTGGG - Intergenic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1027736711 7:81941787-81941809 GTGACGATTCAGAGGCAGGATGG - Intergenic
1028918116 7:96282091-96282113 CTGAAAATTGCAAGGGAGGAAGG - Intronic
1028994618 7:97086116-97086138 GTGGAGAATGACAGGGAGTAGGG + Intergenic
1029110386 7:98210912-98210934 GTGGAAATTGAGGGGGAGGATGG + Intergenic
1029139532 7:98400537-98400559 GGGAAGAAGCACAGGGAGGAGGG + Intronic
1029267003 7:99350276-99350298 GTCAAGAAAGACAGGGAGAAAGG - Intronic
1029792374 7:102858276-102858298 GGGAAGAGTGGCAGGGAGGGAGG + Intronic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030574432 7:111268269-111268291 GTGAAGTCTCACAGGGTGGAAGG + Intronic
1030798159 7:113815630-113815652 GAGAAGATTGAAAGGGAGAGGGG - Intergenic
1031091157 7:117356482-117356504 GGGATGATGGACAGGGAGTAAGG + Intergenic
1031247688 7:119337675-119337697 GTGAGGAGGGAGAGGGAGGAGGG - Intergenic
1031822892 7:126526822-126526844 GTGAAGATTCAGAGGAAGCATGG - Intronic
1032114347 7:129104069-129104091 GTGAAGTGTGACTGGGAGGATGG - Intergenic
1032443323 7:131959112-131959134 GTGATGATTGAGTGGGATGATGG - Intergenic
1032790892 7:135241672-135241694 GTGAAAATGTACAAGGAGGAGGG - Intronic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1033527211 7:142228138-142228160 GTGAAGCTTGACATGGAACATGG + Intergenic
1034317834 7:150150164-150150186 ATGAGTATTGCCAGGGAGGAAGG - Intergenic
1034774918 7:153817088-153817110 ATGAGTATTGCCAGGGAGGAAGG + Intergenic
1034973678 7:155435807-155435829 GTTAAGGTGGACAGGGAGGGAGG - Intergenic
1035574400 8:695775-695797 GTGCAGGTTGATGGGGAGGAAGG - Intronic
1035888223 8:3316469-3316491 GTGAAGGTTGAGAGGGACAAAGG + Intronic
1036194499 8:6702016-6702038 GTGAAGAGTTGCAGGGAGAAGGG - Intergenic
1036372278 8:8171838-8171860 GCGAAGAGTGACTGGGATGAAGG - Intergenic
1036621013 8:10424585-10424607 GTGGAGAGGGACAGGGAGAAGGG + Intronic
1036754871 8:11465432-11465454 TTGAAGACTGATGGGGAGGATGG + Intronic
1036878624 8:12493803-12493825 GCGAAGAGTGACTGGGATGAAGG + Intergenic
1038333079 8:26624838-26624860 GGGAAGATTCACAGAGAGGCAGG + Intronic
1038336828 8:26652323-26652345 GGGAAGATTGTCCTGGAGGACGG + Exonic
1038648570 8:29381773-29381795 GAGAAGATTGAGAGACAGGAGGG + Intergenic
1039146419 8:34451885-34451907 GTAAAAATTGAGAGGGTGGAAGG - Intergenic
1039412691 8:37368535-37368557 AGGAAGAATGAGAGGGAGGAAGG + Intergenic
1039833201 8:41234137-41234159 GGAAAGATTGGCATGGAGGAAGG - Intergenic
1039957932 8:42221547-42221569 ATGAAGCTAGACAGGGAGGCGGG + Intergenic
1040008242 8:42639111-42639133 GCCAAAACTGACAGGGAGGATGG - Intergenic
1040452577 8:47562817-47562839 GTGAAGTTTGGCGGGGATGAAGG - Intronic
1041018611 8:53615973-53615995 GGGAACTTTCACAGGGAGGAGGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042187259 8:66149122-66149144 GTGTAAGTTGACTGGGAGGAGGG + Intronic
1042407715 8:68424112-68424134 GTGAACATGGGCAGGGGGGAGGG - Intronic
1043516775 8:81001918-81001940 GTTAAGATTGCCAGGGAGATGGG - Intronic
1044781742 8:95750529-95750551 TTGAACATTAACAGGAAGGATGG - Intergenic
1044929914 8:97242059-97242081 GTGAAGGGGCACAGGGAGGAAGG - Intergenic
1045081825 8:98634141-98634163 GTGGAGCTGGACAGGAAGGAGGG + Intronic
1045376559 8:101580451-101580473 GGGAAGAGTGACGGGGAGGGAGG - Intronic
1047211093 8:122841156-122841178 GGGAAGACAGGCAGGGAGGAAGG - Intronic
1047215250 8:122870865-122870887 GTGAAGATAGAAAGTGAGAAAGG + Intronic
1047405991 8:124586321-124586343 GTGCAGATAGGCAGGGAAGATGG - Intronic
1047669550 8:127129818-127129840 TTCAAGAGTGAAAGGGAGGATGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048456623 8:134584289-134584311 GGGAACATTGATAGGGAGGCAGG - Intronic
1049088240 8:140494321-140494343 GTGCAGAGTGACTGGGAGGAGGG - Intergenic
1049115815 8:140686648-140686670 GGCAGTATTGACAGGGAGGATGG - Exonic
1049356699 8:142192719-142192741 GAGAAGAGTGAGAGGGAGGGAGG + Intergenic
1049683731 8:143930970-143930992 GTGGGGAGTGACAGGGAAGAGGG - Intronic
1050106006 9:2167582-2167604 CTGAAGAGTGTCAGGGAGGCAGG - Intronic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050390152 9:5134224-5134246 CTGAAAGTTGACAGGGAGAATGG + Intronic
1052029371 9:23610968-23610990 TTGAAGAATGAAAGGAAGGAAGG + Intergenic
1052143343 9:25017038-25017060 GTGAAGAATGCCAAGGAGTAAGG + Intergenic
1054459182 9:65453512-65453534 GTGATGAAAGAAAGGGAGGACGG + Intergenic
1054888660 9:70228323-70228345 GTGTAAATTGACATTGAGGATGG - Intergenic
1055194350 9:73569334-73569356 GGGAAAAAAGACAGGGAGGAAGG + Intergenic
1055722077 9:79186294-79186316 GTGAAGATTGAAACAGAGGTGGG - Intergenic
1056479601 9:86987834-86987856 GTGGAGCTTGAAAAGGAGGAAGG + Intergenic
1056946897 9:91005293-91005315 GTGAAGAGTGGAAGGGAGGAAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057226602 9:93296294-93296316 GGGAAGATGGAGGGGGAGGAAGG - Intronic
1057226742 9:93296706-93296728 GGGAGGATAGAGAGGGAGGAAGG - Intronic
1059735898 9:117099359-117099381 GTGGAGATTGGAAGGAAGGAAGG - Intronic
1059757917 9:117311020-117311042 GGGAAGAGAGACAGGCAGGAAGG - Intronic
1060133809 9:121132239-121132261 CTGAAAAGTGACAGGGAGAATGG - Intronic
1060236002 9:121863040-121863062 GGGAAGAAAGAAAGGGAGGAGGG - Intronic
1060621098 9:125067431-125067453 GTGAAGACAGACAGGAAGGAAGG + Intronic
1062410907 9:136423840-136423862 CGGACGACTGACAGGGAGGAAGG - Intergenic
1203466659 Un_GL000220v1:94589-94611 GGGAAGACTGAAAGTGAGGAGGG - Intergenic
1186143038 X:6597157-6597179 ATGGAAATTAACAGGGAGGATGG + Intergenic
1186328688 X:8509104-8509126 GTGAAGATGGTCATGCAGGAAGG - Intergenic
1186779639 X:12899810-12899832 GTGAAGAGGGAAGGGGAGGAAGG + Intergenic
1187684323 X:21801130-21801152 GAGAAGACTGACAGGGAGACTGG - Intergenic
1188160270 X:26791739-26791761 GTGAAGACAGATAGGGAAGAGGG - Intergenic
1188557588 X:31429736-31429758 GACATGATTCACAGGGAGGAGGG + Intronic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1189877205 X:45448485-45448507 GTGAAGATTGACAGAGATAGAGG + Intergenic
1193894252 X:87092373-87092395 GTGAAGATTGAGAGAGGGCAAGG - Intergenic
1194248104 X:91539059-91539081 GTGAACACTCACAGGGAGGCAGG + Intergenic
1194257900 X:91656867-91656889 GTGTAGAGTGAGAGGAAGGAGGG - Intergenic
1194771960 X:97916780-97916802 CTGAATAATGACAGGGAGAATGG + Intergenic
1195112609 X:101662727-101662749 GAGAAGAGTGACAGGGAGACTGG - Intergenic
1195468205 X:105204388-105204410 TTGATCATTGACAGGAAGGAAGG - Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195922175 X:109994718-109994740 GTAGGGATTGACAGGGAGGTGGG + Intergenic
1196051873 X:111314233-111314255 TGAAAGAATGACAGGGAGGAGGG - Intronic
1198035487 X:132797452-132797474 CTGAAACTTGACAGGGAGAATGG + Intronic
1198681422 X:139186749-139186771 GAGAAGAATGGCAGGAAGGAAGG - Intronic
1199142923 X:144333448-144333470 CTGAAGCTGGACAGGGAGGTTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199257573 X:145734081-145734103 GTGAAGAGCAACAGGAAGGATGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1200567118 Y:4780588-4780610 GTGAACACTCACAGGGAGGCAGG + Intergenic
1201312668 Y:12611119-12611141 GGGAAATTTCACAGGGAGGAGGG - Intergenic
1201433604 Y:13931664-13931686 GTGAAGATGGTCATGCAGGAAGG + Intergenic