ID: 1145911735

View in Genome Browser
Species Human (GRCh38)
Location 17:28547156-28547178
Sequence CTTCCTCCCAACATTGACTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145911724_1145911735 30 Left 1145911724 17:28547103-28547125 CCATGTAGCAGGCCGCATGGGCT 0: 1
1: 0
2: 1
3: 2
4: 90
Right 1145911735 17:28547156-28547178 CTTCCTCCCAACATTGACTCAGG 0: 1
1: 0
2: 0
3: 21
4: 286
1145911727_1145911735 18 Left 1145911727 17:28547115-28547137 CCGCATGGGCTTCATGGGCTTGA 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1145911735 17:28547156-28547178 CTTCCTCCCAACATTGACTCAGG 0: 1
1: 0
2: 0
3: 21
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145911735 Original CRISPR CTTCCTCCCAACATTGACTC AGG Exonic
900139208 1:1132430-1132452 CTTCCTCCACACATGGGCTCAGG - Intergenic
902948920 1:19865656-19865678 TTTCCTCCATACAGTGACTCAGG + Intergenic
903852678 1:26317732-26317754 CTTACTCCCACCGTTGCCTCTGG + Intronic
904301107 1:29555462-29555484 GTCCCTCCCAGCACTGACTCCGG - Intergenic
905773025 1:40650341-40650363 GCTCCTCCCAAAACTGACTCAGG - Intronic
908668873 1:66523497-66523519 CTTCCTCCCAACATTTTCCAAGG + Intergenic
909256283 1:73426810-73426832 CTTCCTCCCCTCATTGGCCCTGG - Intergenic
909370308 1:74876512-74876534 CAACCTCCCAAGATTGAATCAGG + Intergenic
909420053 1:75453827-75453849 CATTCTCCCAAGATTGAATCAGG + Intronic
909882769 1:80900988-80901010 CATCCTCCCAAGACTGAATCAGG + Intergenic
910390209 1:86734740-86734762 TTTCCTCCCAAAATTGCCTTAGG - Intronic
911036263 1:93552200-93552222 CTTCCCCACACCACTGACTCAGG - Intronic
911119152 1:94277760-94277782 CTTCCTCCCATCACTGTGTCAGG - Intergenic
913317954 1:117568137-117568159 CTGCCACCCAACCATGACTCGGG - Intergenic
916170766 1:162000065-162000087 CTTCCTCCCTACCCTGCCTCTGG + Intronic
917648114 1:177048557-177048579 CCTCCTCCCTAAAATGACTCAGG - Intronic
917700454 1:177575379-177575401 CTTCCTACCAGAATTCACTCTGG - Intergenic
920731772 1:208493516-208493538 CAACATCCCAAGATTGACTCAGG - Intergenic
921675514 1:217971277-217971299 CAACCTCCCAACATTGAGCCAGG - Intergenic
922030149 1:221789886-221789908 CCTCCTCCCCACATTTCCTCTGG - Intergenic
922234648 1:223713421-223713443 CCTCCTCATAACATTGACACTGG + Intronic
923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG + Intronic
924919682 1:248615010-248615032 CAACCTCTCAACATTGAATCAGG + Intergenic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1063324398 10:5083021-5083043 CAACCTCCCAACATTGAATCAGG - Intronic
1063406098 10:5796807-5796829 CTTCCTCTCCCCATTGACTCGGG + Exonic
1064248149 10:13685982-13686004 CTCCCTCTCAATTTTGACTCAGG + Intronic
1066972722 10:42328762-42328784 CAACCTCCCAAGATTGAATCAGG - Intergenic
1067790991 10:49287704-49287726 CTTCCTCCCAACACTGCTTGTGG - Intergenic
1068053280 10:51979706-51979728 CATCCTCCCAAGACTGAGTCAGG - Intronic
1068416339 10:56727840-56727862 CATCCTCCCAAGATTGAACCAGG - Intergenic
1068493645 10:57756860-57756882 CAACCTCCCAAGATTGAATCAGG + Intergenic
1068610165 10:59050744-59050766 CAACCTCCCAAGATTGAATCAGG - Intergenic
1070809582 10:79290900-79290922 CTTCCTCTCCACACTGCCTCGGG + Intronic
1071022826 10:81079185-81079207 CAACCTCCCAAAATTGAATCAGG - Intergenic
1075031694 10:119028883-119028905 CTTCCTCCCAACAGGTGCTCAGG - Intergenic
1077364409 11:2155748-2155770 CTTCCTCCCACTATTGTTTCTGG - Intronic
1077695312 11:4387864-4387886 CTTCTGCCCAACATTGAACCAGG - Intronic
1078487662 11:11739067-11739089 CTTACTCCCAACATTGTATTTGG - Intergenic
1079255997 11:18830628-18830650 CAACCTCCCAAGATTGAATCAGG - Intergenic
1080216919 11:29854250-29854272 CAACCTCCCAATATTGAATCAGG + Intergenic
1082650156 11:55780773-55780795 CAACCTCCCAAGATTGAATCAGG + Intergenic
1083866335 11:65455520-65455542 CTTCCACCCCACACTGACCCAGG - Intergenic
1084507017 11:69574726-69574748 CTCCCTCCCACCATCCACTCAGG + Intergenic
1085168581 11:74427549-74427571 GTTCCCGCCCACATTGACTCTGG + Intergenic
1085321654 11:75577910-75577932 CCTCCTCCCAGACTTGACTCAGG - Intergenic
1087583377 11:100088665-100088687 CATTCTCCCAAGATTGAATCAGG + Intronic
1088388642 11:109289376-109289398 CTACCTACCAAAATTGAATCAGG + Intergenic
1089136090 11:116250504-116250526 CATCCTCCCAACATGGGCTTGGG + Intergenic
1089874872 11:121711511-121711533 CTTACTCATAACATTCACTCAGG - Intergenic
1092276893 12:7068277-7068299 CTTCCTCCAAACAATCCCTCAGG - Intronic
1092393894 12:8107591-8107613 CAACCTCCCAAGATTGACCCAGG - Intergenic
1092394516 12:8113913-8113935 CTTCCTTCCATCATTGGATCAGG + Intergenic
1092672855 12:10882905-10882927 TTTTCTCCCAACCTTGATTCTGG - Intronic
1092676856 12:10930433-10930455 TTTTCTCCCAACCTTGATTCTGG + Intronic
1093600187 12:21012392-21012414 CAACCTCCCAACATTGAACCAGG - Intergenic
1094268631 12:28586992-28587014 CTTCCTCTAAATATTGGCTCTGG + Intergenic
1095486140 12:42686608-42686630 CTTCCTGCCCACATTCATTCTGG - Intergenic
1097218774 12:57434588-57434610 CTGTCTCCCAACATTGGCCCAGG + Intergenic
1098504808 12:71237270-71237292 CTTCCTCCCTTCATTCATTCAGG - Intronic
1099372118 12:81847547-81847569 CTAACTCCCAAATTTGACTCAGG - Intergenic
1100174923 12:92018653-92018675 CAACCTCCCAAGATTGAATCAGG - Intronic
1100364065 12:93903220-93903242 TTTCCTCCATGCATTGACTCGGG + Intergenic
1100932225 12:99622675-99622697 CAACCTCCCAAAATTGAATCAGG + Intronic
1101507241 12:105358879-105358901 CTTCCTTCTAAGATTGGCTCTGG + Intronic
1104284364 12:127411268-127411290 CTTCCTCCAAAGTGTGACTCAGG - Intergenic
1105228365 13:18460824-18460846 CAACCTCCCAAGATTGAATCAGG - Intergenic
1105692477 13:22855853-22855875 ATCCCTACCCACATTGACTCTGG + Intergenic
1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1106215778 13:27697651-27697673 CAACCTCCCAATATTGAATCAGG - Intergenic
1107091939 13:36490959-36490981 CTTCCTAAAAACATTGACTGTGG + Intergenic
1107157668 13:37188584-37188606 CATCCTCCCAAGATTGAACCAGG + Intergenic
1107159533 13:37209902-37209924 CTTCTTCCCAACATGGGCTCTGG - Intergenic
1107296982 13:38919753-38919775 CAACCTCCCAAGATTGAATCAGG - Intergenic
1109078619 13:57869057-57869079 CAACCTCCCAAGATTGAATCAGG + Intergenic
1109356527 13:61236275-61236297 CAACCTCCCAAGATTGAATCAGG + Intergenic
1110365071 13:74673655-74673677 GTCCCTCCCCACATTGAATCAGG - Intergenic
1110600580 13:77367995-77368017 CAACCTCCCATCATTGAATCTGG + Intergenic
1111791048 13:92855779-92855801 CCACCTCCCAAGATTGAATCAGG + Intronic
1114012651 14:18387688-18387710 CAACCTCCCAAGATTGAATCAGG - Intergenic
1114126070 14:19727331-19727353 CAACCTCCCAAGATTGAATCTGG - Intronic
1114359499 14:21955743-21955765 CAACCTCCCAAGATTGACTCAGG - Intergenic
1117080685 14:52149189-52149211 CAACCTCCCAAGATTGAATCAGG - Intergenic
1117772902 14:59152359-59152381 CTTCCTCCCAGCATTGCTGCAGG + Intergenic
1119258669 14:73222896-73222918 CTGCCTTCCAACATTGAATTTGG + Exonic
1120221818 14:81742922-81742944 ATTCCTCCCATCTTTGTCTCAGG + Intergenic
1121846363 14:97175738-97175760 CTTCCTCCATACAGTGATTCAGG + Intergenic
1123569301 15:21586636-21586658 CAACCTCCCAAGATTGAATCTGG - Intergenic
1123605411 15:22021957-22021979 CAACCTCCCAAGATTGAATCTGG - Intergenic
1124197241 15:27642534-27642556 CTTCCTCCCAAGACTGAACCAGG + Intergenic
1124439568 15:29676156-29676178 CTTCCTCCAAACCTCAACTCCGG - Intergenic
1124652105 15:31482047-31482069 CTTCCTTCCAAGATTACCTCCGG - Exonic
1127257140 15:57301930-57301952 CTTCCTCCAGCCATTGACCCTGG + Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1130767448 15:86885736-86885758 CTACCACCTACCATTGACTCTGG - Intronic
1131487539 15:92834089-92834111 CTTCCTCACAACATGGTCCCTGG - Intergenic
1132245097 15:100289270-100289292 CATTCTCCCAAAATTGAATCAGG + Intronic
1202977655 15_KI270727v1_random:313729-313751 CAACCTCCCAAGATTGAATCTGG - Intergenic
1134562583 16:15223414-15223436 CAGCCTCCCAACCTTCACTCAGG + Intergenic
1134923123 16:18135041-18135063 CAGCCTCCCAACCTTCACTCAGG + Intergenic
1137263791 16:46852299-46852321 CTTCCTCCAATCACTGACCCTGG + Intergenic
1138536861 16:57664744-57664766 CCTCCTGCCAACATTCAGTCTGG + Exonic
1138801630 16:60038232-60038254 CAACCTCCCAATATTGATTCAGG + Intergenic
1139490005 16:67280868-67280890 CTTCCTCCCCACAGGGACTCGGG + Exonic
1139877379 16:70157071-70157093 CCTCCTCCTAATATTCACTCTGG + Exonic
1140018148 16:71208823-71208845 CATCCTCCCAAGACTGAATCAGG + Intronic
1140792838 16:78408773-78408795 CTACCTCCCAAAGGTGACTCAGG - Intronic
1145911735 17:28547156-28547178 CTTCCTCCCAACATTGACTCAGG + Exonic
1147472305 17:40674447-40674469 CTTTCTCTCAACGTTGGCTCTGG + Intergenic
1149940726 17:60862524-60862546 CAACCTCCCAAAATTGAATCAGG - Intronic
1151456985 17:74232303-74232325 CCTCCTCCCACAATTGACTTGGG - Intronic
1154525086 18:15279476-15279498 CAACCTCCCAAGATTGAATCAGG + Intergenic
1155362955 18:25020218-25020240 CCTCCTCCCAACCTTCACTTTGG - Intergenic
1156425042 18:37001300-37001322 CATCCTACCAAGATTGAATCAGG + Intronic
1157201694 18:45664898-45664920 ATTCCTCCTAACATCGTCTCAGG + Intronic
1157398483 18:47365126-47365148 CTTCCTACCAAGATTGAATCAGG - Intergenic
1159365464 18:67460751-67460773 CAACCTCCCAAGATTGAATCAGG - Intergenic
1159995520 18:74960646-74960668 CCTCCACCCAGCACTGACTCAGG - Intronic
1159995528 18:74960682-74960704 CCTCCACCCAGCACTGACTCAGG - Intronic
1159995559 18:74960826-74960848 CCTCCACCCAGCACTGACTCAGG - Intronic
1159995566 18:74960862-74960884 CCTCCACCCAGCACTGACTCAGG - Intronic
1160250180 18:77196509-77196531 CATCCTCCCAAGATTGAATCAGG - Intergenic
1161835877 19:6645881-6645903 CTCCCTCCCAACTTTGATGCTGG + Intergenic
1162125599 19:8498205-8498227 CTTCCTCCCCACACTCACTGCGG + Exonic
1162128342 19:8511232-8511254 CTTCTCCCCAACAGTGAATCTGG - Intronic
1163142646 19:15360819-15360841 CTTCCTCCCCACACTGCCTGGGG - Intronic
1202654948 1_KI270708v1_random:12092-12114 CTTGTTCCCAACAGTGCCTCAGG - Intergenic
925818235 2:7774181-7774203 ATTCCTCTCAACATAGAGTCTGG - Intergenic
926745751 2:16155934-16155956 CTTCCTGCCAACATCCTCTCGGG - Intergenic
927295134 2:21445069-21445091 TTTCCTCCCAAAATTAACTTTGG + Intergenic
927473198 2:23391686-23391708 CTGCCTCCCAAAGTTCACTCTGG + Intronic
927790472 2:26005573-26005595 CTTCCACCCCACCTTCACTCTGG + Intergenic
927944479 2:27127198-27127220 CTTCTTCCTAAGACTGACTCTGG - Intronic
930493269 2:52105001-52105023 CAACCTCCCAAGATTGAATCTGG + Intergenic
930529952 2:52576728-52576750 CAGCCTCCCAAGATTGAATCAGG - Intergenic
931537540 2:63295688-63295710 CGTCCTCCCAAGATTGAGCCAGG + Intronic
932003796 2:67907926-67907948 CTTCCTCCCTGCATTGTGTCTGG + Intergenic
932296727 2:70630437-70630459 CTTCCTAGCACCATTGAGTCTGG - Intronic
934847996 2:97675078-97675100 CTTCCTCTCAGCATTGGCACTGG - Intergenic
935315712 2:101831708-101831730 CTTCCTCCCACAGTTGACTTTGG + Exonic
936348145 2:111690822-111690844 CTTTCTCTTAACATTGACCCCGG - Intergenic
936604971 2:113942644-113942666 CTTCCCTCCATCATGGACTCAGG + Intronic
936907457 2:117553611-117553633 CATCCTCCCAACATGGACCCAGG - Intergenic
937080060 2:119134511-119134533 CTCCCTCCCAGCATAGACTCTGG + Intergenic
937465174 2:122126065-122126087 CAACCTCCCAAGATTGAATCAGG - Intergenic
938524283 2:132111603-132111625 CAACCTCCCAAGATTGAATCAGG + Intergenic
939179850 2:138791579-138791601 CACCCTCCCAAGACTGACTCAGG - Intergenic
939247262 2:139641849-139641871 CAACCTCCCAAGATTGAATCAGG - Intergenic
939552554 2:143633911-143633933 CTTACCCCCAACTCTGACTCAGG + Intronic
941001149 2:160205007-160205029 AGTCCTCCTAACATTGACTCTGG - Intronic
941684143 2:168430304-168430326 CTTTCTGCCGTCATTGACTCAGG - Intergenic
942212102 2:173681503-173681525 CTTCCTCACAACATGGTGTCTGG + Intergenic
944978901 2:205091460-205091482 TATCCTCCCCACATTCACTCAGG + Intronic
946026553 2:216675170-216675192 GTTCCTCCCCACATCGACTCTGG + Exonic
946996896 2:225403249-225403271 CTTCCTCACAGCATTGAGACAGG + Intronic
948532722 2:238622012-238622034 CAACCTCCCAAGATTGAATCAGG + Intergenic
948672296 2:239576259-239576281 CTTCCTCCCAACATGGCGGCCGG + Intergenic
1170108048 20:12773421-12773443 CTTCCTCCCAACCTTCTCTTTGG - Intergenic
1170137035 20:13086231-13086253 CTTTCTACAAACATTGATTCAGG - Intronic
1170702552 20:18716184-18716206 CTTCCTCCAAATATTGGTTCAGG + Intronic
1171936653 20:31280572-31280594 CACCCTCCCAAGATTGAATCAGG + Intergenic
1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1173294504 20:41744224-41744246 CAACTTCCCAAAATTGACTCAGG - Intergenic
1173419836 20:42891215-42891237 CTTCCTCCCAAAAATGATTGTGG - Intronic
1173980165 20:47217880-47217902 CTTCCCCCCACCATTTACTGGGG + Intronic
1175134154 20:56810327-56810349 CTTCCTCCCAACATGGTGGCTGG - Intergenic
1175788841 20:61728968-61728990 TTTCCTCCCTGCAGTGACTCAGG + Intronic
1176699031 21:10020713-10020735 CATTCTCCCAAGATTGAATCAGG + Intergenic
1176772345 21:13089006-13089028 CAACCTCCCAAGATTGAATCAGG - Intergenic
1177859073 21:26431413-26431435 CTTTCTCCCAACATATACACAGG + Intergenic
1180349655 22:11789930-11789952 CTTGTTCCCAACATTTCCTCAGG - Intergenic
1180437145 22:15318499-15318521 CAACCTCCCAAGATTGAATCAGG - Intergenic
1180519372 22:16182692-16182714 CAACCTCCCAAGATTGAATCAGG - Intergenic
1182049985 22:27305280-27305302 CTTCCCCCCAGCCCTGACTCCGG + Intergenic
1182880567 22:33729541-33729563 CTTCCTCCATCCAATGACTCTGG + Intronic
1182951495 22:34380477-34380499 GTTCCTTCCCACACTGACTCTGG + Intergenic
1184092783 22:42301121-42301143 CCTCCTCCCAGCCTTGCCTCTGG - Intronic
1185191246 22:49437948-49437970 CTTCCTCCCACCTTTCACTATGG + Intronic
1185244551 22:49766053-49766075 TTTCCTCCCAACCCTGCCTCAGG - Intergenic
951439352 3:22705545-22705567 CTGCATCCCAACAACGACTCAGG + Intergenic
952201383 3:31131883-31131905 CATCCTCCCAACAAAGGCTCAGG - Intergenic
952236854 3:31488783-31488805 CTTCCTCACTTCATTGACTTAGG - Intergenic
952400004 3:32954586-32954608 CTTCCTCCTGACACTGGCTCAGG - Exonic
952860549 3:37808802-37808824 CTTCCTCTCCATGTTGACTCAGG + Intronic
954493347 3:50929312-50929334 CTTCTTCCCCACAGTGACACTGG + Intronic
955224569 3:57050279-57050301 CTTCCTCCCAAGTTTGCCTCAGG + Intronic
955367211 3:58321236-58321258 CTTGCTCCCCACATTGATTTTGG - Intergenic
955607459 3:60720962-60720984 CTTCCTCCCAACAGTAGTTCAGG - Intronic
957013881 3:75040445-75040467 CAACCTCCCAAGATTGAATCAGG - Intergenic
957597913 3:82291305-82291327 CAACCTCCCAAGATTGAATCAGG - Intergenic
959865745 3:111268050-111268072 TTTCTTTCCCACATTGACTCTGG + Intronic
960012126 3:112845316-112845338 CAACCTCCCAAGATTGAATCAGG + Intronic
961243150 3:125429801-125429823 CTTCCTCACAACATGGAGGCTGG - Intergenic
962001417 3:131302070-131302092 CAACCTCCCAACATTGAACCAGG - Intronic
962850609 3:139305964-139305986 CTTCCTCCCAGCATGGCATCTGG - Intronic
964413936 3:156427982-156428004 TTACCTTCCAACATTCACTCTGG + Intronic
964536004 3:157722303-157722325 CAACCTCCCAAGATTGAATCAGG - Intergenic
964972716 3:162581033-162581055 CAACCTCCCAAGATTGAATCAGG + Intergenic
966398999 3:179529018-179529040 GTTCTTCCCAACATTTACTGTGG - Intergenic
966454622 3:180101298-180101320 CTTCCTGCCTACATGGACTCTGG + Intergenic
967160908 3:186737092-186737114 CTTCCTACCAGCAGTGACTGAGG + Intronic
967632809 3:191766251-191766273 CATCCTACCAAGATTGAATCTGG - Intergenic
969102286 4:4778203-4778225 CTTCCTCCAGGCAGTGACTCAGG + Intergenic
970266209 4:14289604-14289626 CTACCTCCCAAGATTGAATCAGG + Intergenic
976479155 4:85519358-85519380 CTCCTTCCCAACATTGATTTTGG + Intronic
977015586 4:91689080-91689102 CAATCTCCCAACATTGAATCAGG - Intergenic
977763817 4:100773781-100773803 CAACCTCCCAAGATTGAATCAGG - Intronic
979962715 4:127039963-127039985 CTATCTCCTAACATTGAATCAGG + Intergenic
980713140 4:136596442-136596464 CCTGCTCCCAAGACTGACTCAGG - Intergenic
982703758 4:158685578-158685600 CTTCCTCCCTATCTTTACTCTGG + Intronic
984877980 4:184386322-184386344 CTTCTTCCCAACACAGACTCAGG - Intergenic
986296632 5:6444724-6444746 CTTCCTCTCAACATGGTGTCTGG + Intergenic
987177681 5:15333160-15333182 CAACCTCCCAAGATTGAATCAGG + Intergenic
987976345 5:25019896-25019918 CTTCCACCCAGAATGGACTCTGG - Intergenic
988219905 5:28330912-28330934 CATCTTCCCAAGATTGAATCAGG - Intergenic
988977455 5:36529097-36529119 CTTCCTCCCAGCTCTGCCTCAGG + Intergenic
993628822 5:90258996-90259018 CTTCCTCCCAACGTTTCATCAGG + Intergenic
995304986 5:110635114-110635136 CAACCTACCAAGATTGACTCAGG + Intronic
996181847 5:120429119-120429141 CAACCTCCCAACATTGAACCAGG - Intergenic
996419706 5:123248962-123248984 CTTCATCCAAACATGGAATCAGG - Intergenic
997846331 5:137289473-137289495 CTTTCTCCCACCTTTGCCTCTGG - Intronic
998502466 5:142645402-142645424 CCACCTTCCAATATTGACTCAGG - Intronic
999191992 5:149755330-149755352 ATTCCTCCCACCTTTGCCTCTGG + Intronic
999567106 5:152876652-152876674 CAACCTCCCAAGATTGAATCAGG + Intergenic
1000289338 5:159855593-159855615 ATACATCCCAACTTTGACTCAGG - Intergenic
1000466955 5:161591100-161591122 CTACCTCCCAAAATTGAACCAGG - Intronic
1000873622 5:166607667-166607689 CAACCTCCCAAGATTGAATCAGG + Intergenic
1001454068 5:171847412-171847434 CTTTCTCCCAATAAGGACTCTGG + Intergenic
1001681252 5:173558541-173558563 CTTCCTCCCACCCCTGACTCAGG - Intergenic
1002208295 5:177579439-177579461 CATCCTCCCACCTTAGACTCTGG - Intergenic
1002412212 5:179090020-179090042 CTCTCTCCCCACATTAACTCTGG - Intergenic
1004004156 6:11623565-11623587 CTTCATCTCAAAATTGAGTCTGG - Intergenic
1004918343 6:20353303-20353325 CTTCCTCACAACATGGCCGCTGG - Intergenic
1005689391 6:28287624-28287646 CTTCTTCACAAAATGGACTCTGG + Intronic
1006497095 6:34431633-34431655 CCTGCTCCCAACAATGACTAAGG + Intergenic
1006523217 6:34583980-34584002 CTTCCTCCCAAGATCCAGTCTGG - Intergenic
1007354225 6:41299695-41299717 CAACCTCCCAACATTGAACCTGG + Intergenic
1009033100 6:58084103-58084125 CAACCTCCCAAGATTGAATCAGG + Intergenic
1009208715 6:60835874-60835896 CAACCTCCCAAGATTGAATCAGG + Intergenic
1009354513 6:62725332-62725354 CAACCTCCCAAAATTGAATCAGG - Intergenic
1010411336 6:75565727-75565749 CAACCTCCCAAGATTGAATCAGG + Intergenic
1010803176 6:80201739-80201761 CTACCTCCCAACTTTTTCTCTGG + Intronic
1011705928 6:90001596-90001618 CTCTCTTCCAACAGTGACTCAGG + Intronic
1011846120 6:91565142-91565164 CAACCTCCCAAGATTGAATCAGG + Intergenic
1012476124 6:99616281-99616303 CTTCCTCCCCATATACACTCTGG + Intergenic
1014491401 6:122065915-122065937 TTGCCTCCCAACATTCATTCAGG - Intergenic
1018095170 6:160379820-160379842 ATTTCTCCCATCATTGAATCTGG + Intronic
1018770531 6:166966942-166966964 CAACCTCCCAAGATTGAATCAGG - Intergenic
1023087158 7:36582518-36582540 ACTCTTCCCAACATTGGCTCAGG + Intronic
1023131367 7:37006359-37006381 CTTAATCCCCACAGTGACTCTGG + Intronic
1026598820 7:71756099-71756121 CTTTCTCCCCAGATTTACTCAGG + Intergenic
1029459556 7:100687132-100687154 CTTCCTCCCTCCACTGCCTCAGG - Intronic
1030976402 7:116129340-116129362 TTTCCTCCCTCAATTGACTCAGG + Intronic
1032787322 7:135211299-135211321 CTTCCCCCCAGCACTGCCTCCGG - Intronic
1033000201 7:137495221-137495243 CATCCTCCCAAGATTGAACCGGG + Intronic
1034385079 7:150734324-150734346 GGGCCTCCCAACATTGACTTGGG + Intronic
1034402527 7:150874111-150874133 CTCCCTCTCAACTTTGACTATGG - Intergenic
1034921329 7:155084754-155084776 TTTCCTCCCCAAATTCACTCTGG + Exonic
1036061928 8:5332303-5332325 CTTCCTCCCACCCTTGCCCCTGG - Intergenic
1036954672 8:13174472-13174494 ATTCCTACCAACATTGTCTAAGG + Intronic
1037098607 8:15016103-15016125 CTTGCTCCCAACATTAATCCAGG + Intronic
1037553903 8:20003919-20003941 GTTCCTACCCACACTGACTCTGG - Intergenic
1042578742 8:70252507-70252529 CTTCTTCCCATCCTTAACTCTGG + Intronic
1044172262 8:89069228-89069250 CAACCTCCCAAGATTGAATCTGG - Intergenic
1045486249 8:102633851-102633873 CTCCCTCCGAGCAGTGACTCGGG - Intergenic
1045725891 8:105173110-105173132 CTTCCTGCTGTCATTGACTCTGG - Intronic
1046945748 8:119972872-119972894 CTTCCTCCAAACAATGACCAGGG + Intronic
1047102312 8:121691292-121691314 CTACCTCCCAAGATTGAATCAGG + Intergenic
1048429007 8:134350963-134350985 CATCCTCCCAAGATTGAACCAGG - Intergenic
1048841751 8:138572755-138572777 CTTCCTCCTCACCTGGACTCAGG + Intergenic
1049808494 8:144552236-144552258 CTTCCTCCGAAAATAGGCTCTGG - Intronic
1049942684 9:563250-563272 CTTCCTGGCAACAGAGACTCTGG - Intronic
1050680161 9:8101653-8101675 CAACCTCCCAACATCGAATCAGG - Intergenic
1050821375 9:9884177-9884199 CATCCTTCAAACATTGACTATGG + Intronic
1051310332 9:15764119-15764141 CTTTCTCCCACTATTGACTCTGG - Intronic
1051331316 9:16027504-16027526 CTTCCTCGCAACTTTGATTTTGG - Intronic
1052357880 9:27524708-27524730 CTTCCTCCAAGCATTGGTTCAGG - Exonic
1053703023 9:40719209-40719231 CAACCTCCCAAGATTGAATCAGG + Intergenic
1054413083 9:64842674-64842696 CAACCTCCCAAGATTGAATCAGG + Intergenic
1055780514 9:79816148-79816170 CTTCCTCCCTAGATAGACTGTGG + Intergenic
1057229277 9:93309020-93309042 CTTCCGCCCCACATTGGCTCAGG - Intronic
1057405916 9:94770628-94770650 CTCTCTCCCATCATTTACTCTGG - Intronic
1057444565 9:95104553-95104575 CTTACTCCCAGCAATGTCTCTGG + Intronic
1057682346 9:97200747-97200769 CTGCCTCCCCACATTAACTTCGG + Intergenic
1057938322 9:99258977-99258999 CTTCCTCCCAGTTTTGATTCAGG + Intergenic
1059356136 9:113700989-113701011 CTTCCTCACAGCATGGTCTCTGG - Intergenic
1061970634 9:134043270-134043292 CTTCCTATCAAAATTGACTTTGG + Intronic
1061980628 9:134101533-134101555 CTTCATCCCAAATTTGACCCTGG + Intergenic
1062495162 9:136828130-136828152 CTTCCTCCCACCCTGGACTTGGG + Intronic
1185711451 X:2307021-2307043 ATGCCTCCCAAGATTGAATCAGG - Intronic
1188101234 X:26090537-26090559 CTGCCTCCCTAGAATGACTCAGG - Intergenic
1188928966 X:36081275-36081297 CATCCTCTCAAGATTGAATCAGG + Intronic
1190284722 X:48954563-48954585 CTTCCTCCCATCATTAATTCTGG - Intronic
1191132293 X:57027428-57027450 CGTCCTCCCAAGACTGAATCAGG - Intergenic
1191643739 X:63455948-63455970 CTACCTCCCAAGATTGAACCAGG + Intergenic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1192586245 X:72320183-72320205 ATTCCTCCCAGCATTTACTGAGG + Intergenic
1192702593 X:73491380-73491402 CATCCTCCCAACACTGAACCAGG - Intergenic
1193575368 X:83188728-83188750 CTACCTCCCAAAATTGAACCAGG - Intergenic
1194425810 X:93736503-93736525 CAACCTCCCAAAATTGAATCAGG - Intergenic
1194433644 X:93842679-93842701 CTGTCTCCCAAGATTGAATCAGG + Intergenic
1194689853 X:96970454-96970476 CAACCTCCCAAGATTGAATCGGG - Intronic
1194806961 X:98341559-98341581 CAACCTACCAACATTGAATCAGG - Intergenic
1195868495 X:109459620-109459642 TCTCCTCCCAACATTGCTTCCGG + Intronic
1197180078 X:123525511-123525533 GTTCCCTCCCACATTGACTCTGG + Intergenic
1199300656 X:146209943-146209965 CCTCCTCCCACCCTTCACTCTGG + Intergenic
1199322645 X:146458865-146458887 CATCTTCCCAAGATTGAATCAGG + Intergenic
1200527362 Y:4290213-4290235 CATCCTCCCAAGATTGAAACAGG - Intergenic