ID: 1145917506

View in Genome Browser
Species Human (GRCh38)
Location 17:28584146-28584168
Sequence TTACCTCCAAGGTCTCTTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145917501_1145917506 -8 Left 1145917501 17:28584131-28584153 CCCAAGCCATATTCCTTACCTCC 0: 1
1: 0
2: 4
3: 22
4: 222
Right 1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 190
1145917496_1145917506 16 Left 1145917496 17:28584107-28584129 CCTGAGGCTTACCAGCTCCCTTG 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 190
1145917498_1145917506 5 Left 1145917498 17:28584118-28584140 CCAGCTCCCTTGGCCCAAGCCAT 0: 1
1: 0
2: 5
3: 29
4: 344
Right 1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 190
1145917499_1145917506 -1 Left 1145917499 17:28584124-28584146 CCCTTGGCCCAAGCCATATTCCT 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 190
1145917502_1145917506 -9 Left 1145917502 17:28584132-28584154 CCAAGCCATATTCCTTACCTCCA 0: 1
1: 0
2: 1
3: 15
4: 207
Right 1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 190
1145917500_1145917506 -2 Left 1145917500 17:28584125-28584147 CCTTGGCCCAAGCCATATTCCTT 0: 1
1: 0
2: 0
3: 43
4: 763
Right 1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145917506 Original CRISPR TTACCTCCAAGGTCTCTTTC AGG Exonic
902096297 1:13948657-13948679 TTACCCCCAAGACCTCTTTGTGG + Intergenic
903726219 1:25447738-25447760 ATCCCTCCAAGGGCTCTTTGAGG - Intronic
905099598 1:35507530-35507552 TCACCTCCAAGGTATTTCTCAGG + Intronic
906163852 1:43671194-43671216 TTTCCTCCAAAGTCTCCTGCAGG - Intronic
907129978 1:52088004-52088026 TTACCTCCAAGTCCTCTTAAAGG - Exonic
907512811 1:54974803-54974825 TTACCACGTAGGGCTCTTTCAGG + Intergenic
907666785 1:56439887-56439909 TTACCTCCAAGGTGATATTCTGG - Intergenic
908028807 1:59978065-59978087 TAACATCAAAGGTCTCTTTTAGG + Intergenic
908288551 1:62637783-62637805 TTACTTCCATGTTCTCTTTTAGG - Intronic
908493649 1:64672096-64672118 TTGGTTCCATGGTCTCTTTCTGG - Intronic
908669294 1:66528736-66528758 TTACTTCCATGCACTCTTTCTGG + Intergenic
909597197 1:77419743-77419765 TCACCTCCATTCTCTCTTTCTGG - Intronic
910014285 1:82501923-82501945 TGTCCTCCAAGTTCTCTATCAGG + Intergenic
910276394 1:85453837-85453859 TTATTTCCAAGATCTCTTTTAGG + Intronic
914716787 1:150260459-150260481 TTAGCTGCCAGGTCTCCTTCTGG + Intronic
915131316 1:153697504-153697526 TGACCTCCCAGGCCTCTTCCTGG + Intergenic
916634097 1:166649518-166649540 TTACTTCTGAGGTATCTTTCAGG + Intergenic
917983669 1:180293183-180293205 TTTCCTCTAAGGTCTTTGTCTGG + Intronic
919514096 1:198500159-198500181 TTTTCTCCAAGTTCTATTTCTGG - Intergenic
921946600 1:220890091-220890113 CCACTTCCAAGGTCTCTTTCTGG - Intergenic
924028009 1:239857717-239857739 CTCCCTTCCAGGTCTCTTTCTGG - Intronic
1070463167 10:76690254-76690276 TTGCCTCCAAGATCTGTTTTAGG - Intergenic
1070480163 10:76874408-76874430 ATGACTCTAAGGTCTCTTTCAGG - Intronic
1070740247 10:78898570-78898592 TTTGCTCCACGGTCTCTTACTGG - Intergenic
1071718952 10:88123587-88123609 TTCACTCCCAGGTCTCTTCCTGG + Intergenic
1078134388 11:8640223-8640245 TTACCTGCAGGGTCTCCTCCTGG + Exonic
1080136653 11:28862949-28862971 TTACCTCCATGCTGTCCTTCAGG + Intergenic
1080842923 11:36001113-36001135 TTTTCTCCAAGCTCTCTTTCTGG - Intronic
1081649151 11:44812080-44812102 TTACCTCCCAGGTCTCTGCCAGG + Intronic
1083504187 11:63139812-63139834 TTTCCTCCAAGGGCTCTACCTGG + Intronic
1083938684 11:65883497-65883519 TAACCTCCTAGGGCTATTTCCGG + Exonic
1084434803 11:69132477-69132499 TGATCCCCAAGGTCTCTCTCAGG + Intergenic
1084860579 11:72015363-72015385 TGACCTTCAAGGACTCTTTGAGG + Exonic
1089173145 11:116529304-116529326 ATTCCTCCTAGGTCTCTTGCAGG - Intergenic
1090529828 11:127578946-127578968 TTCCCTACAAGCCCTCTTTCGGG - Intergenic
1091941657 12:4489695-4489717 TGAGCTGCAAGTTCTCTTTCTGG + Exonic
1092042882 12:5400802-5400824 TTTTCTCCAAGGCCTCTTCCAGG + Intergenic
1093958010 12:25244545-25244567 TGACCTTCAAGGTGTCTTACAGG + Intronic
1096449602 12:51727280-51727302 TTTCCTCCAAGGCTTCTTACAGG + Intronic
1098244944 12:68507297-68507319 ATTGCTCGAAGGTCTCTTTCAGG - Intergenic
1099603174 12:84767546-84767568 TTAAATCCAAGTTCTCTTACTGG - Intergenic
1100701162 12:97149747-97149769 TTTCCTTCAAGGTGACTTTCTGG + Intergenic
1101991345 12:109487884-109487906 TTGTCTCCAAGGTCCCTTCCAGG + Intronic
1102101077 12:110279713-110279735 TTACCTCCTCTGTCTCTTTCAGG - Intergenic
1107414670 13:40189728-40189750 TAACATCCAAGGTCTCTCTCTGG - Intergenic
1115553303 14:34523952-34523974 GTACCTCAAAAGTCTGTTTCTGG + Intronic
1117739939 14:58806815-58806837 TGACCTGCTGGGTCTCTTTCTGG + Intergenic
1119155031 14:72402184-72402206 TTCCGTCCAAGATCTCTCTCAGG + Intronic
1121468778 14:94135493-94135515 TTACCTGCAAAGTGTCTTTGTGG + Intergenic
1124349113 15:28942702-28942724 ATACCTCCCAGGTCGCTTACTGG - Intronic
1125294848 15:38191451-38191473 TTACCTTCAAGAGCTCTATCAGG - Intergenic
1126455675 15:48859435-48859457 TTAGCTCCTAAGTCTATTTCAGG - Intronic
1129111260 15:73338673-73338695 TTTCCACCAAGGCCTCTTCCTGG + Intronic
1129895388 15:79101849-79101871 TGAACTCCCAGGTCTGTTTCTGG + Intergenic
1129972836 15:79795455-79795477 TATCCTCCAAGTTCTCTTTGAGG + Intergenic
1131802827 15:96089553-96089575 ATACCACCAAGCTCTATTTCTGG - Intergenic
1133629161 16:7602585-7602607 TTATCCCAAGGGTCTCTTTCAGG + Intronic
1137331787 16:47505064-47505086 TTCCCTCCAAGGTTTCTCTCAGG + Intronic
1137776897 16:51062800-51062822 TGATCTCCGAGGTCTTTTTCAGG + Intergenic
1141025533 16:80543254-80543276 TTATCTTCCTGGTCTCTTTCAGG + Exonic
1141826540 16:86484624-86484646 TCACCTCCAAGTCCTCTTTCTGG - Intergenic
1141954511 16:87361481-87361503 TGACCTTCAAGGTCACTGTCAGG - Intronic
1144679147 17:17181335-17181357 TTTCCTCCATGTTCTCATTCCGG - Intronic
1144716137 17:17437135-17437157 TTCCCTCAAGGGTCTCTCTCAGG + Intergenic
1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG + Exonic
1146361673 17:32181157-32181179 TTCCCTCCAAGCTCTCTTGCAGG + Intronic
1148553013 17:48561875-48561897 TGATCTCTAAGGTCTCTTTTTGG + Intronic
1151581186 17:74979929-74979951 TTATCTTAAAAGTCTCTTTCCGG + Intergenic
1152399498 17:80057067-80057089 TTTCCTCTAAGTTCTCTTTGAGG - Intronic
1152766493 17:82143422-82143444 TTTCCTCAAAGGTCGCTGTCTGG - Intronic
1155575910 18:27246555-27246577 TTACCACCATGGGCTGTTTCAGG + Intergenic
1156587003 18:38442341-38442363 TTATCTACAAGGTCTGATTCAGG - Intergenic
1158518428 18:58150183-58150205 TTACCTCCTATCTCTCTTGCTGG + Intronic
1159023208 18:63160105-63160127 GTGGCTCCAAGGGCTCTTTCTGG - Intronic
1159457350 18:68677479-68677501 TAACCACAAAGGTCTCTTTAAGG + Intronic
1163016907 19:14461947-14461969 TTGCCTTCAAGGTCTCTCTGTGG + Intronic
1163578729 19:18125391-18125413 TTGACTCCAAGTTCACTTTCTGG - Intronic
1168394920 19:56039536-56039558 TTCACTCCAAGTTCTCTTTACGG + Intronic
1168436925 19:56325464-56325486 TGACCTCCCTGTTCTCTTTCAGG - Intronic
1168440843 19:56365888-56365910 TTATCTCCAAGGACTCTAGCAGG + Intronic
1168595389 19:57671441-57671463 TTCCCTCCAAGTTCTCTTTTTGG - Intronic
925960636 2:9011851-9011873 TTACTTCCAAATTCTCTTCCTGG - Intergenic
929253930 2:39789386-39789408 TAAGTTCCAAGGTCTCTTTCTGG + Intergenic
929998506 2:46845405-46845427 TAAACTCTAAGGTCCCTTTCAGG - Intronic
930805883 2:55489802-55489824 TTAGCCACAAGGTCTCCTTCAGG + Intergenic
931509056 2:62968958-62968980 TTACATCCAAGGCCTCTTGCTGG - Intronic
932084689 2:68747584-68747606 TTAGCTCCAACGTCTCTTCTGGG + Intronic
933587698 2:84198050-84198072 TTTGCTTCAAGGTCCCTTTCAGG + Intergenic
935334158 2:101999600-101999622 AGACCTCCCAGGTCTCTTGCAGG - Intronic
936381968 2:111994247-111994269 CTTCCTCCAAGAGCTCTTTCTGG - Exonic
936489347 2:112957055-112957077 CCACCTCCAGGGGCTCTTTCAGG + Intergenic
936942749 2:117902635-117902657 TTATCTCCAGGGTCTCTATCAGG - Intergenic
940594276 2:155769609-155769631 TTACCTCCAGGAGCTCCTTCAGG - Intergenic
940674046 2:156706909-156706931 CTACCTCCTAAGTCCCTTTCTGG - Intergenic
942475420 2:176314518-176314540 TTTCCTCCAACATTTCTTTCTGG + Intronic
942675706 2:178424301-178424323 TTAACTCCAAAGTTTCTTTGTGG + Intergenic
943063492 2:183062554-183062576 TTATCTCCAAGGACTTTTTTAGG - Intergenic
946185061 2:217976087-217976109 CTTCCTCCAAGGAGTCTTTCTGG + Intronic
946807593 2:223486593-223486615 TTACCTGATAGGTCCCTTTCTGG + Intergenic
947153204 2:227135288-227135310 TTACCTCCTTGATCTTTTTCGGG - Intronic
948402023 2:237691806-237691828 TTTCCTCCAGGTCCTCTTTCCGG + Intronic
949052839 2:241906277-241906299 TACACTCCAAGGTCTCTCTCCGG - Intergenic
1169342765 20:4809208-4809230 TTACCCCCAAGCTGTCTTTCAGG - Intronic
1169535548 20:6535268-6535290 ACACCTCCAATGTCTCTTTGAGG + Intergenic
1172185555 20:33028975-33028997 TGGCCTCCAAGATCTCTCTCAGG + Intergenic
1173937752 20:46881857-46881879 TTACCTCCACGGTCTCCCTCTGG - Intergenic
1174388873 20:50204865-50204887 GTACCACCTAGGTCTCCTTCAGG - Intergenic
1175163411 20:57025329-57025351 TTCCCTCCAAGGTTTCATTGAGG - Intergenic
1177157903 21:17517269-17517291 TTACCTCCAAGTCCTCTTAAAGG + Intronic
1178793718 21:35723789-35723811 ATAACTCCCAGGTCTCTGTCTGG - Intronic
1181052880 22:20246060-20246082 TTTCCTCCAGGGTCTCCTCCTGG + Intronic
1183617196 22:38953190-38953212 TGAGCTCCTAGGTCTGTTTCTGG - Intronic
950754190 3:15158994-15159016 TAATCTCTAAGGTCTTTTTCAGG + Intergenic
951679967 3:25284285-25284307 TTACCTTCAGGGTCTCTTACAGG - Intronic
952426958 3:33185357-33185379 TTACCTCCAGGAGCTCTATCAGG - Intronic
952748133 3:36801324-36801346 CTTCCTCCATGGTTTCTTTCTGG - Intergenic
955533476 3:59899203-59899225 TTACCTCCAGGGTCACATGCGGG + Intronic
955959392 3:64323918-64323940 TTATCTTTAAGGTTTCTTTCAGG - Intronic
957875758 3:86144173-86144195 TTATCTGCAAAGTCCCTTTCTGG + Intergenic
958833536 3:99117590-99117612 TTAACTTCAAGATCTCCTTCTGG + Intergenic
958893064 3:99801791-99801813 TTACTTGCAAGGTCTATTTAGGG - Intergenic
959757708 3:109918708-109918730 TTTCCTCCCAAGTCACTTTCAGG + Intergenic
960050441 3:113234018-113234040 CTACCTCTAAGGTCTTTTCCAGG - Intronic
960846716 3:122010649-122010671 AGATCTCCAAGGTCTATTTCAGG - Intronic
964153143 3:153552797-153552819 TTACCTCAGAGGTATCTTGCTGG - Intergenic
964822583 3:160788835-160788857 TTACCTGTAGGGTCTATTTCTGG + Intronic
965530030 3:169762485-169762507 TTAACTCCATCGTCACTTTCTGG - Intergenic
967255806 3:187590812-187590834 TTAATTCCAAGGCCTCCTTCTGG + Intergenic
967276588 3:187781820-187781842 TGACCTCTAAAGTTTCTTTCAGG + Intergenic
970891697 4:21052719-21052741 GTACCTCCTCTGTCTCTTTCAGG + Intronic
971131327 4:23814162-23814184 TTGCCTCCAAAGTCTCTCTCAGG + Exonic
973124080 4:46561888-46561910 TTATCTCCAAAATCTCTTCCTGG - Intergenic
975191007 4:71462373-71462395 TAATCTCTAAGGTCTCTTCCAGG - Intronic
977252804 4:94707664-94707686 TTGCCTATAAGATCTCTTTCAGG - Intergenic
977323399 4:95547701-95547723 TCCCCTCCGGGGTCTCTTTCAGG - Intronic
977667476 4:99657491-99657513 TTACCTCCAAAGTATCTGTGTGG + Intergenic
982377313 4:154707299-154707321 TTCCCTACAGGGTCTCATTCAGG - Intronic
983280820 4:165679077-165679099 TAACCTCCAAGGTCTCTTCAAGG - Intergenic
984049160 4:174842272-174842294 TGTCCTTCAAGGTCTCTTGCAGG - Intronic
984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG + Intronic
985664353 5:1174189-1174211 TAAGCTCCAAAGTCTCGTTCCGG - Intergenic
986114437 5:4757660-4757682 TTACCTCCAGGGACTCTACCAGG - Intergenic
986279523 5:6312059-6312081 TCCCCTCCCAGGTCTTTTTCTGG + Intergenic
987305202 5:16630937-16630959 TTATCTCCAAAGTCTCCTCCTGG - Intergenic
987714828 5:21554429-21554451 TACACCCCAAGGTCTCTTTCTGG - Intergenic
988368204 5:30330400-30330422 CTTCCTCCCAAGTCTCTTTCTGG + Intergenic
990201986 5:53386202-53386224 TTACCTCCAGGAGCTCTATCAGG + Intergenic
991708009 5:69378368-69378390 CTACCTCCTAGTTCTCTTACTGG + Intronic
992144589 5:73833014-73833036 TTAACTCAAAAGTCTCTATCAGG - Intronic
995572093 5:113491249-113491271 TTGCTGCCAAGGTCTCTCTCAGG + Intergenic
999401746 5:151269670-151269692 TTACTTCTAAGGTTTTTTTCGGG - Exonic
999565199 5:152851884-152851906 TTACCTCCAGGAGCTCTATCAGG - Intergenic
1000283472 5:159803757-159803779 TTGCCTCCAAGGTGTCTTCCAGG + Intergenic
1000337855 5:160254732-160254754 TTACCTCCAGTGTCAGTTTCAGG + Intronic
1000623106 5:163507084-163507106 TTACCTTAAGGGTCTGTTTCTGG + Intronic
1001274989 5:170344152-170344174 TTCCCTTCCAGGTCTTTTTCTGG - Intergenic
1004438313 6:15619622-15619644 TCAGTTCCAAGGTCTCATTCAGG - Intronic
1012278584 6:97302155-97302177 TTTCCACCTAGGTCTCATTCTGG - Intergenic
1013144575 6:107375715-107375737 TTTCCTGTAATGTCTCTTTCTGG - Intronic
1013633991 6:112011076-112011098 TTCCTTCCAAGGTTTCTGTCGGG + Intergenic
1013670131 6:112392621-112392643 TTACCTCGATGGTATTTTTCTGG + Intergenic
1014067116 6:117139893-117139915 TTATCTGCAAGGTCTGCTTCAGG + Intergenic
1015855393 6:137618725-137618747 TTGCCTTCATGCTCTCTTTCAGG + Intergenic
1016548422 6:145249570-145249592 GTTCCTCTAAGGTGTCTTTCTGG + Intergenic
1017195904 6:151699918-151699940 TTCCCTCCACGGTGACTTTCTGG - Intronic
1018227305 6:161640664-161640686 TTACCACCGAGGTTTCTTTCAGG + Intronic
1018450731 6:163904953-163904975 TTATCTCCCACTTCTCTTTCTGG + Intergenic
1019075008 6:169379900-169379922 TGACCTCCAAGTTCTTTTCCTGG - Intergenic
1019141624 6:169950384-169950406 TCACCTGCCAGGTCTCTTTATGG - Intergenic
1019385300 7:752208-752230 TTGACTCCAAGTTCACTTTCTGG - Intronic
1021630842 7:22646073-22646095 TTAGCTCCAAGATTTCTTTTTGG + Intergenic
1025071561 7:55904098-55904120 TTACTTCCACCGTCTCTCTCAGG - Intronic
1025204263 7:56982672-56982694 CTCCCTCCAAGGTCTCTGTGGGG - Intergenic
1025667676 7:63594262-63594284 CTCCCTCCAAGGTCTCTGTGGGG + Intergenic
1026406622 7:70072804-70072826 TTATCTCCATTGTCTCTTTGAGG + Intronic
1027982465 7:85243306-85243328 TTACCTCCAGGAGCTCTTACAGG - Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1031188244 7:118511342-118511364 TTACATCCAAGGGCTGTCTCGGG - Intergenic
1031456288 7:121984417-121984439 ACACCTCCAAGTTCACTTTCTGG + Intronic
1032599033 7:133273350-133273372 CTACTTCCAAGGTTTCTTGCAGG - Intronic
1036062171 8:5335558-5335580 CTACCTCCTAGTTTTCTTTCAGG + Intergenic
1037017426 8:13925837-13925859 TTACCTCCAGGGCCTCTACCAGG - Intergenic
1039407136 8:37323004-37323026 GTACCTCCCCGCTCTCTTTCTGG - Intergenic
1040612553 8:48999563-48999585 CTTCCTCCAGGGGCTCTTTCAGG - Intergenic
1042043174 8:64617118-64617140 TTATCACCAAGGTCTCTTTGAGG + Intronic
1044944075 8:97374912-97374934 TTCCCTTCAAAGTCTCTTGCTGG - Intergenic
1046516838 8:115273274-115273296 TTACCTCCTAGGTCCCTGTCAGG - Intergenic
1046686804 8:117236856-117236878 ATACCTCCCATGACTCTTTCAGG - Intergenic
1047268944 8:123336369-123336391 TCACCTCCAGGATCTCTATCTGG + Exonic
1047750347 8:127875896-127875918 TTATCTCCAAGGCCTCATGCTGG + Intergenic
1047793747 8:128232979-128233001 TCACCTCACAGGGCTCTTTCAGG + Intergenic
1048360802 8:133695605-133695627 CTAACTCCAATGTCCCTTTCAGG - Intergenic
1050062115 9:1720192-1720214 GTACCTCCAGGCACTCTTTCAGG + Intergenic
1052148411 9:25079235-25079257 TGACTTACAAGGTCTCTGTCTGG + Intergenic
1052351248 9:27460583-27460605 GTACCACCAAGGTCTCTTAGAGG - Intronic
1053202356 9:36161484-36161506 TTTCCTCTAAGCTCTCTTTAGGG - Intronic
1054919983 9:70533216-70533238 ACACCTCCAAGGCCTCATTCTGG - Exonic
1055153913 9:73037882-73037904 TTCCCTCCATGGTAACTTTCAGG - Intronic
1061009656 9:127947514-127947536 TTACATCCCAGGTCACTTTGGGG - Intronic
1186210099 X:7241784-7241806 TTAGCTTCTACGTCTCTTTCAGG + Intronic
1187543857 X:20227885-20227907 TTTCCTCTATTGTCTCTTTCTGG + Intronic
1188999785 X:36931486-36931508 TAACCTCCAAGCTGTCTTTGTGG - Intergenic
1189119975 X:38384175-38384197 TTACCTCCATGGTCTCAATGTGG + Intronic
1189750120 X:44212319-44212341 TTACCTCCACGATCTCCATCAGG + Intronic
1190267529 X:48836075-48836097 AAACCTCCAAGGTCACTTTGAGG - Intergenic
1190713456 X:53085398-53085420 TTATCTCAAAGGTCCCTTTTTGG - Intronic
1191861574 X:65669786-65669808 TAGTCTCCAAGGTCCCTTTCAGG - Intronic
1193684220 X:84557508-84557530 TTTCCTTCAAGGTCTCTTGTAGG - Intergenic
1194615072 X:96090292-96090314 TTAACTCCAGTGTTTCTTTCTGG - Intergenic
1196245331 X:113392444-113392466 TTGCCTCCACTGCCTCTTTCAGG - Intergenic
1196692738 X:118577688-118577710 CTACCTCCAAGGGTTCTATCTGG + Intronic
1197334590 X:125197017-125197039 TTACCTCTAATGTCTCTATCTGG - Intergenic
1201306804 Y:12557315-12557337 TTACCTCCAAACTCTTTTTAAGG - Intergenic