ID: 1145916474

View in Genome Browser
Species Human (GRCh38)
Location 17:28576961-28576983
Sequence CCACACCCCCTCCCCAGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1260
Summary {0: 1, 1: 1, 2: 10, 3: 116, 4: 1132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145916466_1145916474 -4 Left 1145916466 17:28576942-28576964 CCTGCATGCCCCGCCCTGACCAC 0: 1
1: 0
2: 6
3: 65
4: 460
Right 1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG 0: 1
1: 1
2: 10
3: 116
4: 1132
1145916465_1145916474 8 Left 1145916465 17:28576930-28576952 CCGGGGGCGTGGCCTGCATGCCC 0: 1
1: 0
2: 2
3: 25
4: 233
Right 1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG 0: 1
1: 1
2: 10
3: 116
4: 1132
1145916464_1145916474 11 Left 1145916464 17:28576927-28576949 CCTCCGGGGGCGTGGCCTGCATG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG 0: 1
1: 1
2: 10
3: 116
4: 1132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145916474 Original CRISPR CCACACCCCCTCCCCAGGAC TGG Exonic
900031923 1:378653-378675 CCACAAAGCCTCCCCAGGGCTGG + Intergenic
900052471 1:606839-606861 CCACAAAGCCTCCCCAGGGCTGG + Intergenic
900084603 1:885746-885768 CAACACCACCTCCCCAGCAAGGG - Intergenic
900106695 1:984394-984416 CCCCCCGCCCTCCCCAGGAGGGG - Intergenic
900129054 1:1079988-1080010 CCGCACCACGTCCCCAGGCCTGG - Intergenic
900432398 1:2609108-2609130 TCACACCCCAACCCCAGCACAGG - Intronic
900487321 1:2929336-2929358 CCACACTCTCTCCCCAGGGAGGG - Intergenic
900517364 1:3089221-3089243 CCACACCCCTTCTCCAGGCAGGG - Intronic
900658773 1:3772734-3772756 CCTCGCCCCCTGCCCAGGCCCGG + Intergenic
900714873 1:4137872-4137894 GCAGACCCCCTCCCCAGACCTGG - Intergenic
900819456 1:4875014-4875036 CCAGACCCCCACCCCACAACAGG + Intergenic
900918409 1:5654636-5654658 CCACTCCCCCACCCCACAACAGG - Intergenic
900991021 1:6098415-6098437 CCCCACCTCCTCCCCAGGCCAGG + Intronic
901003574 1:6160924-6160946 CCACAGCCCCTTCCCAGGGAGGG + Intronic
901049304 1:6418524-6418546 CGACACACCCACCCCAGCACTGG - Exonic
901242534 1:7703988-7704010 CCGCACCCCCTCCCCAAAGCCGG + Intronic
901659411 1:10789159-10789181 CCACACCCCCCACCCAAGACAGG + Intronic
902044854 1:13516572-13516594 ACTCACCCCCTCTCCAGGAAGGG + Intergenic
902079479 1:13811492-13811514 CCACACACCCTCCCCAGGCCCGG - Intronic
902373060 1:16017363-16017385 CCCCACCCCCACCCCAGAAAAGG - Intronic
902411253 1:16212729-16212751 CCGCCCCCCTTCCCCAGAACCGG + Intergenic
902987799 1:20166026-20166048 CCTCACCACCACCCCAGGAATGG - Intronic
903181471 1:21607086-21607108 CCTCACCCTCAACCCAGGACAGG - Intronic
903225512 1:21892382-21892404 CCAGTCCCCTTCCCCAGGAGCGG - Intronic
903742283 1:25565221-25565243 CCAGGCCCCCTACCCAGCACAGG - Intronic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
903882749 1:26522907-26522929 ACAGACCCTCTCCCCAGGACAGG + Intergenic
903888659 1:26555636-26555658 CCACATCCCCTCCCCTGAGCTGG - Intronic
903927364 1:26840128-26840150 CCCAAGCCTCTCCCCAGGACAGG - Intronic
903928506 1:26848864-26848886 CCAGACCCCCTGCCCAGCCCTGG - Intronic
904010007 1:27383904-27383926 CCACACCCTCTGGCCAGGTCAGG + Intergenic
904286608 1:29456786-29456808 CCTTATCCTCTCCCCAGGACAGG - Intergenic
904405988 1:30288220-30288242 TCACACTCTCTCCCCAGGCCTGG + Intergenic
904441459 1:30534606-30534628 CAAGACCCTCTCCCCAGAACAGG + Intergenic
904652217 1:32014121-32014143 CCCCTCCGCCTCCCCGGGACCGG - Exonic
905040978 1:34958071-34958093 CCCCTCCCCCACCCCACGACAGG - Intergenic
905481710 1:38266257-38266279 CCCCTCCCCCACCCCACGACAGG + Intergenic
905489906 1:38335211-38335233 TCAGACCCCCCTCCCAGGACTGG + Intergenic
905772995 1:40650229-40650251 CCATGCCCCCTTCCCAGGACAGG + Intronic
906607598 1:47182719-47182741 CCTGACTCCCACCCCAGGACTGG + Intergenic
906908490 1:49921083-49921105 CCATACTCCCACCCCACGACAGG - Intronic
906945594 1:50291719-50291741 CCATCCCCCCACCCCACGACAGG - Intergenic
907016775 1:51023227-51023249 CCATCCCCCCACCCCATGACAGG + Intergenic
907686170 1:56613988-56614010 CCATTCCCCCACCCCATGACAGG - Intronic
907979470 1:59467341-59467363 CCATTCCCCCACCCCACGACAGG - Intronic
908099165 1:60772687-60772709 CCATACCCCCACCCCACAACAGG + Intergenic
908100183 1:60782805-60782827 CCCCTCCCCCACCCCATGACAGG - Intergenic
908451312 1:64258469-64258491 CCATCCCCCCACCCCAAGACAGG + Intronic
908821134 1:68087744-68087766 CCATCCCCCCACCCCATGACAGG + Intergenic
908906022 1:69010862-69010884 CCCTACCCCCACCCCATGACAGG + Intergenic
909543064 1:76812641-76812663 CCGCAGCCCCTCCCATGGACTGG + Intergenic
909723913 1:78810988-78811010 CCCCACCCCCACCCCACAACAGG - Intergenic
910412655 1:86963794-86963816 CCCCACCTCCCCCCCTGGACGGG + Intronic
910673429 1:89795608-89795630 CCATACCCCTACCCCACGACAGG + Intronic
910786479 1:91003524-91003546 CCAGGCCCCCACCCCACGACAGG - Intronic
910829728 1:91448146-91448168 CCAGTCCCCCACCCCATGACAGG - Intergenic
911079154 1:93910881-93910903 CCAACCCCCCACCCCATGACAGG + Intergenic
911370549 1:96989661-96989683 CCACACCCCCTCCACAGAGAAGG + Intergenic
911649907 1:100376145-100376167 CCATCCCCCCACCCCATGACAGG - Intronic
911669386 1:100591342-100591364 CTAGACCCCCACCCCATGACAGG + Intergenic
912126512 1:106545756-106545778 CCATCCCCCCACCCCATGACAGG + Intergenic
912584806 1:110752784-110752806 CCCTTCCCCCACCCCAGGACAGG + Intergenic
912613504 1:111073673-111073695 CCATTCCCCCACCCCATGACAGG + Intergenic
912623533 1:111189439-111189461 CCACACCCTTTCCTCAGGAATGG - Intronic
912750898 1:112286554-112286576 CCAACCCCCCACCCCATGACAGG - Intergenic
912797121 1:112700017-112700039 CCACAGCCCCTGCCTAGGGCAGG + Intronic
913002979 1:114599960-114599982 CCATCCCCCCACCCCACGACAGG - Intronic
913289826 1:117261847-117261869 CCAGCCCCCCACCCCACGACAGG + Intergenic
913341678 1:117764122-117764144 CCCAACCCCCACCCCACGACAGG + Intergenic
913423323 1:118697564-118697586 CCAACCCCCCACCCCAAGACAGG - Intergenic
913424240 1:118709021-118709043 CCAAACACCCTCCCCACAACAGG - Intergenic
914899305 1:151703398-151703420 TCACACCCTCTTCCCACGACTGG - Exonic
914981230 1:152416060-152416082 CCCCACCTTCACCCCAGGACTGG - Intergenic
915324383 1:155073462-155073484 CCACTTCCCCTCCCCTGGGCTGG - Intergenic
915707500 1:157860623-157860645 CCCCTCCCCCACCCCATGACAGG + Intronic
915901772 1:159852032-159852054 GCACATCCCTTCCCAAGGACAGG + Intronic
916265733 1:162888274-162888296 CCTCCCCACCTCCCCGGGACAGG - Intergenic
916638297 1:166697802-166697824 CCCTACCCCCACCCCACGACAGG - Intergenic
916776049 1:167965598-167965620 CCATACCCCCACCGCATGACTGG + Intronic
916928585 1:169550284-169550306 CCCCACCCCCCCCCCCCGACAGG + Intronic
917329633 1:173868327-173868349 CCCCACCCCCTCCCACGGAGCGG - Intronic
917427384 1:174929059-174929081 CCCCAGCCCCACCCCACGACAGG - Intronic
917726572 1:177833481-177833503 CCAAACCCCCTACCCCAGACAGG + Intergenic
918243662 1:182641056-182641078 CCACACCCCCTCCCAAGTGGCGG + Intergenic
918403134 1:184184585-184184607 CCATCCCCCCACCCCATGACAGG + Intergenic
918816380 1:189190903-189190925 CCATCCCCCCACCCCATGACAGG + Intergenic
919150432 1:193690400-193690422 CCCTACCCCCACCCCATGACAGG + Intergenic
919727887 1:200895527-200895549 CCCCACCCCCTCCCTAACACAGG - Intronic
919800782 1:201353509-201353531 CCCAACCCCCGCCCCAGGTCAGG + Intergenic
919897531 1:202018503-202018525 CCACCCCCACTCCCCAGCCCAGG - Intergenic
919974091 1:202599640-202599662 CCCCACCCACTCCCCAGTACAGG - Intronic
920112797 1:203598937-203598959 CAACACCCCCTCCCCAGCTGAGG + Intergenic
921021792 1:211242547-211242569 CCCCACCCCGACCCCACGACAGG - Intergenic
921171891 1:212558223-212558245 CCCCACCCCCACCCAAGGACAGG + Intergenic
921239230 1:213160842-213160864 CCATCCCCCCACCCCATGACAGG - Intronic
921470167 1:215538202-215538224 CCGTACCCCCACCCCAAGACAGG - Intergenic
921915458 1:220605662-220605684 CCAGCCCCCCACCCCACGACAGG + Intronic
922072482 1:222209002-222209024 CCATCCCCCCACCCCACGACAGG - Intergenic
922689445 1:227676669-227676691 CCCCTCCCCCTCCCCACAACAGG + Intronic
922717956 1:227886809-227886831 CCAGACACCCTGTCCAGGACCGG + Intergenic
922749750 1:228064856-228064878 CCTCACCCCCACCCCATGTCGGG - Intergenic
922774083 1:228207080-228207102 CAGCATCCCCTCCCCAGGGCTGG + Intronic
922801223 1:228365599-228365621 CCATGCCCCCTGCCCAGGGCTGG + Intronic
922803755 1:228375510-228375532 CCCCAGCCCCTCGCCAGGAGAGG + Intronic
923051216 1:230392676-230392698 CCACACCCGCTCCTCAGCAGCGG + Intronic
923240700 1:232082696-232082718 CCCTACCCCCACCCCAGGACAGG - Intergenic
923345694 1:233050081-233050103 CTAGACCCCCACCCCATGACAGG - Intronic
923418697 1:233790945-233790967 CCCCACCCCCACCCCAGGAAAGG + Intergenic
923968091 1:239166314-239166336 CCATCCCCCCACCCCATGACAGG - Intergenic
1063121497 10:3107908-3107930 CCACAGCCCATCCCCAGCCCCGG - Intronic
1063591169 10:7396890-7396912 CCATCCCCCCACCCCACGACAGG - Intronic
1063872994 10:10439776-10439798 CCTCTCCCCCGCCCCAGGACAGG - Intergenic
1064151493 10:12869399-12869421 CCAGTCCCCATCCCCAGCACTGG + Intergenic
1064367517 10:14720992-14721014 CCAGGCCCCCACCCCATGACAGG + Intronic
1064892563 10:20194784-20194806 CCCTCCCCCCACCCCAGGACAGG + Intronic
1064939644 10:20719653-20719675 CCCCCCCCCCACCCCACGACAGG + Intergenic
1065223871 10:23523300-23523322 CCAAAGCCCCTGCCAAGGACAGG - Intergenic
1065563567 10:26987273-26987295 CCATACCCCCACCCCACAACAGG - Intergenic
1065676185 10:28176870-28176892 CCACCCCCCCACCCCACGACAGG - Intronic
1065692112 10:28345220-28345242 CCAGACCCCACCCCCAGCACTGG - Intergenic
1065969026 10:30791237-30791259 CCACGCCCCCTCCCCAGCGGAGG - Intergenic
1066016641 10:31251522-31251544 CCACTCCCCCACCCCATAACAGG - Intergenic
1067017024 10:42765266-42765288 CCATCCCCCCACCCCATGACAGG - Intergenic
1067141011 10:43656677-43656699 CCAGTCCCCCACCCCACGACAGG - Intergenic
1067214682 10:44292824-44292846 CCCCACCCCCTCCCCCCAACAGG + Exonic
1067362397 10:45594663-45594685 CCACACCCCCTGCCCGGGCCGGG + Intronic
1067695524 10:48532634-48532656 CCAACCCCCCACCCCATGACAGG + Intronic
1067847376 10:49735126-49735148 CCACAGCCCCTCTCCTGGGCAGG + Exonic
1068054251 10:51991528-51991550 CCACTCCCCCAGCCCATGACAGG + Intronic
1068057060 10:52024477-52024499 CCATTCCCCCACCCCACGACAGG + Intronic
1068401362 10:56531777-56531799 CCCTCCCCCCACCCCAGGACAGG - Intergenic
1068622141 10:59198201-59198223 CCCTACCCCCACCCCATGACAGG + Intronic
1069049547 10:63778201-63778223 CCCCACCTCCACCCCACGACAGG + Intergenic
1069053614 10:63820552-63820574 ACTCTCCCCTTCCCCAGGACTGG + Intergenic
1069821037 10:71228962-71228984 CTACACCCACTCCCCAAGGCAGG + Intronic
1070463230 10:76690956-76690978 CCCCTCCTCCTCCCCATGACAGG + Intergenic
1070476953 10:76838179-76838201 CCTGCCCCCCTCCCCATGACAGG - Intergenic
1070666387 10:78348049-78348071 CCACACTCCCTCCCAAGTAGTGG + Intergenic
1070725920 10:78790395-78790417 CCTCACCCCCTCCCGCTGACTGG - Intergenic
1070819535 10:79346843-79346865 CCCCCAGCCCTCCCCAGGACTGG - Intergenic
1071084036 10:81847210-81847232 CCATTCCCCCACCCCATGACAGG - Intergenic
1071606954 10:87000922-87000944 CCACTCCCCCACCCCACGACAGG + Intergenic
1071697924 10:87897945-87897967 CCAACCCCCCACCCCAGGACAGG + Intronic
1071894563 10:90051519-90051541 CCACAATCCCTGCCCAGGAAGGG + Intergenic
1072073781 10:91948156-91948178 CCATCCCCCCACCCCACGACAGG + Intronic
1072360722 10:94656453-94656475 CCACAACACCTCCCCAGCAAGGG - Intergenic
1072373970 10:94795151-94795173 CCCCACCCCCACCCCACGACAGG + Intronic
1072404006 10:95132628-95132650 CCCTACCCCCACCCCATGACAGG - Intergenic
1073146765 10:101286226-101286248 CCCCACCCCCACCCCCAGACTGG + Intergenic
1073327925 10:102653200-102653222 CCCCACCCCGTAGCCAGGACAGG + Intronic
1073445878 10:103580045-103580067 CCAGACTCCCTGCCCAGGGCTGG + Intronic
1073500935 10:103936360-103936382 ACACAGCCTCTCCCCAGGACAGG + Intergenic
1074241414 10:111643071-111643093 CCTCCCCCCCACCCCACGACAGG - Intergenic
1074252910 10:111770610-111770632 CCATCCCCCCACCCCACGACAGG - Intergenic
1074595834 10:114866125-114866147 CCCCACCCCGCCCCCAGCACAGG + Intronic
1074898386 10:117796199-117796221 CCTCATCCCTTCCCCAGCACTGG - Intergenic
1074986450 10:118664135-118664157 CCCCACCCCATGCTCAGGACAGG - Intergenic
1075129352 10:119725614-119725636 CCACACCCGCTCTCCCGGAGCGG - Intergenic
1075170555 10:120109735-120109757 CCCCTCCCCCACCCCACGACAGG + Intergenic
1075591160 10:123692599-123692621 ACCCACCCTCTCCCCAGGTCCGG - Exonic
1075669917 10:124257183-124257205 CCTGAGCCCCTCCCCAGGTCAGG - Intergenic
1075790018 10:125077510-125077532 ACTCACCCCCTCACCAGGCCTGG + Intronic
1075804812 10:125179138-125179160 CCAGCCCCCCACCCCATGACAGG + Intergenic
1076107978 10:127839496-127839518 CCTCACCCCTGCCCCATGACAGG - Intergenic
1076615070 10:131749683-131749705 GCCCACCTCCTCCCCAGGCCTGG - Intergenic
1076691319 10:132225153-132225175 AGCCACCCCCTCCCCAGCACTGG + Intronic
1077161144 11:1113325-1113347 CCCCACCCCTTCCCCAGAGCAGG + Intergenic
1077161195 11:1113440-1113462 CCCCACCCCTTTCCTAGGACAGG + Intergenic
1077311686 11:1891625-1891647 CCACACCCCCACTCCACCACAGG - Intronic
1077499144 11:2901462-2901484 CCCCACCTCCTCCCCAGGCAAGG - Intronic
1077682157 11:4251992-4252014 CCATCCCCCCACCCCACGACAGG + Intergenic
1077696271 11:4395804-4395826 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1077780087 11:5318275-5318297 CCCCACCCCCACCCCACAACAGG + Intronic
1077864326 11:6210553-6210575 CTACGCCACCTCCCCAGGAAGGG + Exonic
1078119852 11:8495941-8495963 CCAGCCCCCCACCCCATGACAGG - Intronic
1078414859 11:11156734-11156756 CCTAACCCCCTCCCCTGGGCTGG + Intergenic
1078721947 11:13893093-13893115 CAATACCCCCACCCCATGACGGG + Intergenic
1078929157 11:15900110-15900132 CTAGACCCCATACCCAGGACAGG - Intergenic
1079119582 11:17672333-17672355 TTATGCCCCCTCCCCAGGACAGG - Intergenic
1079177595 11:18157355-18157377 CCCCTCCCCCACCCCACGACAGG - Intronic
1079465584 11:20726744-20726766 CCATCCCCCCACCCCATGACAGG + Intronic
1080012311 11:27471985-27472007 GCGGACCCCCTCCCCAGGCCCGG + Intronic
1080604295 11:33851959-33851981 CCACACCCACTCCCCATAATGGG - Intergenic
1080639143 11:34148716-34148738 CCATACCCCCTCGCCAGGCGGGG + Intergenic
1080650064 11:34215175-34215197 CCTCACCCCCTGCCCAGCAATGG - Intronic
1080682553 11:34490115-34490137 CAACACCCCCTCTCCTGGCCTGG - Intronic
1081067643 11:38565798-38565820 CCTAACCCCCTCCCCTAGACAGG + Intergenic
1081173263 11:39893929-39893951 CCACACCCCCTCCCAAGTCTAGG + Intergenic
1081378069 11:42382793-42382815 CCATCCCCCCACCCCACGACAGG - Intergenic
1081728094 11:45346812-45346834 ACACAAGCCCTCCACAGGACAGG + Intergenic
1081768810 11:45633568-45633590 CCATCCCCCCACCCCACGACAGG - Intergenic
1081983387 11:47284305-47284327 CCCCAACCCCTGCCCAGGGCTGG - Intronic
1082654902 11:55842511-55842533 CCCCACCCCCACCCCACAACAGG + Intergenic
1082786338 11:57319240-57319262 ACGCAGCCCCACCCCAGGACTGG + Intronic
1082811693 11:57482592-57482614 CCAAACCCCCGCCGCGGGACGGG - Intergenic
1082887852 11:58107260-58107282 CCATACCCCCACCCAATGACAGG + Intronic
1082967481 11:58981663-58981685 CCCCACCCCCACCCCACAACAGG + Intronic
1083078751 11:60068851-60068873 CCAGCCCCCCACCCCACGACAGG + Intronic
1083227780 11:61295375-61295397 CCACACCCCCTGCCCCGGTTTGG + Exonic
1083272630 11:61580096-61580118 GCCCTCCCCCACCCCAGGACGGG + Intronic
1083361567 11:62112435-62112457 CCCGACCCCCTCCTCAGGCCGGG + Intergenic
1083596557 11:63920568-63920590 CCACACTCCCTCCCCAACCCCGG - Intergenic
1084547926 11:69823668-69823690 CCCCACCTCATCCACAGGACTGG - Intergenic
1084674930 11:70628765-70628787 CCACCTGCCCTCCCCAGGACAGG + Intronic
1084935911 11:72586514-72586536 CCACCGCCCCTCCCCAAGGCTGG - Intronic
1084961915 11:72721308-72721330 TTACCCCTCCTCCCCAGGACTGG - Intronic
1085043173 11:73338715-73338737 CCACTCCACCTCCCCTGGCCTGG - Intronic
1085052123 11:73385211-73385233 CCACTCCCCCTCCCCTAGGCAGG - Intronic
1085206966 11:74740812-74740834 CCAGCCCCCCACCCCACGACAGG + Intergenic
1085208185 11:74749437-74749459 CTCCACCCCCTCACCAGGCCGGG - Intronic
1085509690 11:77082030-77082052 ACACAGCCCCTCCCCTGGAGGGG + Intronic
1085536002 11:77218537-77218559 CCATACCCCCACCCCACGACAGG + Intronic
1085575519 11:77599417-77599439 CCAGCCCCCCACCCCATGACAGG + Intronic
1085820605 11:79789369-79789391 CCTTACCCCCACCCCATGACAGG + Intergenic
1085848276 11:80090974-80090996 CCACCCCAGATCCCCAGGACAGG + Intergenic
1085936882 11:81157042-81157064 TCACACCCCATTCCAAGGACAGG - Intergenic
1086065180 11:82736141-82736163 CCATCCCCCCACCCCACGACAGG - Intergenic
1086254792 11:84862812-84862834 CCCCACCCCCCCCCCCCGACAGG - Intronic
1086628968 11:88992860-88992882 CCCCTCCCCCACCCCACGACAGG - Intronic
1087138745 11:94745246-94745268 CCATCCCCCCACCCCACGACAGG + Intronic
1087569283 11:99904284-99904306 CCAACCCCCCTCCCCAAGCCCGG + Intronic
1087869317 11:103272416-103272438 CCATCCCCCCACCCCACGACAGG - Intronic
1088357620 11:108960197-108960219 GCACACCCTCTCCCCATGGCTGG - Intergenic
1089215143 11:116830496-116830518 CCACGCCACCTCCCCAGGGAGGG + Intronic
1089303737 11:117514143-117514165 CCAGAGCCCCTTCCCAGGCCTGG + Intronic
1089670820 11:120055908-120055930 CCTCACTCCCACCCCAGGAAGGG + Intergenic
1089677364 11:120098813-120098835 CCACATCCCCACCCCATGCCGGG + Intergenic
1090429358 11:126633219-126633241 CCTCACCCCCACCCCACAACAGG - Intronic
1090739932 11:129650052-129650074 CCCTACCCCCACCCCATGACAGG + Intergenic
1090829113 11:130408691-130408713 CCACACCCCCGCCCCCCGGCAGG - Intronic
1090852031 11:130579109-130579131 CCACCCCCACACCCCAGCACAGG - Intergenic
1090933256 11:131318509-131318531 CCATCCCCCCACCCCATGACAGG - Intergenic
1090972294 11:131654113-131654135 CCAAACCTCCTCCTGAGGACAGG - Intronic
1091218569 11:133918033-133918055 CCACCCCCCGTCCCCATGTCCGG - Intronic
1091397541 12:163205-163227 CCCCTCCCCCTCCACAGAACCGG + Intronic
1091529659 12:1341654-1341676 CCAACCCCCCACCCCATGACAGG - Intronic
1091590616 12:1840839-1840861 CCACAGCTCTTCCCCATGACTGG - Intronic
1091645410 12:2268966-2268988 CCCCACCCCCTGCCCAGGGTCGG + Intronic
1091718130 12:2794537-2794559 CGGCGCCCCCTCCCCGGGACCGG - Intergenic
1091781309 12:3216138-3216160 CCCCACCCCCACCCCAGCCCTGG + Intronic
1092204952 12:6608944-6608966 CCTCACCACATCCCCAGGTCAGG + Intergenic
1093516605 12:19994241-19994263 CCATCCCCCCACCCCACGACAGG - Intergenic
1093694314 12:22142794-22142816 CCCCTCCCCCACCCCACGACAGG - Intronic
1093875699 12:24346871-24346893 CCATCCCCCCACCCCACGACAGG - Intergenic
1094127694 12:27040663-27040685 CCATCCCCCCACCCCACGACAGG + Intronic
1094253991 12:28400350-28400372 CCCCACCCCCACCCTAGGACTGG + Intronic
1094496426 12:30992174-30992196 CCAGAGCCCCTCACCAGGAACGG + Exonic
1095348267 12:41179090-41179112 CCACTCCCCCACCCCACAACAGG + Intergenic
1095652884 12:44634320-44634342 CCAGCCCCCCACCCCATGACAGG + Intronic
1095845812 12:46742972-46742994 CCAACCCCCCACCCCACGACAGG - Intergenic
1095946926 12:47758926-47758948 CCCCTTCCCCTCCCCAGGACTGG + Intronic
1096073649 12:48789170-48789192 CCCCTCCCCCTCCCCAGAAGTGG + Intergenic
1096478896 12:51924894-51924916 CCCCACTCCTCCCCCAGGACAGG - Intergenic
1096526221 12:52211894-52211916 CCACACCCTCTCACCTGGGCAGG - Intergenic
1096885676 12:54716826-54716848 CCAGCCCCCCTCTCCAGCACTGG + Intergenic
1096921804 12:55095293-55095315 CCACCCCCCCACCCCACAACAGG - Intergenic
1096977489 12:55707845-55707867 CCACCCCGCCGCCCCAGCACCGG + Intronic
1097303141 12:58039839-58039861 CCCAACCCCCACCCCATGACAGG + Intergenic
1097305475 12:58063852-58063874 CCCCACCCCCACCCCACAACAGG - Intergenic
1097321077 12:58227087-58227109 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1097430474 12:59499198-59499220 CCATCCCCCCACCCCACGACAGG - Intergenic
1097526028 12:60737362-60737384 CCTGACCCCCACCCCATGACAGG - Intergenic
1097624395 12:61982282-61982304 CCAGACCCCCACCCCACGACAGG - Intronic
1097799210 12:63894619-63894641 CCACTTCCCCACCCCACGACAGG + Intronic
1097911757 12:64977933-64977955 CCATTCCCCCTCCCCTGGACAGG + Intergenic
1098798832 12:74927022-74927044 CCAGGCCCCCACCCCATGACAGG - Intergenic
1099427731 12:82545330-82545352 CCATCCCCCCACCCCATGACAGG + Intergenic
1099575681 12:84377952-84377974 CCATCCCCCCACCCCATGACAGG - Intergenic
1099626899 12:85087090-85087112 CCATCCCCCCACCCCACGACAGG + Intronic
1099839629 12:87949181-87949203 CCACTCCCCCACCCCACAACAGG - Intergenic
1100117124 12:91320615-91320637 CCATGCCCCCACCCCATGACAGG - Intergenic
1100226997 12:92568077-92568099 CCAGACCCCCACCCCCCGACAGG - Intergenic
1100353964 12:93811277-93811299 TTACAGCCCCTCCCCAGAACTGG + Intronic
1100568365 12:95820940-95820962 CCCCTCCCCCACCCCATGACAGG + Intronic
1100749244 12:97678926-97678948 CCAGCCCCCCACCCCATGACAGG - Intergenic
1100827648 12:98489924-98489946 CCACACCCCCACCCCATGCCTGG + Intronic
1100980698 12:100160043-100160065 CCACCCCCCGCCCCCAGGAGCGG + Intergenic
1101741024 12:107500249-107500271 CTGCGCCCGCTCCCCAGGACTGG + Intronic
1101892645 12:108730971-108730993 CCAAACCCAGTCCCCAGGCCTGG + Intronic
1102514149 12:113435312-113435334 TCACCCCCCCTCCCCAGGAAAGG + Exonic
1102688190 12:114740519-114740541 CCATGCCCCCACCCCAGGCCAGG + Intergenic
1102797578 12:115702117-115702139 CCCTACCCCCACCCCACGACAGG - Intergenic
1103564356 12:121808077-121808099 CCACACAGCCTCCCTAGGACTGG + Intronic
1103907485 12:124335063-124335085 CCCCATCCCCTCTCCAGGCCTGG + Intronic
1103956919 12:124582479-124582501 CCACAGCAGCTCCCCAGGGCAGG - Intergenic
1104086837 12:125483088-125483110 CCAACCCCCCACCCCACGACAGG - Intronic
1104174828 12:126320801-126320823 CCATCCCCCCACCCCACGACAGG + Intergenic
1104408217 12:128536384-128536406 CCAGCCCCCCACCCCATGACAGG - Intronic
1104517108 12:129437887-129437909 CCAGCCCCCCTCCCCCCGACAGG + Intronic
1104751381 12:131241889-131241911 ACACACCCTTTCCCCAGTACAGG + Intergenic
1105322663 13:19343888-19343910 CCCCACCCCCTCCCCCCGACAGG - Intergenic
1105734780 13:23256526-23256548 CCATTCCCCCACCCCACGACAGG + Intronic
1105883522 13:24623636-24623658 CCACACCCCCTCCCCTGTGGTGG + Intergenic
1106030967 13:26002408-26002430 CCATCCCCCCACCCCACGACAGG - Intronic
1106317205 13:28605158-28605180 CCACACCCCCACCACACAACAGG + Intergenic
1106564725 13:30874260-30874282 CCCCACCTCCTCCCCAGCCCCGG - Intergenic
1106574049 13:30957734-30957756 CCACAGCCCCTACCCTGGAAGGG - Intronic
1106583840 13:31039726-31039748 CCACACTCCATCTCCAGCACTGG - Intergenic
1106730606 13:32538063-32538085 CCGCCCCCCCCCCCCAAGACGGG - Intronic
1107042113 13:35959954-35959976 ACACAACCCTTTCCCAGGACAGG - Intronic
1107371536 13:39755426-39755448 CCCCACCCCCACCCCAGTAGAGG - Intronic
1108188949 13:47917471-47917493 CCACACCCCATCCCCCTCACTGG + Intergenic
1108457211 13:50628526-50628548 CCCCTCCCCCACCCCATGACAGG + Intronic
1108572818 13:51767769-51767791 CCCCCCCCCCGCCCCAGGAGAGG - Intergenic
1108989321 13:56634762-56634784 CCATTCCCCCACCCCATGACAGG - Intergenic
1109949061 13:69478008-69478030 CCCCAACCCCACCCCATGACAGG + Intergenic
1110016698 13:70414433-70414455 CCATCCCCCCACCCCAGGACAGG - Intergenic
1110159594 13:72359570-72359592 CCCTCCCCCCTCCCCATGACAGG - Intergenic
1110188657 13:72704418-72704440 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1110877061 13:80522821-80522843 CCATGCCCCCACCCCATGACAGG - Intergenic
1112290808 13:98143066-98143088 CCACCGCCCCTCCCCGGGTCTGG - Intronic
1112506444 13:99979195-99979217 CCCCACCCCACCCCCAGGACAGG + Intergenic
1113335802 13:109374552-109374574 CCAAATCCCCTCTCCAGGACAGG - Intergenic
1113488667 13:110675551-110675573 CCACTCCCCCACCCCATGACAGG - Intronic
1113612433 13:111656747-111656769 CCTCACCCCGTGCCCAGGAAGGG + Intronic
1113706240 13:112434560-112434582 CCAGACCCCCTGCGCAGGAGAGG + Exonic
1114055961 14:18967253-18967275 CCCCACGCCCACCCCAGGAAGGG - Intergenic
1114106588 14:19434500-19434522 CCCCACGCCCACCCCAGGAAGGG + Intergenic
1114343122 14:21766121-21766143 CCAGACCCCCACCCCACAACAGG - Intergenic
1114442246 14:22758632-22758654 CCATCCCCCCACCCCACGACAGG - Intergenic
1114566887 14:23639537-23639559 CCTCACCCCACCCCCAGGCCCGG + Intronic
1115916947 14:38325925-38325947 CCATCCCCGCACCCCAGGACAGG - Intergenic
1116128271 14:40818169-40818191 CCATTCCCCCACCCCATGACAGG + Intergenic
1116650034 14:47578246-47578268 CCTCACCCCCACCCCCTGACTGG - Intronic
1116728604 14:48593722-48593744 CCATTCCCCCACCCCATGACAGG - Intergenic
1116902048 14:50370883-50370905 CCAGACCCCATCTCCAGCACTGG + Intronic
1117612492 14:57499150-57499172 CCATCCCCCCACCCCATGACAGG + Intergenic
1118857850 14:69637826-69637848 CCACACTCCCTCCCCTGCACAGG - Intronic
1119262240 14:73244706-73244728 TGACACCCCCTCCACAGGTCCGG - Exonic
1119987055 14:79149849-79149871 CCTCCTCCCCTCCCCATGACTGG - Intronic
1120066307 14:80044819-80044841 CCAAACCCCCACCCCCTGACAGG - Intergenic
1120663188 14:87275184-87275206 CCCTCCCCCCTCCCCACGACAGG + Intergenic
1121908889 14:97771122-97771144 CTGCACCCCCTCCCCAAGCCTGG - Intergenic
1122093165 14:99353238-99353260 TCACTCCCCCTCCCCAGCCCAGG + Intergenic
1122836026 14:104431567-104431589 CCCCACCTCCACCCCAGGATGGG + Intergenic
1123499403 15:20866495-20866517 CCCCACGCCCACCCCAGGAAAGG + Intergenic
1123556655 15:21440225-21440247 CCCCACGCCCACCCCAGGAAAGG + Exonic
1123592877 15:21877460-21877482 CCCCACGCCCACCCCAGGAAAGG + Intergenic
1123877067 15:24634079-24634101 CCCCATCCCCACCCCATGACAGG + Intergenic
1124253136 15:28120664-28120686 CCTCACACCCTCCCCACCACTGG - Intronic
1124551042 15:30681753-30681775 CCCCACACCCTCGCCAAGACTGG - Intronic
1124680212 15:31723915-31723937 CCCCACACCCTCGCCAAGACTGG + Intronic
1125355619 15:38814612-38814634 CCAGCCCCCCACCCCATGACAGG - Intergenic
1126184477 15:45818620-45818642 CCATCCCCCCGCCCCATGACAGG + Intergenic
1126724628 15:51619836-51619858 CCACACACCCTCTCCAGAGCAGG + Intronic
1127154339 15:56110402-56110424 TGACCCCCCCTCCCCCGGACGGG - Intronic
1127732619 15:61814519-61814541 CCCCACCCCCTGCCCAGTCCAGG - Intergenic
1127865474 15:63029017-63029039 ACATACCCCCTCCCCAGGCTTGG + Intergenic
1127920693 15:63492050-63492072 CCACACCACCACCCCATCACAGG + Intergenic
1128114188 15:65095068-65095090 CCACACCCCTTCTCCAGCACTGG - Intronic
1128156526 15:65395112-65395134 CCGCACCTCCACCCCAGCACTGG - Exonic
1128228697 15:66020057-66020079 CCACCGCCCCTCCCCAGCTCGGG + Intronic
1128339515 15:66810863-66810885 CCATCCCCCCACCCCATGACGGG + Intergenic
1128493244 15:68172061-68172083 CCAGCCCCCCACCCCAAGACAGG + Intronic
1128600261 15:68989946-68989968 CCACACCTCCACCCCAGTTCAGG - Intronic
1128801715 15:70501281-70501303 ACCCACCCCCTCACCCGGACTGG + Intergenic
1128898987 15:71402095-71402117 CCATCCCCCCACCCCACGACAGG - Intronic
1129623110 15:77167885-77167907 CCATGCCCCCACCCCACGACAGG + Intronic
1129668184 15:77591438-77591460 CGACACCCCCTCACCAGGAGCGG - Intergenic
1129776074 15:78237282-78237304 GCACACCCTCTCGCCAGGGCAGG + Intronic
1129866012 15:78909380-78909402 CCCAAACCCCTCCCCAGGACTGG - Intergenic
1130555273 15:84918261-84918283 CCACCCCCTCTCCTCAGCACAGG - Intronic
1130561567 15:84963318-84963340 ATACACCCTCTCCCCAGGAGTGG + Intergenic
1130701353 15:86185749-86185771 CCAGCCCCCCACCCCACGACAGG - Intronic
1131498070 15:92932441-92932463 CCTCCCCCCCACCCCATGACAGG + Intronic
1132011319 15:98279051-98279073 CCCCACCCCCACCCCACAACAGG - Intergenic
1202964994 15_KI270727v1_random:167414-167436 CCCCACGCCCACCCCAGGAAAGG + Intergenic
1132543441 16:521991-522013 CCAGACCCCATCACCAAGACTGG + Exonic
1132584431 16:700148-700170 CTACACCCCCTCCCCAGATGTGG - Intronic
1132598133 16:762462-762484 ACCCAGCCCCTCCCCTGGACAGG + Intronic
1132607812 16:800808-800830 CCCCACACCCTCCTCAGGGCTGG + Intergenic
1132639985 16:973526-973548 CCACTCCCCGTCCCCAGACCTGG - Intronic
1132664152 16:1074002-1074024 GCACATACCCTCCCCAGGAGAGG - Intergenic
1132666681 16:1084057-1084079 TCACACCCGTTTCCCAGGACGGG - Intergenic
1132726761 16:1342275-1342297 CCACACCCACTCACCCGGACAGG - Exonic
1132939466 16:2499698-2499720 TCCCACCCCCACCCCAGGGCAGG - Intronic
1132949477 16:2552861-2552883 CCACACCCCCTTCTCAGTCCTGG - Intronic
1132964871 16:2647305-2647327 CCACACCCCCTTCTCAGTCCTGG + Intergenic
1133847300 16:9467133-9467155 CAACACCACCCCCCCAGGCCTGG - Intergenic
1134775281 16:16847755-16847777 CCATCCCCCCACCCCATGACAGG + Intergenic
1134794690 16:17024313-17024335 CCATGCCCCCACCCCACGACAGG + Intergenic
1134880145 16:17739138-17739160 CCATCCCCCCACCCCACGACAGG - Intergenic
1135166571 16:20144393-20144415 CCATCCCCCCACCCCATGACAGG + Intergenic
1135503640 16:23017960-23017982 TCCCACCCCCTCCCCAGGCTGGG + Intergenic
1135631034 16:24035655-24035677 CCACACCCCCTCCCCGTCCCTGG - Intronic
1135895906 16:26402282-26402304 CCAGGCCCCCACCCCACGACAGG + Intergenic
1136395574 16:29990983-29991005 CCACCCTCCCTCCCCAGTCCTGG - Intronic
1137253819 16:46759098-46759120 GGACACCCCCTCACCAGGCCAGG - Intronic
1137576624 16:49604304-49604326 CCACAGCCACCCTCCAGGACAGG + Intronic
1137785257 16:51133232-51133254 CCCCACCCCCACCCCCGGTCTGG - Intergenic
1138006780 16:53344568-53344590 CCCTACCCCCACCCCATGACAGG + Intergenic
1138678223 16:58666974-58666996 GCACAACCCCTACTCAGGACAGG + Exonic
1139488289 16:67271607-67271629 CCCAACTCCCTCCCCAGCACTGG + Exonic
1139577569 16:67851655-67851677 CGCTACCCCCGCCCCAGGACAGG + Intronic
1139784955 16:69385563-69385585 CCAACCCCCCTCCCCCGGCCCGG + Intronic
1139950296 16:70665091-70665113 CCACACCCTCCCTGCAGGACTGG - Exonic
1140098639 16:71895789-71895811 CCACGCCCCCCACCCAGGCCTGG - Intronic
1140384183 16:74519713-74519735 CCCCACCCACTCCCCAGAAGCGG + Intronic
1140582607 16:76249435-76249457 CCACAACCCCACCCCATGACAGG + Intergenic
1140586585 16:76299988-76300010 CCACTCCCCCACCCCACAACAGG - Intronic
1140588814 16:76326792-76326814 CCCCACCCCCACCCCACAACAGG - Intronic
1140765117 16:78150262-78150284 CCACATCCCCTCCGCATGCCTGG - Intronic
1141034941 16:80618657-80618679 CCCCACGCCCTCCCCAGGCTGGG + Intronic
1141479945 16:84299806-84299828 CCAGCCCCCCTCAGCAGGACAGG - Intronic
1141893578 16:86944279-86944301 CCACACCCCTCACCCAGCACTGG + Intergenic
1141961799 16:87413807-87413829 CCCACCCCCCACCCCAGGACTGG - Intronic
1142024504 16:87805189-87805211 CCACACACACTCCCCAGGCAGGG + Intergenic
1142078136 16:88132192-88132214 CCCCCACCCCTACCCAGGACGGG + Intergenic
1142149081 16:88504873-88504895 AGACACCCCCTCCCCAGGACAGG + Intronic
1142156014 16:88533221-88533243 GCCCACCCCATCGCCAGGACTGG + Exonic
1142185627 16:88693530-88693552 CCCCACCCCCTCCCCACCCCCGG + Intergenic
1142266881 16:89068040-89068062 AGACACCCTCTCCCCAGGGCTGG + Intergenic
1203141676 16_KI270728v1_random:1771327-1771349 CCACAGCCTCCCCCCAGGGCTGG - Intergenic
1203141693 16_KI270728v1_random:1771374-1771396 CCACAGCCTCCCCCCAGGGCTGG - Intergenic
1142759753 17:2035484-2035506 CCCCACCCCCTCCCCACCACAGG - Intronic
1142759766 17:2035513-2035535 CCCCACTCCCTCCCCACCACAGG - Intronic
1142836852 17:2593851-2593873 CCCCTCCCCCTCCCCGGGCCCGG + Exonic
1143204701 17:5133627-5133649 CCACCCCCCCACCCCAGGGTGGG - Intronic
1144124341 17:12188679-12188701 CCCCACCCCCACCTCAGGAAGGG + Intergenic
1144286848 17:13785366-13785388 CCACCCCCCAGCCCCAGGCCTGG - Intergenic
1144364590 17:14530268-14530290 CCATCCCCCCACCCCACGACAGG + Intergenic
1144501902 17:15795458-15795480 CCACTCCCCCACCCCACGACAGG + Intergenic
1144528508 17:16012471-16012493 CCACCCCCCAGCCCCAAGACAGG - Intronic
1145083909 17:19919074-19919096 CCAGCCCCCCACCCCACGACAGG + Intronic
1145903201 17:28501159-28501181 CCACACGCCCTCCACAGCTCTGG + Intronic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1145966018 17:28917835-28917857 CCACACTCCCTTCCCAGGAAGGG + Intronic
1145974141 17:28974709-28974731 CCCCAGGCCCTCCCCAGAACTGG + Intronic
1146056640 17:29584670-29584692 CCCCACCCCCACCCCAGGACAGG - Intronic
1146537621 17:33666675-33666697 TGTCACCCCCTGCCCAGGACTGG + Intronic
1146849753 17:36211952-36211974 CATCACCCCCTCCCCAAAACAGG - Intronic
1147005164 17:37397035-37397057 CCATCCCCCCACCCCACGACAGG + Intronic
1147167856 17:38602930-38602952 CCCCACCCCCACCCCAGGTTAGG - Intronic
1147197707 17:38778737-38778759 CCACTGTCCCTCCCCAGGCCGGG - Intronic
1147382556 17:40063904-40063926 CCCCACCCCCACCCCTGGAACGG - Intronic
1147390885 17:40108440-40108462 CCTCCACCCCTCCCCAGCACTGG + Intergenic
1147531411 17:41281599-41281621 CCTGACCCCCACCCCATGACAGG - Intergenic
1147597597 17:41726986-41727008 GCAAACCCCCTCCCCACTACAGG + Intronic
1147819503 17:43233251-43233273 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147820595 17:43239399-43239421 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147820807 17:43240664-43240686 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147821617 17:43245133-43245155 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147822711 17:43251291-43251313 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147825228 17:43266087-43266109 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147826069 17:43270822-43270844 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147826348 17:43272599-43272621 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147827236 17:43277451-43277473 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147828348 17:43283607-43283629 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147829458 17:43289771-43289793 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147830549 17:43295906-43295928 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147831233 17:43299494-43299516 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147976186 17:44249521-44249543 CCCCACCCCCACCCCAGGGCAGG + Exonic
1148451231 17:47778971-47778993 CCAGCCCCCCACCCCAAGACCGG + Intergenic
1148554688 17:48571379-48571401 CAACCCCCTCTGCCCAGGACAGG + Intronic
1148629066 17:49092606-49092628 CCCCACCCCCGCCCCAGCCCAGG - Intergenic
1148885006 17:50766112-50766134 ACTCAGCCCCTTCCCAGGACAGG + Intergenic
1149090652 17:52774296-52774318 CCAGTCCCCCACCCCACGACAGG + Intergenic
1149726419 17:58899001-58899023 CCATCCCCCCACCCCACGACAGG - Intronic
1150005059 17:61464032-61464054 CCCCACCCCCTCTCCAGGAATGG - Intronic
1150026289 17:61677806-61677828 CCAGACCCCCACCCCCAGACAGG - Intergenic
1150218149 17:63481549-63481571 CCACACCCCTCCTCCAGGGCTGG + Intergenic
1150292452 17:63989332-63989354 CCCCACACCCGCCCCAGGCCGGG - Intergenic
1150426871 17:65084110-65084132 CCAGCCCCCCACCCCATGACAGG - Intergenic
1150739942 17:67771394-67771416 CCAGCCCCCCACCCCACGACAGG + Intergenic
1151203075 17:72483248-72483270 CCAGGCCCCCTCTCCAGAACTGG + Intergenic
1151226591 17:72652539-72652561 ACTCACCCTCACCCCAGGACAGG - Intronic
1151353907 17:73547207-73547229 CCACGCCCCCTCTGCAGGGCAGG + Intronic
1151376775 17:73694629-73694651 ACCCACTCCCTCCCCAGGACAGG - Intergenic
1151377817 17:73703350-73703372 GCACAGCCCCTCCCCTGGCCAGG - Intergenic
1151486612 17:74404821-74404843 CCCCACCTCCTCCCCAGTTCAGG + Intergenic
1151662212 17:75525187-75525209 CCGCACCCCCCCCCGAGGAAAGG + Intronic
1151667987 17:75556512-75556534 CCTCACCCCCTGCCCGGGACTGG - Intronic
1151794475 17:76334174-76334196 CCCCACCCCCACCCCAAGACGGG - Intronic
1151974092 17:77474664-77474686 GCTGACCCCCTCCCCAGGCCAGG - Intronic
1152001106 17:77645814-77645836 CCACCCCCCCTGCCCAGCAGTGG + Intergenic
1152320979 17:79608806-79608828 CCCCGCCCCTCCCCCAGGACTGG - Intergenic
1152461696 17:80445284-80445306 CGACACCCTGTCCCCAGCACTGG + Intergenic
1152631049 17:81410824-81410846 CCCCACCCCCGCCCCGAGACTGG - Intronic
1152755810 17:82086553-82086575 CCTCCCTCCCTCCCCAGGGCTGG - Exonic
1152931506 17:83112373-83112395 CCACATCCCCAGCCCAGGACAGG - Intergenic
1152947733 17:83207061-83207083 CCACAAAGCCTCCCCAGGGCTGG - Intergenic
1152986915 18:329619-329641 CCCCTTCCTCTCCCCAGGACAGG + Intronic
1153133533 18:1885739-1885761 CCCCACCCCCACCCCACAACAGG - Intergenic
1153177939 18:2399969-2399991 CCTCTCCCCCACCCCATGACAGG - Intergenic
1153418891 18:4882233-4882255 CCACCCCCCCACCCCTTGACTGG + Intergenic
1154184120 18:12166871-12166893 CCCAACCCCCACCCCATGACAGG + Intergenic
1154344821 18:13532888-13532910 CCACGGCCCCTGCCCAGGACAGG - Intronic
1154370035 18:13751963-13751985 CCAGGCCCCCACCCCATGACAGG - Intronic
1155393927 18:25366643-25366665 CCACACCCCCTCACCTGGGGAGG + Intergenic
1155464727 18:26121549-26121571 CCACAACACCTCCCCAGCAAGGG + Intergenic
1155981442 18:32184452-32184474 CTCCACCCCTTCCCCATGACAGG + Intronic
1156086775 18:33415544-33415566 CCATCCCCCCACCCCACGACAGG - Intronic
1156295290 18:35783996-35784018 CCTCATCCCCTCCCCAACACGGG + Intergenic
1156380444 18:36554479-36554501 CCCCACCCCCACCCCACGACAGG - Intronic
1156471201 18:37378220-37378242 CCCCACGCCCACCCCAGGAGCGG + Intronic
1156709093 18:39920111-39920133 CCTCACCCCAACCCCATGACAGG + Intergenic
1156850908 18:41725390-41725412 CCCCGCCCCCACCCCACGACAGG + Intergenic
1156905951 18:42352291-42352313 CCAGCCCCCCACCCCATGACAGG + Intergenic
1156914263 18:42447149-42447171 CCACACCCCCTCTTCAACACCGG + Intergenic
1156923092 18:42546856-42546878 CCAGCCCCCCACCCCACGACAGG + Intergenic
1157151544 18:45223594-45223616 ACACACCCCCTCCCCTGGCTAGG + Intronic
1157231605 18:45921805-45921827 CCAGCCCCCCACCCCATGACAGG - Intronic
1158100551 18:53824882-53824904 CCCTACCCCCACCCCACGACAGG - Intergenic
1158781950 18:60662768-60662790 CCTCACCACCACCCCAGGTCTGG - Intergenic
1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG + Intronic
1159095516 18:63897326-63897348 CCACACCAGCTCCCTAGGGCTGG + Intronic
1159240663 18:65739496-65739518 CCCTACCCCCACCCCATGACAGG + Intergenic
1159325255 18:66906762-66906784 CCATACCCCCACCCCACGACAGG + Intergenic
1160309593 18:77777165-77777187 CCCCACCCCCACCGCAGGGCTGG - Intergenic
1160379254 18:78439053-78439075 TCTCATACCCTCCCCAGGACCGG - Intergenic
1160408307 18:78658248-78658270 CCACAGCCCACCCCCAGGTCAGG + Intergenic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1160693361 19:470530-470552 GCACCCCCTGTCCCCAGGACTGG - Intronic
1160726456 19:619850-619872 CCCCACCACATCCTCAGGACAGG + Intronic
1160801926 19:974275-974297 ACACACCCCCTTTCCAGGAGGGG + Exonic
1160803287 19:980076-980098 CCTCACCTCCTCCCCAGCCCAGG + Intergenic
1161191938 19:2962497-2962519 CCACATCCCCTCTCCAAGCCCGG + Intergenic
1161253956 19:3295885-3295907 CACCACCCCCTCCCAAGGCCAGG + Intronic
1161312907 19:3604590-3604612 CCACCCCACCTCCCCCAGACAGG + Intronic
1161619463 19:5290656-5290678 CCAGACTCCCGCCCCAGGACAGG - Intronic
1161630933 19:5355081-5355103 ACACACCCCCACCCCCAGACCGG + Intergenic
1161882073 19:6962529-6962551 CCCTACCCCCACCCCACGACAGG - Intergenic
1162203113 19:9035642-9035664 CCACATTCCCACACCAGGACCGG - Intergenic
1162254883 19:9482267-9482289 CCATACCCCCACCCCACAACAGG - Intronic
1162786178 19:13036384-13036406 CCACAGCCCCACCCCTGGCCTGG - Intronic
1162909887 19:13842961-13842983 CCTCCCCCCCTCCCCGGGCCGGG + Intergenic
1162940503 19:14006196-14006218 CCACCCCCACCCCCCAGGCCCGG - Exonic
1163068658 19:14819318-14819340 CCTCACCCCCACCCCCTGACAGG + Intronic
1163112635 19:15170641-15170663 CGCCACCCCCTCCCCAAGGCAGG + Intronic
1163271705 19:16258526-16258548 CCACAGCCCCTGCCCAGGCCAGG + Intergenic
1163315631 19:16538779-16538801 CCACCCCCCCGCCCCAGAAAGGG + Intronic
1163869268 19:19804926-19804948 CCATCCCCCCACCCCATGACAGG - Intronic
1163976746 19:20859845-20859867 CCAGACCCCCACCCCCTGACAGG - Intronic
1164028698 19:21380424-21380446 CCACCCCCACTCCACAGGCCAGG - Intergenic
1164403359 19:27919031-27919053 CCACGCCTCCTCCCCAGGTGAGG + Intergenic
1164796088 19:31031824-31031846 CCAGACCCCCACCCCATAACAGG - Intergenic
1164965324 19:32478216-32478238 CCACAGGTCCTCCCCAGGTCGGG + Intronic
1164977137 19:32581546-32581568 CCACACCCCAACGCCAGGGCAGG - Intronic
1165070051 19:33249680-33249702 CCACACCCCCGCCCCAGATGGGG + Intergenic
1165073761 19:33269698-33269720 CCACACCCCATCCCAAGGCCAGG - Intergenic
1165154196 19:33777477-33777499 CCACACCCCCTCCCCGGCCCGGG - Intergenic
1165320696 19:35083592-35083614 TCCCAGGCCCTCCCCAGGACAGG - Intergenic
1165509279 19:36256835-36256857 CCCCACCCCCACCCCGCGACCGG - Intergenic
1165727419 19:38122892-38122914 GCACACCCCCTCCCCTGGCTTGG + Intronic
1165782447 19:38442262-38442284 CCACACTCCCTCCCCTAGTCTGG - Intronic
1165994226 19:39833254-39833276 CCCCACCCCCTACCCGGGTCAGG + Exonic
1166098425 19:40555997-40556019 CTAAACCCCCTCCCCAGGACAGG - Intronic
1166180684 19:41106012-41106034 CCAGGCCCCCACCCCACGACAGG - Intergenic
1166435445 19:42763459-42763481 CCACAACCCAGCCCCAGCACAGG + Intronic
1166445310 19:42853491-42853513 CCACAACCCAGCCCCAGTACAGG + Intronic
1166530453 19:43539985-43540007 CCCCACCCCCACCCCCTGACAGG - Intergenic
1166636296 19:44454485-44454507 CCCCAACCCCACCCCATGACAGG + Intergenic
1166647561 19:44543459-44543481 CCACACTCCCACCCCAGGCTTGG + Intergenic
1166705594 19:44906321-44906343 CCCCACCCCCTCCCCACCGCCGG - Intronic
1166827121 19:45616554-45616576 CCCCTCCCCCTCCCCCAGACGGG - Exonic
1166855451 19:45780849-45780871 CCCCTCCCCCGCCCCAGGCCTGG + Intronic
1167055995 19:47112088-47112110 CGGCGCCCCCTCCCCAGGACAGG + Intronic
1167383128 19:49149885-49149907 CCACTCCCCCTTCCCAGGGCGGG + Intronic
1167593835 19:50417537-50417559 CCTGGCCCCCTCCCCAGGGCGGG + Intronic
1167691134 19:50984085-50984107 CCACCCTCCCTCCGAAGGACGGG + Intronic
1167721438 19:51182803-51182825 TCTCCCTCCCTCCCCAGGACCGG - Intergenic
1167721916 19:51185309-51185331 CCCCAACCCCCTCCCAGGACAGG - Intergenic
1167729250 19:51241181-51241203 TCACCCTCCCTCCCCAGGATGGG - Intronic
1167763538 19:51463967-51463989 TCTCCCTCCCTCCCCAGGACCGG + Intergenic
1168713304 19:58513711-58513733 CCCCACCACCACCCCAGGAGAGG + Exonic
925286810 2:2721454-2721476 CCACACCCCAGCCACAGCACTGG + Intergenic
925869123 2:8253956-8253978 CCACCCCCCACCCCCAGGCCTGG + Intergenic
925920115 2:8632545-8632567 CCCGCCCCCCACCCCAGGACAGG + Intergenic
926498336 2:13619472-13619494 CCCTTCCCCCACCCCAGGACAGG - Intergenic
926929984 2:18027536-18027558 CCCCACCCCCTCCCGCCGACAGG + Intronic
927102757 2:19800468-19800490 CAGCACCCCCTGCCCATGACAGG + Intergenic
927221703 2:20716570-20716592 CCAACCCCCCACCCCACGACAGG - Intronic
927647413 2:24886776-24886798 CCCCTTCCCCTCCCCAGGGCAGG - Intronic
927681721 2:25144030-25144052 CCACCTCTCCTCCTCAGGACAGG + Intronic
928414265 2:31078693-31078715 CCACACCGCATGCTCAGGACAGG + Intronic
928598490 2:32880287-32880309 CCCCTCCCCCACCCCATGACAGG - Intergenic
929090293 2:38209957-38209979 CCAGCCCCCCACCCCATGACAGG - Intergenic
930255530 2:49085957-49085979 CCACTCCCCCCCCCCACAACAGG - Intronic
931059541 2:58511227-58511249 CCATGCCCCCACCCCACGACAGG - Intergenic
931204095 2:60130324-60130346 CCATCCCCCCACCCCATGACAGG + Intergenic
931517848 2:63059990-63060012 CCCCACCCCCACCCCCGGGCCGG + Intergenic
931699287 2:64896924-64896946 CCCTCCCCCCACCCCAGGACAGG - Intergenic
931835499 2:66094682-66094704 CCAGCTCCCCACCCCAGGACAGG + Intergenic
931885203 2:66609792-66609814 CCTGCCCCCCACCCCAGGACAGG + Intergenic
932699911 2:73985222-73985244 CCCCTCCCCCTCCCCCGGGCCGG - Intergenic
932783414 2:74578405-74578427 CCAAACCCCCACCCCATGACAGG + Intronic
933567214 2:83964962-83964984 CCCAACCCCCACCCCATGACAGG - Intergenic
934699461 2:96428189-96428211 ACCCACCCCCTCTCCTGGACTGG + Intergenic
934755096 2:96819167-96819189 CCAGGCTCCCTCCCCAGGGCAGG - Intronic
935050233 2:99518972-99518994 CCCCACCTCACCCCCAGGACTGG + Intergenic
935449389 2:103191108-103191130 CCACACCACCTCTCCAGCAAGGG + Intergenic
935471908 2:103470820-103470842 CCAAACCCCCACCCCCTGACAGG + Intergenic
936351183 2:111713741-111713763 CCACTCCCCCACCCCACGACAGG - Intergenic
936407833 2:112223102-112223124 CCACTCCCCCACCCCACGACAGG - Intronic
937055210 2:118928866-118928888 CCAGACCCCATCTCCAGCACTGG + Intergenic
937346774 2:121130958-121130980 CCACAAACCCTGCCCAGGACAGG - Intergenic
937390629 2:121482875-121482897 CCTCAAACTCTCCCCAGGACCGG + Intronic
937419513 2:121742138-121742160 CCCCATCCCCTCCCCATCACGGG + Intronic
937986875 2:127641946-127641968 CCACACTCCCAGCCCAGGGCGGG - Intronic
938020481 2:127902106-127902128 CCCTACCCCCACCCCACGACAGG - Intergenic
938150973 2:128882343-128882365 CCATCCCCCCACCCCAAGACAGG - Intergenic
938167588 2:129044535-129044557 CCAATCCCCCACCCCATGACAGG + Intergenic
938272755 2:129989649-129989671 CCATCCCCCCACCCCATGACAGG - Intergenic
938297630 2:130188310-130188332 CCACAGTCCCTCCGCAGGCCAGG - Intronic
938443480 2:131356469-131356491 CCATCCCCCCACCCCATGACAGG + Intergenic
938474098 2:131591463-131591485 CCCCACGCCCACCCCAGGAAGGG - Intergenic
938801650 2:134768927-134768949 CCAACCCCCCACCCCACGACAGG - Intergenic
939019402 2:136941003-136941025 CCAGCCCCCCACCCCATGACAGG + Intronic
939038940 2:137164873-137164895 CCTCTCCCCCACCCCACGACAGG - Intronic
939408245 2:141788686-141788708 CCCCACCCCCACCCCACAACAGG + Intronic
939724359 2:145697861-145697883 CCATTCCCCCACCCCACGACAGG - Intergenic
939934531 2:148274376-148274398 CCAGCCCCCCACCCCATGACAGG + Intronic
939947722 2:148429839-148429861 CCAGCCCCCCACCCCATGACAGG - Intronic
940257765 2:151749325-151749347 CCATCCCCCCACCCCACGACAGG - Intergenic
940580202 2:155570383-155570405 CCCCTCCCCCACCCCATGACAGG + Intergenic
940592997 2:155752859-155752881 CCACCCCCCCACCCCATGACAGG - Intergenic
941305039 2:163854015-163854037 CCAGACCCCCACCACATGACAGG + Intergenic
942047638 2:172109054-172109076 CCCCACCCCCGCCCCCTGACAGG - Intergenic
942108196 2:172654603-172654625 CCAGCCCCCCACCCCACGACAGG - Intergenic
942630523 2:177946488-177946510 CCCCACCTCCTTCCCGGGACGGG - Intronic
942640428 2:178055340-178055362 CCTCCCCCCCACCCCATGACAGG - Intronic
942929231 2:181469908-181469930 CCATCCCCCCACCCCACGACAGG - Intronic
943150674 2:184108157-184108179 CCCCACCCCCACCCCACGACAGG - Intergenic
943377574 2:187098858-187098880 CCCCTCCCCCACCCCACGACAGG + Intergenic
943379928 2:187132032-187132054 CTAGACCCCCACCCCTGGACAGG - Intergenic
943397444 2:187357496-187357518 CCTCACCCCCACCCCCCGACAGG - Intronic
943777356 2:191780950-191780972 CCAGACCCCCACCCCACAACAGG + Intergenic
944251518 2:197583775-197583797 CCACTCCCCCACCCCACGACAGG + Intronic
944393704 2:199246207-199246229 CCTCACCCCCACCCCAAGGCTGG + Intergenic
944701926 2:202253485-202253507 CCATCCCCCCACCCCAGGACAGG - Intergenic
945115862 2:206407355-206407377 CCAGCCTCCCACCCCAGGACAGG + Intergenic
945212739 2:207400500-207400522 CCCCAACCCCACCCCATGACAGG - Intergenic
945311823 2:208322843-208322865 CCCCTCCCCCACCCCATGACAGG + Intronic
945484535 2:210379506-210379528 CCCGACCCCCACCCCAAGACAGG - Intergenic
945518786 2:210797313-210797335 CCGAACCCCCTTTCCAGGACTGG + Intergenic
946045812 2:216820047-216820069 CCACACCCCCACTCCTGGAAAGG - Intergenic
946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG + Intronic
946929441 2:224657320-224657342 CCCCCCCCCCGCCCCAAGACAGG - Intergenic
947515991 2:230805243-230805265 CCACCCCGCCACCCCATGACAGG - Intronic
947731721 2:232435022-232435044 CCAGTTGCCCTCCCCAGGACAGG + Intergenic
947742125 2:232489501-232489523 CCCCACCCCACCCCCGGGACTGG - Intergenic
947787722 2:232838812-232838834 CCCCTCCCCCACCCCAGGGCAGG + Intronic
948092672 2:235307836-235307858 CCCCTCCCCCACCCCAAGACAGG - Intergenic
948196826 2:236103006-236103028 CCACCCCCCACCCCCAGGCCTGG + Intronic
948219477 2:236258215-236258237 CCACACTGCCTTCCCAGGAGTGG - Intronic
948808092 2:240461544-240461566 CCACACCCCCTGCCCAGCAGGGG + Intronic
948915444 2:241032477-241032499 CGACCCCCCCACCCCACGACAGG - Intronic
948945009 2:241215016-241215038 CCCCTCCCCCTCCCCAGGCAAGG - Intronic
1168838698 20:894991-895013 CCACACCCGCCCACCAGCACAGG + Intronic
1169264725 20:4160930-4160952 CCCCACCCCCTCCCCGGGGCTGG + Intronic
1169508831 20:6242453-6242475 CCCCACCCCTTCCCTGGGACAGG - Intergenic
1169880409 20:10341239-10341261 CCACCCCCCCTCCAGAGCACAGG - Intergenic
1171001350 20:21418928-21418950 CCACCCTCCCACCCCACGACAGG - Intergenic
1171257004 20:23696958-23696980 CCATACCCCCACCCCAGGACAGG - Intergenic
1171264359 20:23758817-23758839 CCACACCCCCACCCCATGACAGG - Intergenic
1171774873 20:29355771-29355793 CAACACCACCTCCCCAGCAAGGG + Intergenic
1172032607 20:31992439-31992461 GCTCACACGCTCCCCAGGACAGG - Intronic
1172055192 20:32149933-32149955 CCCCAGCCCCAGCCCAGGACTGG + Intronic
1172245724 20:33443790-33443812 CGAGGCCCCCTCCCCAGCACTGG - Exonic
1172781484 20:37439395-37439417 GCATACCCCCTCCCCGGGCCAGG + Intergenic
1173262342 20:41447756-41447778 TCCTACCCCCTGCCCAGGACCGG - Intronic
1173340821 20:42151305-42151327 CCCCACCCCCACCCCCTGACAGG + Intronic
1173482746 20:43416248-43416270 CCACTACCCCTCTCCAGCACCGG + Intergenic
1173654482 20:44690217-44690239 CCAAACTGCCTCCCCAGGACAGG + Intergenic
1174596254 20:51686209-51686231 CCACTCCCCCACGCCACGACAGG - Intronic
1175267236 20:57710101-57710123 CCGCACCCCCTCCCCGAGCCGGG + Intronic
1175307377 20:57985809-57985831 CCATCCCCCCACCCCACGACAGG + Intergenic
1175870610 20:62207860-62207882 CTACCACCCCTCCCCAGGAGTGG + Intergenic
1175903959 20:62370879-62370901 CCAGACCCCTCCCCCAGGCCTGG + Intergenic
1176146531 20:63567969-63567991 CACCACCACCTCCCCAGGCCGGG - Intronic
1176309069 21:5140246-5140268 CCTCACCCCACCCCCAGGCCTGG - Intronic
1176736731 21:10556190-10556212 CCATCCCCCCACCCCATGACAGG + Intronic
1176916111 21:14627120-14627142 CCCTACCCCCACCCCATGACAGG - Intronic
1176944324 21:14959809-14959831 CAACAGCACCTCCCCAGGACTGG + Intergenic
1177849350 21:26328161-26328183 CCATCCCCCCACCCCATGACAGG + Intergenic
1177886656 21:26755254-26755276 CCACTGCCCCACCCCAGGCCAGG - Intergenic
1178049680 21:28733868-28733890 CCCCACCCCCTTCCCAGCAACGG + Intergenic
1178107612 21:29337692-29337714 CCACTCCCCCACCCGACGACAGG - Intronic
1178229435 21:30764400-30764422 CCAGCCCACCTCCCCAGAACAGG + Intergenic
1178690076 21:34743267-34743289 CCACATCCCCTACCCACAACAGG + Intergenic
1179581365 21:42346666-42346688 TTACACCCCCTCCCCGGGAAAGG - Intronic
1179603853 21:42499398-42499420 CCACTCCCACGCCCCAGGAAAGG - Intronic
1179615451 21:42580370-42580392 CCAGACCCCCTCCACGGGACTGG - Exonic
1179615989 21:42583760-42583782 CTCCACCACCTCCCCAGGAGGGG - Intergenic
1179847992 21:44121787-44121809 CCTCACCCCACCCCCAGGCCTGG + Intronic
1179873555 21:44255963-44255985 CCCCACCCCCTCCCCTAGACCGG - Intronic
1179888166 21:44323325-44323347 CCCCTGCCCCTCCCCAGCACTGG - Intronic
1179924725 21:44528209-44528231 CCACAGGCCCTCCTCAGGGCAGG - Intronic
1180183982 21:46130480-46130502 CCACACCCACTGCACAGGGCAGG + Intronic
1180474440 22:15689845-15689867 CCCCACGCCCACCCCAGGAAGGG - Intergenic
1180562719 22:16633650-16633672 CCATCCCCCCACCCCATGACAGG + Intergenic
1180656639 22:17427008-17427030 CCAGCCCCCCACCCCACGACAGG + Intronic
1180840220 22:18955567-18955589 CCACACCTGCTCACCAGGCCTGG + Intergenic
1181061657 22:20284799-20284821 CCACACCTGCTCACCAGGCCTGG - Intergenic
1181335490 22:22125165-22125187 CCACAACCCGTCCCCACCACAGG - Intergenic
1181342492 22:22193807-22193829 CCCTACCCCCACCCCACGACAGG - Intergenic
1181806881 22:25380290-25380312 CCACACCCCCTGCCTAGGCCAGG + Intronic
1182121015 22:27786758-27786780 TCCCACCACCTCCTCAGGACAGG - Intronic
1182131413 22:27855605-27855627 CCTCACCCCCACCCCGGAACCGG + Intronic
1182904470 22:33922904-33922926 CCCTACCCCCTCCCCGGAACCGG + Intergenic
1183148878 22:36021239-36021261 CCCTCCCCCCACCCCAGGACAGG - Intronic
1183197169 22:36361416-36361438 CCACAGGCCCTCCCTTGGACAGG - Intronic
1183279165 22:36922952-36922974 CCCTCCCCCCACCCCAGGACAGG - Intronic
1183309425 22:37101423-37101445 CCACACCCTCTCCTCGGGCCAGG + Intronic
1183456560 22:37926095-37926117 CCACACCCCCTCCCCAGGCCCGG - Intronic
1183532404 22:38366486-38366508 CCATCCCCCCACCCCATGACAGG - Intronic
1183665410 22:39243574-39243596 CCACCCCCTCTCCCCCGGCCGGG + Intronic
1183698469 22:39436676-39436698 CCCCGCCCCCTCCCCGGGACTGG + Intronic
1183734496 22:39636338-39636360 CCCCATCCCCGCCCCAGGAAGGG + Intronic
1183750770 22:39719185-39719207 TCACACTCCCTGCCCAGGGCGGG + Intergenic
1183830918 22:40418011-40418033 CCACAGCCTCTCCCCGGGGCAGG + Intronic
1184072263 22:42153348-42153370 CCCCATCCCCGCCCCAGGATCGG - Intergenic
1184453816 22:44598025-44598047 CCAGAACCTCCCCCCAGGACTGG + Intergenic
1184550567 22:45202331-45202353 CCACTCTCCTTCCCCAGGGCGGG - Intronic
1184555642 22:45231533-45231555 CACCACCCCCTCCCCAGGGAGGG + Intronic
1184896580 22:47410784-47410806 GCACACCCCATCCCCTAGACAGG - Intergenic
1185139427 22:49092121-49092143 CCACGCCCCATCCCCAGGTCTGG - Intergenic
1185295862 22:50054425-50054447 GCACTCTCCCTCCCCAGGAGAGG - Intronic
949248737 3:1957421-1957443 CTATTCCCCCACCCCAGGACAGG + Intergenic
949450563 3:4180536-4180558 CCAGCCCCCCACCCCATGACAGG - Intronic
949574702 3:5327680-5327702 CCCTCCCCCCACCCCAGGACAGG + Intergenic
950496865 3:13339055-13339077 CCCTACCCCATCCCCAGGACAGG + Intronic
950754807 3:15163071-15163093 CCCCAACCTCTCTCCAGGACGGG + Intergenic
950862189 3:16159020-16159042 CCAGGCCCCCACCCCATGACAGG + Intergenic
950937402 3:16853738-16853760 CTACTCCCCCTCCCCACCACAGG + Intronic
950947419 3:16964170-16964192 CCCTCCCCCCTCCCCACGACAGG + Intronic
951053197 3:18118175-18118197 CGTTACCCCCACCCCAGGACAGG - Intronic
951189841 3:19755410-19755432 CCAGCCCCCCACCCCACGACAGG + Intergenic
951424951 3:22533397-22533419 CCATCCCCCCACCCCACGACAGG - Intergenic
951461192 3:22953557-22953579 CCATACCCCCACCCCACAACAGG + Intergenic
952146627 3:30540301-30540323 CCCTACCCCCACCCCACGACAGG + Intergenic
952415881 3:33091450-33091472 CCACTCACATTCCCCAGGACTGG + Exonic
952670238 3:35958169-35958191 CCCCACCCCCACCCCACAACAGG + Intergenic
952939296 3:38429704-38429726 CCAGGCCCCCACCCCATGACAGG + Intergenic
953091415 3:39730121-39730143 CCTCACCCCCACCCCACAACAGG + Intergenic
953300099 3:41765401-41765423 CCACTCCCCCACCCCATGACAGG - Intronic
953314540 3:41913955-41913977 CCGCACCCCCTCCCGGAGACGGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953387330 3:42514015-42514037 CCACATTCCCACCCCAGGTCTGG + Intronic
953586737 3:44207860-44207882 CCAGAACCTCTCCCTAGGACAGG + Intergenic
953771228 3:45779922-45779944 CCACACCCCCTTCCCCGAGCGGG + Intronic
953913734 3:46905428-46905450 CCCCACCCACACCCCAGGACAGG + Intergenic
953927006 3:46987775-46987797 CCACAAGCCCCACCCAGGACAGG + Intronic
954258083 3:49420005-49420027 CAAGACCCCCTCCCCATGCCTGG + Intronic
954349552 3:50031574-50031596 CCCCTCCCCCACCCCACGACAGG - Intronic
954460806 3:50625898-50625920 CCCCACCCCCACCCCAGGGGAGG + Intronic
954480510 3:50796019-50796041 CCACACCACCTCTCCAGAAAGGG - Intronic
954488988 3:50883110-50883132 CCATTCCCCCACCCCACGACAGG - Intronic
954675266 3:52312000-52312022 CCAAGCTCCCTCCCCAGGGCAGG + Intergenic
954828513 3:53397559-53397581 CCCTACCCCCAGCCCAGGACAGG + Intergenic
955699166 3:61666398-61666420 CCACACACCCTTCCCAGAAGGGG - Intronic
955895973 3:63700219-63700241 CCTGGCCCCCACCCCAGGACAGG - Intergenic
956048030 3:65217440-65217462 CCCAACCCCCACCCCACGACAGG + Intergenic
956051853 3:65256671-65256693 CCACCCCCCTTCCCCAGCCCAGG + Intergenic
956568137 3:70662667-70662689 CCCTGCCCCCACCCCAGGACAGG - Intergenic
956778462 3:72586085-72586107 CCACCCCCACTCCCCAGGCTGGG - Intergenic
956847150 3:73193943-73193965 CCATCCCCCCACCCCACGACAGG + Intergenic
956938994 3:74135703-74135725 TTACACACCCTCCCCAGTACAGG + Intergenic
957997569 3:87709682-87709704 CCATACCCCCACCCCATGACAGG - Intergenic
958061934 3:88494892-88494914 CCATCCCCCCACCCCAGGACAGG + Intergenic
958191242 3:90187801-90187823 CCAGCTCCCCACCCCAGGACAGG + Intergenic
959165678 3:102775372-102775394 CCATACACCCTTCCCAGGAAGGG + Intergenic
959778536 3:110200140-110200162 CCACACCACCTCCCCAGCAAGGG + Intergenic
960565678 3:119129152-119129174 CCTCACCCCCACCCCACAACAGG - Intronic
960744765 3:120874804-120874826 CCCTACCCCCACCCCACGACAGG - Intergenic
961018209 3:123483175-123483197 CCAAGCCCCCTCCCCAGGGCTGG - Intergenic
961815089 3:129545592-129545614 CCACCCCCACTCCCCAGCCCTGG + Intronic
962056340 3:131875674-131875696 CCCTCCCCCCACCCCAGGACAGG - Intronic
962127372 3:132634898-132634920 CCACCCCCCCACCCCACAACAGG - Intronic
962226464 3:133614820-133614842 CCCTCCCCCCACCCCAGGACAGG - Intronic
962601378 3:136993568-136993590 CCCAACCCCCACCCCATGACCGG + Intronic
962767277 3:138577188-138577210 CCATCCCCCCACCCCACGACAGG - Intronic
962861838 3:139410574-139410596 CCAGCCCCCCACCCCATGACAGG - Intergenic
963173396 3:142274064-142274086 CCAGCCCCCCACCCCACGACAGG + Intergenic
963580792 3:147124345-147124367 CCATTCCCCCACCCCATGACAGG + Intergenic
964199755 3:154105756-154105778 CCCCACCCCATCCCTGGGACTGG - Intergenic
964500784 3:157346022-157346044 CCCCTCCCCCACCCCACGACAGG - Intronic
964581155 3:158239567-158239589 CCAGCCCCCCACCCCATGACAGG - Intronic
965818385 3:172660123-172660145 CCCTCCCCCCTCCCCACGACAGG + Intronic
965966306 3:174494467-174494489 CCCTCCCCCCACCCCAGGACAGG - Intronic
966150942 3:176867254-176867276 CCCTACCCCCACCCCATGACAGG - Intergenic
966460166 3:180167591-180167613 CCACTCTCCCACCCCATGACAGG - Intergenic
966879354 3:184341258-184341280 CCACACCTTCTCCCCACGTCTGG - Intronic
967251219 3:187541236-187541258 CCATCCCCCCACCCCACGACAGG - Intergenic
967452776 3:189645653-189645675 CCACTCCCCCACCCCACGACAGG + Intronic
967748476 3:193086463-193086485 CCCCTCCCCCACCCCATGACAGG + Intergenic
967966114 3:194961341-194961363 CCATACCTCCACCCCTGGACGGG - Intergenic
968089915 3:195893339-195893361 CCTCACCCCCTCCCCTGGGGTGG + Intronic
968230815 3:197003512-197003534 CCCCACCCCCACCCCAGAGCGGG - Intronic
968358904 3:198132951-198132973 CAACACCACCTCCCCAGCAAGGG - Intergenic
968503054 4:960093-960115 CCACACCTGCTGCCCAGGGCGGG + Exonic
968649869 4:1756268-1756290 CTGCACCCCCACCCCAGGAGGGG + Intergenic
968662911 4:1806180-1806202 CCACCCCCGCACCCCAGGGCCGG - Intronic
968684540 4:1948539-1948561 CCACACCCCCTCCCAGCCACCGG - Intronic
968823570 4:2875962-2875984 CCACAGCCCCTCACAAGGAGAGG + Exonic
968899722 4:3425630-3425652 ACTCACCCCCTCCCCTGCACCGG - Intronic
968899960 4:3426291-3426313 ACTCACCCCCTCCCCTGCACTGG - Intronic
969110533 4:4841426-4841448 CCCCACACCCTCCCTAGTACCGG + Intergenic
969327183 4:6450784-6450806 CCCCACCCCCTACCCAGGTATGG - Intronic
969572900 4:8020431-8020453 CCACACTCCTTCCCCTGGGCAGG - Intronic
969587543 4:8103150-8103172 CCACACCCCTACCCCAGGGCTGG - Intronic
969666062 4:8558182-8558204 GCCCACCCTGTCCCCAGGACTGG + Intergenic
970316292 4:14831443-14831465 GCACACCCCCTGCCCATGCCTGG - Intergenic
970487697 4:16541170-16541192 CCACACCCCACCTCCAGTACTGG - Intronic
970796136 4:19915822-19915844 CCGCCCCCCCACCCCATGACAGG + Intergenic
971322745 4:25618471-25618493 CCGCAGCCCCTCCCCAGGCCTGG - Intergenic
971568564 4:28178790-28178812 CCACTCCCCCACTCCACGACAGG - Intergenic
972109297 4:35536258-35536280 CCACTTCCCCACCCCAGGACAGG + Intergenic
972142875 4:35983022-35983044 CCACACCAGCTCCCCAGCAATGG + Intronic
972864226 4:43210462-43210484 CCCCACCCCCACCCCACGACAGG - Intergenic
973132930 4:46671073-46671095 CCATACCCCCACCCCACGACAGG + Intergenic
974140908 4:57885704-57885726 CCATCCCCCCACCCCACGACAGG + Intergenic
974205069 4:58691266-58691288 CCATCCCCCCACCCCACGACAGG - Intergenic
974264376 4:59565456-59565478 CCAGCCCCCCGCCCCATGACAGG + Intergenic
974288343 4:59897963-59897985 CCCCACCCCAAACCCAGGACAGG - Intergenic
975057774 4:69956996-69957018 CCCTACCCCCACCCCACGACAGG - Intronic
975132338 4:70842024-70842046 CCACACCCCCTCTCCCAGCCAGG - Intergenic
975522993 4:75320146-75320168 CCTCTCCCCCACCCCACGACAGG - Intergenic
976079969 4:81345138-81345160 CCCTACCCCCACCCCATGACAGG - Intergenic
976120673 4:81777731-81777753 TCACTCCACCTCCCCCGGACAGG + Intronic
976127280 4:81847453-81847475 CCACATCTCCTCCTCAGGACTGG + Intronic
976450834 4:85189162-85189184 CCAGCCCCCCACCCCACGACAGG + Intergenic
976555419 4:86445412-86445434 CTACTCTCCCTCCCCATGACAGG - Intronic
976595008 4:86887106-86887128 CCATACCCCCACCCCACAACAGG - Exonic
976790801 4:88876134-88876156 CCAGCCCCCCATCCCAGGACAGG - Intronic
977043788 4:92044915-92044937 CCACACCCCCGCCCCAACAGTGG - Intergenic
977127260 4:93185894-93185916 CCTGACCCCCACCCCATGACAGG + Intronic
977160700 4:93631363-93631385 CCACTCCCCGACCCTAGGACAGG + Intronic
977221949 4:94348042-94348064 CCATTCCCCCACCCCACGACAGG - Intergenic
977457905 4:97284587-97284609 CCCCGCCCCCACCCCATGACAGG - Intronic
977857298 4:101909385-101909407 CCCTACCCCCACCCCACGACAGG - Intronic
978046349 4:104134066-104134088 CCAGCCCCCCACCCCATGACAGG + Intergenic
978142306 4:105331791-105331813 CCAGACCCCCACCCCACAACAGG - Intergenic
978242653 4:106535261-106535283 CCAGACCCCCACCCCACAACAGG + Intergenic
978325335 4:107547492-107547514 CCCCACCCCCACCCCCCGACAGG + Intergenic
978680168 4:111370361-111370383 CCCCACCCCCACCCCAAAACAGG - Intergenic
978692388 4:111529613-111529635 CCAGACACCCTCATCAGGACTGG - Intergenic
979018466 4:115464966-115464988 CCATCCCCCCACCCCATGACAGG + Intergenic
979117685 4:116848548-116848570 CCCTACCCCCACCCCACGACAGG + Intergenic
979208745 4:118075049-118075071 CCATCCCCCCACCCCATGACAGG + Intronic
979497126 4:121395996-121396018 CCAGCCCCCCACCCCATGACAGG - Intergenic
979563519 4:122127584-122127606 CCAGCCCCCCACCCCACGACAGG + Intergenic
980559488 4:134454272-134454294 CCATCCCCCCACCCCATGACAGG - Intergenic
980692217 4:136310227-136310249 CCATACCCCCACCACAAGACAGG + Intergenic
980756738 4:137173871-137173893 CCCCACCCCCACCCCTTGACTGG - Intergenic
981086096 4:140685585-140685607 CCCCACCCCCACTCCAGTACAGG - Intronic
981293981 4:143108618-143108640 CCCTACCCCCACCCCATGACAGG - Intergenic
981483074 4:145257579-145257601 CCATTCCCCCACCCCACGACAGG + Intergenic
981560412 4:146042409-146042431 CCACTCCCCCACCCCATGACAGG + Intergenic
981848639 4:149201017-149201039 CCTTGCCTCCTCCCCAGGACTGG - Intergenic
981986393 4:150862522-150862544 CCTCTCCCCCACCCCATGACAGG - Intronic
982077183 4:151749503-151749525 CCCCACCCCCACCCCACAACAGG - Intronic
982166064 4:152614562-152614584 CCTCACACCCTCCCCAGGGCAGG + Intergenic
982251740 4:153414010-153414032 CCACCCCCTCTCCCTAGTACTGG + Intronic
982620930 4:157703863-157703885 CCCTACCCCCACCCCACGACAGG - Intergenic
982889106 4:160824055-160824077 CCCCTCCCCCACCCCATGACAGG - Intergenic
983717991 4:170809229-170809251 CCCAACCCCCACCCCAAGACAGG + Intergenic
983785034 4:171719430-171719452 CCACACTCGCTCCCCAGAAATGG + Intergenic
984165053 4:176296355-176296377 ACCCACCCCCGACCCAGGACTGG - Intergenic
984592009 4:181627483-181627505 CCCTACCCCCACCCCATGACAGG + Intergenic
984665239 4:182419863-182419885 CCCCTCCCCCACCCCACGACAGG - Intronic
985039848 4:185879167-185879189 CCCCCCCCCCACCCCACGACAGG + Intronic
986625861 5:9723480-9723502 CCACACCTGTTCCCCATGACTGG + Intergenic
987073684 5:14360695-14360717 CCAAAACCACTCCCCAGGGCAGG - Intronic
987076018 5:14382506-14382528 CCACACCCCCACCCTGGGCCGGG - Intronic
987152167 5:15054119-15054141 CAACACCCCCCTCTCAGGACTGG - Intergenic
987663797 5:20909084-20909106 CCAGACCCCACCTCCAGGACTGG + Intergenic
987847517 5:23305273-23305295 ACAGACCCCCTCTCCAGGCCTGG + Intergenic
987973114 5:24976853-24976875 CCACTCCCCCAACCCACGACAGG + Intergenic
988011463 5:25492671-25492693 CCACCCCCCCACCCCACGAGAGG + Intergenic
988048356 5:25990065-25990087 CCACATCCCCACCCCACCACAGG + Intergenic
988059458 5:26148680-26148702 CCCCACCCCCTCCCCACTGCTGG - Intergenic
988187301 5:27884037-27884059 CCATCCCCCCACCCCATGACAGG + Intergenic
988235262 5:28535846-28535868 CCCCACCCCAACCCCACGACAGG + Intergenic
988312292 5:29575834-29575856 CCCTCCCCCCTCCCCACGACAGG - Intergenic
988758887 5:34293111-34293133 CCAGACCCCACCTCCAGGACTGG - Intergenic
989402936 5:41028031-41028053 CCATCCCCCCACCCCACGACGGG - Intronic
989503879 5:42202909-42202931 CCCCACCCCTACCCCACGACAGG + Intergenic
989517416 5:42359494-42359516 CCAGACCCCCCCACCACGACAGG - Intergenic
990244278 5:53848525-53848547 CCCTACCCCCACCCCATGACAGG + Intergenic
990704856 5:58516257-58516279 CCACAACACCTCCCCAGCAAGGG + Intergenic
990859831 5:60314634-60314656 CCACACCCCCACCCCACAACAGG + Intronic
990956408 5:61344524-61344546 CCTCACCCCATCCCCAAGAAAGG - Intronic
991143327 5:63272801-63272823 CCACATCACCTCTCCAGCACAGG - Intergenic
991388078 5:66111912-66111934 CCATGCCCCCACCCCACGACAGG - Intergenic
991543282 5:67752797-67752819 CCACACTACCTCCCCAGTAATGG + Intergenic
991553197 5:67866143-67866165 CCATCCCCCCACCCCATGACAGG + Intergenic
991684300 5:69167439-69167461 CCACACTCTCTCACCAGGCCTGG - Intronic
992274074 5:75096810-75096832 CCCCACCCCCACCCCATGACAGG + Intronic
992385538 5:76280734-76280756 CCACACCCCCACACCCGGGCAGG - Intronic
992513686 5:77469235-77469257 CCCTACCCCCACCCCACGACAGG - Intronic
992972746 5:82079513-82079535 CCAATCCCCCACCCCACGACAGG + Intronic
993024749 5:82632481-82632503 CCACTCCCCCACCCCATGACAGG + Intergenic
993170969 5:84418732-84418754 CCTTCCCCCCTCCCCATGACAGG + Intergenic
994408931 5:99382042-99382064 CCATGCCCCCACCCCATGACAGG + Intergenic
994996110 5:107065320-107065342 CCATCCCCCCACCCCAAGACAGG + Intergenic
995684813 5:114760766-114760788 CCTCACCCCCACCCCACAACAGG + Intergenic
995971122 5:117973019-117973041 CCAGACCCCATCTCCAGCACTGG + Intergenic
996075418 5:119186918-119186940 CCATCCCCCCACCCCACGACAGG - Intronic
996175656 5:120353047-120353069 CCCCACCCCCACCCCACAACAGG - Intergenic
996261032 5:121468554-121468576 CCATACCCCCACCCCACAACAGG - Intergenic
996547368 5:124694718-124694740 CCCCTCCCCCACCCCATGACAGG + Intronic
997006217 5:129819471-129819493 CCATCCCCCCACCCCAGAACAGG - Intergenic
997094565 5:130896238-130896260 CCAGTCCCCCACCCCATGACAGG - Intergenic
997116294 5:131128996-131129018 CCCTACCCCCACCCCATGACAGG - Intergenic
997210486 5:132074160-132074182 CCCCACCTCCACCCCAGGGCAGG - Intronic
997229811 5:132234141-132234163 CCACTCCCCTTCCCCAAAACAGG - Intronic
997233382 5:132258937-132258959 GCCCACCCCCTCCCAAGAACTGG - Intronic
997239183 5:132294367-132294389 CCACACCCCCATCCCCGGCCGGG - Intronic
997582265 5:135025362-135025384 CCACACCCCCACCCCACCCCAGG - Intergenic
998254776 5:140576394-140576416 CTCCAACCCCTCCCCAGCACAGG + Intronic
998907456 5:146921762-146921784 CCACACCTCCTCCCCTAGAAAGG + Intronic
999820886 5:155227125-155227147 CGACACCCCCACCCCACAACAGG - Intergenic
1000378589 5:160608076-160608098 CCATCCCCCCACCCCACGACAGG + Intronic
1000423890 5:161068328-161068350 CCTGCCCCCCACCCCAGGACAGG + Intergenic
1000596215 5:163217959-163217981 CCATCCCCCCACCCCACGACAGG - Intergenic
1001285889 5:170423788-170423810 CCTCACCCCCTCCCCTCCACAGG + Intronic
1001405785 5:171476395-171476417 CCATCCCCCCACCCCACGACAGG + Intergenic
1001430296 5:171655611-171655633 CCCCACCCCCACCCCACAACAGG - Intergenic
1001637993 5:173226475-173226497 CCTCACCCCCTGCCCCTGACTGG - Intergenic
1001852434 5:174981139-174981161 GCACGCCCCCACCCCAGGGCTGG + Intergenic
1002193276 5:177489757-177489779 CCACTCCCTCTCACCAGGCCAGG + Exonic
1002541457 5:179908721-179908743 CCAGACCCCATCCCCAGGGCCGG - Intergenic
1002640130 5:180626811-180626833 CCACACCCCGCCCCCAGGCCTGG + Intronic
1002741897 5:181440215-181440237 CCACAAAGCCTCCCCAGGGCTGG - Intergenic
1003399434 6:5779610-5779632 CCAGCCCCCCACCCCACGACAGG + Intergenic
1003531941 6:6944494-6944516 CCATCCCCCCACCCCACGACAGG + Intergenic
1003699311 6:8444571-8444593 CCAATCCCCCACCCCAGGACAGG + Intergenic
1003793372 6:9572768-9572790 CCATCCCCCCACCCCATGACAGG - Intergenic
1004056611 6:12145361-12145383 CCAGGCCCCCACCCCATGACAGG - Intronic
1004282174 6:14289512-14289534 CCCGACCCCCACCCCATGACAGG - Intergenic
1004465042 6:15877151-15877173 CTAGACCCCCACCCCACGACAGG - Intergenic
1005182336 6:23120116-23120138 CCAATCCCCCACCCCAGGACAGG + Intergenic
1005184805 6:23153396-23153418 CCATCCCCCCACCCCACGACAGG - Intergenic
1005222072 6:23598227-23598249 CCCCTCCCCCACCCCAGGACAGG - Intergenic
1005322786 6:24671455-24671477 CCATCCCCCCACCCCACGACAGG - Intronic
1005455539 6:26016586-26016608 CCACGCCCTCTCCACAGGAGTGG - Intergenic
1005828611 6:29652301-29652323 CCTCCCAGCCTCCCCAGGACTGG + Intergenic
1005953230 6:30646559-30646581 CCCCACCCACTGTCCAGGACTGG - Exonic
1006021690 6:31121264-31121286 TCACAGCCCCTCCCCATGGCTGG + Intronic
1006406750 6:33849960-33849982 CCACCCCCTCTCCCCAGGGCAGG - Intergenic
1006436402 6:34027993-34028015 CCCCGCCGCCTCCCCAGGATGGG + Intronic
1006455876 6:34131613-34131635 CCTCACCCCCACCCCAACACTGG + Intronic
1006594479 6:35182612-35182634 CCGCACCTCCTCCCCAGCTCGGG + Intergenic
1006617051 6:35336745-35336767 CCAGCCCCCCACCCCATGACAGG + Intergenic
1007363769 6:41375820-41375842 TCACACCCCCTCCCCAGGCCTGG - Intergenic
1007371363 6:41428453-41428475 CCACACCCCCACCCCAGGGCTGG + Intergenic
1007397390 6:41585548-41585570 CCTCACCCCCTGCCCAGAGCTGG + Intronic
1007399382 6:41595095-41595117 CCACACCCCTTCCCCCAGCCAGG - Intronic
1007421668 6:41723531-41723553 CCGCACCCCAGCCCCAGGGCCGG + Intronic
1007498161 6:42276131-42276153 CCACACCCCACCCCCTGGCCTGG + Intronic
1007577157 6:42932594-42932616 TCCCACGCCCTCCCCAGGAGTGG - Intronic
1007704648 6:43783379-43783401 CCACACCAACTACCCAGGCCTGG - Intronic
1008363003 6:50643770-50643792 CCAGTCCCCCACCCCATGACAGG + Intergenic
1008371667 6:50739219-50739241 CCCTACCCCCACCCCACGACAGG + Intronic
1008398822 6:51039940-51039962 CCATCCCCCCACCCCATGACAGG + Intergenic
1008552601 6:52647220-52647242 CCACAGCACCAACCCAGGACAGG - Intergenic
1008786122 6:55170730-55170752 CCCCTCCCCCACCCCACGACAGG + Intronic
1009340450 6:62547849-62547871 CCATACCCCCACCCCACAACAGG - Intergenic
1009500540 6:64407291-64407313 CCAGCCCCCCACCCCATGACAGG - Intronic
1009689990 6:67018277-67018299 CCACCCCCCCACCCCACAACAGG + Intergenic
1010467494 6:76186261-76186283 CCAGCCCCCCACCCCACGACAGG + Intergenic
1010512510 6:76737911-76737933 CCATCCCCCGACCCCAGGACAGG - Intergenic
1010683313 6:78821693-78821715 CCCTACCCCCACCCCATGACAGG - Intergenic
1010688488 6:78879193-78879215 CCCTACCCCCACCCCAAGACAGG - Intronic
1010692352 6:78925162-78925184 CCATACCCCCACCCCAAAACAGG - Intronic
1011051277 6:83152911-83152933 CCTCCACCCCTCCCCAGGCCGGG - Intronic
1011241281 6:85273920-85273942 CCACCCCCCCTTCCCAGTCCTGG + Intergenic
1011242411 6:85286942-85286964 CCCCACCCCCACCCCACGACAGG + Intergenic
1011304353 6:85910131-85910153 CCATGCTCCCACCCCAGGACAGG - Intergenic
1011380520 6:86737863-86737885 CCACTCCCCCACCCCACAACAGG - Intergenic
1011521209 6:88208948-88208970 CCACACTCCCTCCCCACGATGGG + Intergenic
1012012286 6:93804827-93804849 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1012117551 6:95322407-95322429 CCACACCCCCACCCCACGACAGG + Intergenic
1012411035 6:98957293-98957315 CAACACCCCCACCCCCTGACAGG - Intergenic
1012494162 6:99815791-99815813 CCACCCCCCCACCCCACGACAGG - Intergenic
1012648217 6:101716593-101716615 CCCTCCCCCCACCCCAGGACAGG - Intronic
1013386685 6:109638799-109638821 CCAGATCCCCACCCCACGACAGG + Intronic
1013869789 6:114743162-114743184 CCACTCCCCCTCCACACAACAGG + Intergenic
1013900294 6:115147491-115147513 CCATCCCCCCACCCCACGACAGG - Intergenic
1013933835 6:115569686-115569708 CCATTCCCCCACCCCACGACAGG + Intergenic
1014133722 6:117864217-117864239 CCCTACCCCCACCCCATGACAGG + Intergenic
1014332330 6:120085510-120085532 CCCTGCCCCCTCCCCATGACAGG + Intergenic
1014785209 6:125610943-125610965 CAATACCCCCACCCCACGACAGG - Intergenic
1014826202 6:126051032-126051054 CCACGCCCCAGCCCCAGGGCAGG - Intergenic
1014913188 6:127118125-127118147 CCCCACCCCATCCCCAGCGCCGG - Intergenic
1015129302 6:129792132-129792154 CCCCACCCCCGCCCCAGCACAGG + Intergenic
1015418665 6:132981245-132981267 CCAGCCCCCCACCCCACGACAGG + Intergenic
1015967165 6:138706070-138706092 CCAGCCCCCCACCCCATGACAGG + Intergenic
1016022371 6:139249606-139249628 TCACACCCACACCCCAAGACTGG - Intronic
1016357588 6:143234972-143234994 CTCCACCCCCGCCCCAGGAAGGG - Intronic
1016380073 6:143468805-143468827 CCCCCCCCCCACCCCACGACAGG + Intronic
1016425520 6:143932686-143932708 CCACACCAGCTCCCCAGCAATGG - Intronic
1017058735 6:150460919-150460941 CCATCCCCCCACCCCACGACAGG + Intergenic
1017207871 6:151823619-151823641 CCCTACCCCCACCCCACGACAGG + Intronic
1017720615 6:157240905-157240927 CCTCCCTCCCTCCCCAGGGCTGG - Intergenic
1018715900 6:166532587-166532609 TCACAGCCCCTCCCCAGGTGGGG + Intronic
1018795715 6:167184125-167184147 CCCTCCCCCCTCCCCACGACAGG + Intronic
1018820601 6:167370934-167370956 CCCTCCCCCCTCCCCACGACAGG - Intronic
1019247038 6:170715972-170715994 CCACAAAGCCTCCCCAGGGCTGG - Intergenic
1019351290 7:555208-555230 CCTCAGCCCCTCCCCAGAGCGGG - Intronic
1019425713 7:975639-975661 CCCCACCCCTTGCCCAGGCCCGG + Intergenic
1019437528 7:1029733-1029755 CCACACCATCTCCCCAGGCAGGG - Intronic
1019527934 7:1489140-1489162 CCACACCCCCTCTCCCGGCAAGG + Intronic
1019660844 7:2223294-2223316 CCAGACCCACCCCCCACGACTGG + Intronic
1019737832 7:2659312-2659334 CCACTCTCCTTCCCCAGGAAAGG - Intronic
1019816205 7:3202560-3202582 CCACACCCCTTCCCCCATACTGG + Intergenic
1019921853 7:4168217-4168239 CTGGACCCCCTCCCCAGGCCTGG + Intronic
1020083166 7:5297133-5297155 CCATAGCCCCTGCCCAGGCCTGG - Exonic
1020382142 7:7558066-7558088 CCACACCACCTCTCCAGCAAGGG + Intergenic
1021307717 7:19051720-19051742 CCACTCCCCCACCCCAAGACAGG - Intronic
1021313082 7:19116679-19116701 CCCCACCCCCTCAGCAGGGCCGG - Exonic
1021802028 7:24316763-24316785 CCAGCCCCCCTGCCCAGGAAAGG + Intergenic
1021824775 7:24538663-24538685 CCCTACCCCCACCCCACGACAGG - Intergenic
1022128210 7:27378334-27378356 CCACACCCCCTCCCGAGTCTGGG - Intergenic
1022497169 7:30860476-30860498 CACCACCTTCTCCCCAGGACTGG + Intronic
1022558474 7:31324876-31324898 CCCTACCCCCACCCCACGACAGG - Intergenic
1022569613 7:31438871-31438893 CCCCACCCCTACTCCAGGACTGG + Intergenic
1022844640 7:34197610-34197632 CCTCCTCCCCTCCCCATGACAGG - Intergenic
1023213971 7:37841019-37841041 ACACTCTCCCACCCCAGGACAGG + Intronic
1023868838 7:44252025-44252047 CCACAGCCCCTCCCCGTGGCGGG - Intronic
1024350739 7:48360187-48360209 CCCCTCCCCCACCCCATGACAGG + Intronic
1024477633 7:49830666-49830688 CCACCCCCTCACCCCACGACAGG + Intronic
1025211117 7:57020054-57020076 CCAGAGCCCCTGCCCAGGCCTGG + Intergenic
1025660838 7:63556793-63556815 CCAGAGCCCCTGCCCAGGCCTGG - Intergenic
1025739892 7:64185943-64185965 CCTTACCCCCACCCCACGACAGG + Intronic
1026875786 7:73878384-73878406 CCACCCCTGGTCCCCAGGACCGG + Intergenic
1027336317 7:77154453-77154475 CCCCTCCCCCACCCCATGACAGG + Intronic
1027468107 7:78540259-78540281 CCACACCCCATCCCCAACAGTGG - Intronic
1027636780 7:80686090-80686112 CCATGCCCCCACCCCACGACAGG - Intergenic
1027686617 7:81286451-81286473 CCATCCCCCCACCCCATGACAGG - Intergenic
1027727316 7:81824226-81824248 CCAGCCCCCCACCCCATGACAGG + Intergenic
1028015539 7:85706557-85706579 CCACTCCCCCACCCCATGACAGG + Intergenic
1028336805 7:89668004-89668026 CCACACCACCTCTCCAGCAAGGG + Intergenic
1028394974 7:90359293-90359315 CCAGACCCCCACCCCCTGACAGG + Intronic
1028432520 7:90763658-90763680 CCATCCCCCCACCCCACGACAGG - Intronic
1029132168 7:98339907-98339929 CCACCCCCCCTCGCCATGACAGG + Intronic
1029456722 7:100675508-100675530 CCTCCCGCCCTCCCCAGAACCGG - Intronic
1029779471 7:102716648-102716670 CCCCTCCCCCACCCCATGACAGG - Intergenic
1030030381 7:105364027-105364049 CCAGCCCCCCACCCCACGACAGG - Intronic
1030324267 7:108203367-108203389 CCTTCCCCCATCCCCAGGACTGG - Intronic
1030525941 7:110655280-110655302 CCCCTCCCCCACCCCACGACAGG + Intergenic
1030596357 7:111544240-111544262 CCATCCCCCCACCCCACGACAGG - Intronic
1032844628 7:135742002-135742024 CCTCACCCCCACCCCTGCACTGG + Intronic
1034318920 7:150161362-150161384 CCAGTCCCCCACCCCACGACAGG + Intergenic
1034350869 7:150413982-150414004 CCACCCCCACCCTCCAGGACTGG + Intergenic
1034424325 7:151006754-151006776 CCTCAGCCCCTCCCAAGGGCAGG + Intronic
1034431147 7:151041732-151041754 CCAGAATCCCTCCCCAGGAGTGG - Intronic
1034433029 7:151050385-151050407 GCAGCCCCTCTCCCCAGGACTGG - Intronic
1034435787 7:151062231-151062253 CTCAACTCCCTCCCCAGGACTGG - Intronic
1034493598 7:151407473-151407495 CCACAACCCGTCCCCAGCCCAGG + Intronic
1034531125 7:151697063-151697085 ACACACCCCTTCCCCATGCCAGG - Intronic
1034681721 7:152934023-152934045 CCACCTCCCATCCCCAGGCCCGG + Intergenic
1034692618 7:153025978-153026000 CCAGCCCCCCACCCCATGACAGG + Intergenic
1034773839 7:153805845-153805867 CCAGTCCCCCACCCCACGACAGG - Intergenic
1034861566 7:154599668-154599690 CCAGCCCCCCACCCCATGACAGG + Intronic
1034899332 7:154897881-154897903 CCAGCCCCCCACCCCACGACAGG + Intergenic
1034973032 7:155430989-155431011 CCAGCCCCCCACCCCACGACAGG - Intergenic
1035287050 7:157813308-157813330 CCACACCGGCTTCCCAGCACTGG - Intronic
1035501103 8:91981-92003 CCACAAAGCCTCCCCAGGGCTGG + Intergenic
1035842666 8:2829150-2829172 CCACCCACCCTCCCCAGAATGGG - Intergenic
1036485605 8:9175980-9176002 CCACCCTCCCACCCCAAGACAGG + Intergenic
1036578789 8:10054281-10054303 CCACACCCCCTGTCCAGGGAAGG + Exonic
1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG + Intergenic
1037750643 8:21679949-21679971 AGACTCCCCCTCCCCAGGAACGG + Intergenic
1038141407 8:24849313-24849335 CCTCCCCCCCACCCCATGACAGG + Intergenic
1038280668 8:26161334-26161356 CCACTCCCCACCCCCAGGAAAGG - Intergenic
1038477147 8:27876452-27876474 CCACTCCCCCTCCCCACATCAGG - Intronic
1038870081 8:31484268-31484290 CCCCTCCCCCACCCCATGACAGG + Intergenic
1039476778 8:37842952-37842974 CCACTCCCCTCCCCCAGGACTGG - Exonic
1039762997 8:40598360-40598382 CCTCACCCCCACCCCCTGACAGG + Intronic
1040110330 8:43564367-43564389 CCCCACCCCCTCCCTGGGTCCGG + Intergenic
1040412051 8:47164448-47164470 CCATCCCCCCACCCCATGACAGG - Intergenic
1040835253 8:51724068-51724090 CCCCACCCCCACCCCTGGTCCGG - Intronic
1040897843 8:52387954-52387976 CCACCCCCCCGCCCCACGCCGGG + Intronic
1040915456 8:52563817-52563839 CTCCATCCCCTCCCCAGGGCAGG + Intronic
1040961902 8:53043316-53043338 CCATCCCCCCACCCCACGACAGG + Intergenic
1041107577 8:54458061-54458083 CCCCACCCCCTCCCCCGGGTCGG + Exonic
1041277856 8:56181560-56181582 CCCCACCCCCTGCCAATGACAGG - Intronic
1041426706 8:57729304-57729326 CCATGCCCCCACCCCACGACAGG + Intergenic
1041614634 8:59892258-59892280 CCATCCCCCCACCCCACGACAGG - Intergenic
1041686718 8:60651866-60651888 CCAGACCCCTTCCCCGGGCCGGG - Intergenic
1041780843 8:61577169-61577191 CCATCCCCCCACCCCACGACAGG - Intronic
1041945993 8:63443650-63443672 CCCCCCCCCCACCCCATGACAGG + Intergenic
1042153042 8:65810340-65810362 CCATCCCCCCACCCCATGACAGG - Intronic
1042852971 8:73235005-73235027 CCAGACCCCCACCCCCTGACAGG + Intergenic
1042855213 8:73260380-73260402 CCCCTCCCCCACCCCACGACAGG - Intergenic
1042931837 8:74021914-74021936 CCAGCCCCCCACCCCATGACAGG - Intronic
1042959859 8:74292019-74292041 CCCCTCCCCCACCCCACGACAGG - Intronic
1043316490 8:78928425-78928447 CCCCTCCCCCACCCCATGACAGG - Intergenic
1043458264 8:80433584-80433606 CCAGCCCCCCACCCCACGACAGG + Intergenic
1043629492 8:82311288-82311310 CCCTTCCCCCTCCCCAGGACAGG + Intergenic
1044102461 8:88157819-88157841 CCATCCCCCCACCCCATGACAGG + Intronic
1044221773 8:89678106-89678128 CCATCCCCCCACCCCATGACAGG - Intergenic
1044615083 8:94131825-94131847 CCAGACCCCCACCCCCTGACAGG + Intronic
1044793643 8:95873247-95873269 CCACACCACCTCTCCAGGAAGGG + Intergenic
1044873274 8:96641209-96641231 CCACAACCCCTCCCCAGCAAGGG - Intergenic
1045573857 8:103397568-103397590 CCAGACCCCTTTCACAGGACTGG + Intergenic
1045585236 8:103527538-103527560 CCATCCCCCCTCCCCACAACAGG + Intronic
1046286264 8:112096155-112096177 CCATCCCCCCACCCCACGACAGG - Intergenic
1046926725 8:119799304-119799326 CCATCCCCCCACCCCACGACAGG + Intronic
1047621012 8:126608008-126608030 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1047727298 8:127694982-127695004 CCACTCCCCATCCCCATGAGTGG - Intergenic
1048029440 8:130617056-130617078 CCACACCACCTCTCCAGCAAGGG + Intergenic
1048051972 8:130826908-130826930 CCAACCCCCCACCCCACGACAGG - Intronic
1048805781 8:138239992-138240014 CCCCTCCCCCACCCCATGACAGG - Intronic
1048816467 8:138339103-138339125 CCCCTCCCCCACCCCATGACAGG - Intronic
1049004266 8:139844923-139844945 CATCACCCCGTCCCCAGGCCTGG + Intronic
1049203199 8:141351718-141351740 CCCCACCCCCACCCCAGGACAGG - Intergenic
1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG + Intronic
1049404725 8:142447322-142447344 CCTCAGCCCCTCCCCAGGGAGGG - Intergenic
1049405285 8:142449616-142449638 CCCCCCCCCCTCGCCAGGAAGGG + Exonic
1049438636 8:142599151-142599173 CCACACAGCCTCCCCATGCCAGG - Intergenic
1049532140 8:143160064-143160086 CCCCACCCCCACCCCTGGGCTGG + Intronic
1049594011 8:143475254-143475276 CCTGACCTCCTCCCCAAGACAGG + Intronic
1049611561 8:143558462-143558484 CCCCGCCCCCTCCCCCGGCCTGG + Intronic
1049624789 8:143615146-143615168 CCACACCCCCAGCTCAGGGCTGG + Intronic
1049779979 8:144424470-144424492 CCACACTCTCTCCCGAGGCCAGG + Intronic
1050053626 9:1629106-1629128 CCAGTCCCCCACCCCACGACAGG - Intergenic
1050315006 9:4392233-4392255 CCCGACCCCCGCCCCACGACAGG - Intergenic
1050381733 9:5037699-5037721 CCATCCCCCCACCCCAGAACAGG - Intronic
1051043814 9:12849055-12849077 CCCTCCCCCCTCCCCACGACAGG - Intergenic
1051205648 9:14686048-14686070 CCCCTCCCCCACCCCACGACAGG - Intronic
1051298629 9:15624460-15624482 CCACTCCCCCACCCCATGACAGG + Intronic
1051314154 9:15810485-15810507 CCACCCCCCCACCCCATGGCGGG - Intronic
1051548243 9:18300454-18300476 CCAGCCCCCCTCCCCCTGACAGG - Intergenic
1051887941 9:21914624-21914646 CCCCACCCCCACCCCATGAGAGG - Intronic
1052212950 9:25929442-25929464 CCACTCCCCCACCCCACAACAGG + Intergenic
1052261538 9:26522201-26522223 CCATTCCCCCACCCCACGACAGG + Intergenic
1052451002 9:28631306-28631328 CCCCACCCCCACCCCATGACAGG + Intronic
1052642129 9:31181909-31181931 CCCCACCCCCACCCCACGACAGG - Intergenic
1052645098 9:31224896-31224918 CCTTACCCCCACCCCATGACAGG + Intergenic
1052656790 9:31373667-31373689 CTCCACCCCCACCCCATGACAGG + Intergenic
1053122196 9:35555652-35555674 CCTCACCACCTCCCCGGGCCAGG - Exonic
1053593266 9:39534162-39534184 ACACACCCCCTTTCCAGGAGGGG - Intergenic
1053661320 9:40283471-40283493 CCATCCCCCCACCCCACGACAGG - Intronic
1053753800 9:41281579-41281601 CCAGCCCCCCACCCCATGACAGG + Intergenic
1053850999 9:42288870-42288892 ACACACCCCCTTTCCAGGAGGGG - Intergenic
1053886117 9:42646040-42646062 CCACAACCCATCCCCACCACGGG - Intergenic
1053911694 9:42912814-42912836 CCATCCCCCCACCCCACGACAGG - Intergenic
1054225139 9:62453489-62453511 CCACAACCCATCCCCACCACGGG - Intergenic
1054259323 9:62845935-62845957 CCAGCCCCCCACCCCATGACAGG + Intergenic
1054332454 9:63774098-63774120 CCAGCCCCCCACCCCATGACAGG - Intergenic
1054373439 9:64429689-64429711 CCATCCCCCCACCCCACGACAGG - Intergenic
1054523290 9:66092813-66092835 CCATCCCCCCACCCCACGACAGG + Intergenic
1054573040 9:66831115-66831137 ACACACCCCCTTTCCAGGAGGGG + Intergenic
1054681073 9:67919460-67919482 CCATCCCCCCACCCCACGACAGG - Intergenic
1054870590 9:70044379-70044401 CCCCACCCCCACCCCAGGCTTGG - Intronic
1054938519 9:70714631-70714653 CCTCCCCCCCACCCCACGACAGG - Intronic
1054940210 9:70732624-70732646 CCTCCCCCCCACCCCACGACAGG - Intronic
1055226571 9:74004515-74004537 CCCTCCCCCCTCCCCACGACAGG + Intergenic
1055282970 9:74696151-74696173 CCAGCCCCCCACCCCACGACAGG - Intergenic
1055490523 9:76800198-76800220 CCATACCCCCACCCCGCGACAGG + Intronic
1055679653 9:78702485-78702507 CCATTCCCCCACCCCAAGACTGG + Intergenic
1055766789 9:79672118-79672140 GCACCCTCTCTCCCCAGGACAGG - Intronic
1055921680 9:81467509-81467531 CCACACCCCCGCTCCAAGAGAGG - Intergenic
1056590722 9:87964036-87964058 CCACACCCCCTCCCCTCCAGAGG + Intergenic
1056668606 9:88603314-88603336 CCAGCCCCCCACCCCACGACAGG - Intergenic
1057053584 9:91944805-91944827 CCCCACCCCCACCCCAGTCCTGG - Intronic
1058103127 9:100938326-100938348 CCACTCCTCCTCTCCAGGAAAGG - Intergenic
1058595494 9:106610962-106610984 CCATCCCCCCACCCCACGACAGG - Intergenic
1058750709 9:108035907-108035929 CCCCACCTCCTGCCCAGGGCTGG - Intergenic
1058791271 9:108448170-108448192 CCCCACCCCCACCCCACAACAGG - Intergenic
1059500912 9:114753288-114753310 CCCTCCCCCCACCCCAGGACAGG - Intergenic
1059524379 9:114976786-114976808 CCCTACCCCCACCCCACGACAGG - Intergenic
1059978761 9:119746028-119746050 CCATCCCCCCACCCCACGACAGG - Intergenic
1060382511 9:123189691-123189713 CCAGCCCCCCACCCCACGACAGG - Intronic
1060403164 9:123360244-123360266 CTCCTGCCCCTCCCCAGGACAGG + Intronic
1060508464 9:124215481-124215503 CATCAGACCCTCCCCAGGACAGG - Intergenic
1060820565 9:126659244-126659266 CCTCACCACCTGCCCAGCACTGG - Intronic
1060823628 9:126675071-126675093 CGCCACCCCCACCCCATGACTGG - Intronic
1060965899 9:127712148-127712170 CCTTCCCCCTTCCCCAGGACTGG - Intronic
1061369108 9:130187912-130187934 CCCCACCCCAGCCCCAGGAAGGG - Intronic
1061450650 9:130665298-130665320 CTCCACCCCCTCCCCAGCCCCGG - Intronic
1061451073 9:130667196-130667218 CCTCACCCCCAGCCCAGGACTGG - Intronic
1061540236 9:131274444-131274466 CAGCACCCCCTCCCCCGAACTGG + Intronic
1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG + Intronic
1061637468 9:131922016-131922038 CCCTCCCCCCTCCCCATGACAGG - Intronic
1061820277 9:133223519-133223541 GCCCACACCCTCCCCAGGGCAGG - Intergenic
1061854366 9:133433476-133433498 CCACACCTCCTCCGCAGGAGCGG - Exonic
1061861863 9:133472439-133472461 CCACACCCCCTACCCAGCGCTGG + Intronic
1062106727 9:134758994-134759016 CCACACCTCCTCAACAGGGCAGG - Intronic
1062132044 9:134901664-134901686 CCCTCCCCCCTCCCCACGACAGG + Intergenic
1062161721 9:135083992-135084014 CCTCACCCCCTTCCCTGGAGAGG - Intronic
1062240341 9:135534317-135534339 GCCCACACCCTCCCCAGGGCAGG + Intergenic
1062240356 9:135534385-135534407 GCCCACACCCTCCCCAGGGCAGG + Intergenic
1062449671 9:136610205-136610227 TCACATCGCCTCCCCAGGCCTGG - Intergenic
1062630894 9:137462605-137462627 CCACTCCCCTGCCGCAGGACAGG + Intronic
1203607809 Un_KI270748v1:71431-71453 CCACAAAGCCTCCCCAGGGCTGG - Intergenic
1185828238 X:3273402-3273424 CCAGACCCCCACCCCCTGACAGG + Intronic
1185890284 X:3816262-3816284 GCACACACCACCCCCAGGACTGG - Intergenic
1186169491 X:6861830-6861852 ACACACCCCCACCCCAGGGAAGG + Intergenic
1186306966 X:8271929-8271951 CCCTACCCCCACCCCACGACAGG - Intergenic
1186652809 X:11579023-11579045 CCATCCCCCCACCCCACGACAGG - Intronic
1187365437 X:18662449-18662471 CCGCTCCCCCACCCCACGACAGG + Intronic
1187493758 X:19776984-19777006 CCACACAACCACCCCAAGACTGG + Intronic
1188099918 X:26071251-26071273 CCACACCTCCTCACCAGGTGGGG - Intergenic
1188123650 X:26339946-26339968 CCATCCTCCCACCCCAGGACAGG - Intergenic
1188323141 X:28765146-28765168 CCCCACCCCCACCCCACAACAGG - Intronic
1188596586 X:31908561-31908583 CCAGCCCCCCACCCCACGACAGG - Intronic
1188720016 X:33510710-33510732 CCAGCCCCCCACCCCCGGACAGG - Intergenic
1188730438 X:33639569-33639591 CCCCATCCCCACCCCACGACAGG + Intergenic
1189344737 X:40232434-40232456 CCCCACCCCCTGCCCTGGACAGG - Intergenic
1189442213 X:41047928-41047950 CCACACTCACTCCCCATGAGGGG - Intergenic
1189623708 X:42872286-42872308 CCCCTCCCCCACCCCAAGACAGG + Intergenic
1189637868 X:43031419-43031441 CCCCACCCCAACCCCATGACAGG - Intergenic
1189893071 X:45625786-45625808 CCAGCCCCCCTCCCCACAACAGG + Intergenic
1189894415 X:45639261-45639283 CCAGCCCCCCACCCCATGACAGG - Intergenic
1190940896 X:55040288-55040310 CCCCTCCCCCACCCCACGACAGG + Intergenic
1191065944 X:56348024-56348046 CCAGACCCCCTCCCCCCAACAGG + Intergenic
1191657314 X:63612501-63612523 CCACTCCCCCACCCCACAACAGG - Intergenic
1191658378 X:63624375-63624397 CCACTCCCCCACCCCACAACAGG - Intergenic
1191936249 X:66430139-66430161 CCAGATCCCCACCCCACGACAGG + Intergenic
1192567396 X:72176627-72176649 CCAGCCCCCCACCCCATGACAGG - Intergenic
1192636581 X:72825365-72825387 CCAGCCCCCCACCCCCGGACAGG + Intronic
1192645133 X:72895449-72895471 CCAGCCCCCCACCCCCGGACAGG - Intronic
1192897193 X:75456346-75456368 CCAGCCCCCCACCCCATGACAGG - Intronic
1192934368 X:75843783-75843805 CCCTACCCCCACCCCATGACAGG + Intergenic
1192970621 X:76225238-76225260 CCCAACCCCCACCCCATGACAGG + Intergenic
1193008701 X:76650477-76650499 CCACTCCCCCACCCCACAACAGG + Intergenic
1193339167 X:80325419-80325441 CCATACCCCCACCCCAAAACAGG - Intergenic
1193657199 X:84212737-84212759 CCATCCCCCCACCCCATGACAGG + Intergenic
1193790087 X:85807362-85807384 CCACACCACCTCTCCAGCAAGGG - Intergenic
1194508521 X:94763731-94763753 CCATGCCCCCACCCCATGACAGG + Intergenic
1194519064 X:94896138-94896160 CCCTACCCCCACCCCATGACAGG + Intergenic
1194866704 X:99077894-99077916 CCATACCCCCACCCCGTGACAGG + Intergenic
1194930392 X:99880816-99880838 CCACACAGTCTCCCCAGCACTGG - Intergenic
1195116764 X:101707133-101707155 CCACACCCACTCCACAGCAGAGG + Intergenic
1195156319 X:102126787-102126809 CCACACCCATCCCCCAGGAAAGG + Exonic
1195306330 X:103586632-103586654 CCACCCCCATCCCCCAGGACAGG + Exonic
1195335911 X:103853902-103853924 CCCTACCCCGACCCCAGGACAGG - Intergenic
1195342916 X:103922354-103922376 CCCCTCCCCCACCCCACGACAGG + Intronic
1195517119 X:105789677-105789699 CCAGCCCCCCACCCCATGACAGG - Intergenic
1195602597 X:106765866-106765888 CCAGCCCCCCACCCCACGACAGG + Intronic
1195665641 X:107427698-107427720 CCAGCCCCCCACCCCATGACAGG - Intergenic
1195787393 X:108542255-108542277 CCCCACCCCCACCCCACAACAGG + Intronic
1195794477 X:108629811-108629833 CCATTCCCCCACCCCATGACAGG + Intronic
1195932315 X:110090856-110090878 CCAGCCCCCCACCCCATGACAGG + Intronic
1195951382 X:110277411-110277433 CCAGCCCCCCACCCCATGACAGG - Intronic
1195956250 X:110333819-110333841 CCAGACCCCCACCCCCTGACAGG - Intronic
1196092981 X:111766699-111766721 CCCCACCCCCACCCCATGACAGG + Intergenic
1196119009 X:112028423-112028445 CCAGGCCCCCACCCCATGACAGG + Intronic
1196303956 X:114079000-114079022 CCATCCCCCCACCCCACGACAGG + Intergenic
1196468294 X:115994603-115994625 CCACACCACCTCTCCAGCAAGGG + Intergenic
1196474210 X:116064047-116064069 CCATACCCCCACCCCACAACAGG + Intergenic
1196603914 X:117633884-117633906 CCCCTCCCCCACCCCATGACAGG - Intergenic
1196606429 X:117662562-117662584 CCATGCCCCCACCTCAGGACAGG - Intergenic
1197264652 X:124356051-124356073 CCCTCCCCCCACCCCAGGACAGG + Intronic
1197765395 X:130056737-130056759 CCTCACCCCCTCCCCAGTGGGGG - Exonic
1198120979 X:133592279-133592301 CCCTCCCCCCACCCCAGGACAGG + Intronic
1198191504 X:134311382-134311404 CCATCCCCCCACCCCACGACAGG - Intergenic
1198587820 X:138142331-138142353 CCATCCCCCCACCCCATGACAGG + Intergenic
1199194857 X:145016296-145016318 CCCTCCCCCCTCCCCACGACAGG + Intergenic
1199475544 X:148240932-148240954 CCATCCCCCCACCCCATGACAGG - Intergenic
1199791086 X:151155847-151155869 CCCCACCCCCTCACCACGCCTGG + Intergenic
1200123026 X:153800191-153800213 CCAACCCCCCTCCCAAGGCCTGG - Intergenic
1200519192 Y:4189136-4189158 CCAGACCCCATCGCCAGCACCGG + Intergenic
1200645649 Y:5779778-5779800 CCCTACCCCCACCCCACGACAGG - Intergenic
1200826966 Y:7656624-7656646 CCAAACCCCCACCCCACAACCGG + Intergenic
1201559823 Y:15304118-15304140 ACACACCCCCACCCCAGGGAAGG + Intergenic