ID: 1145918048

View in Genome Browser
Species Human (GRCh38)
Location 17:28588267-28588289
Sequence CATGGCATGCTGATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145918046_1145918048 -9 Left 1145918046 17:28588253-28588275 CCAGGCAGCAAGGACATGGCATG 0: 1
1: 0
2: 1
3: 28
4: 300
Right 1145918048 17:28588267-28588289 CATGGCATGCTGATGGAGAATGG 0: 1
1: 1
2: 1
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145918048 Original CRISPR CATGGCATGCTGATGGAGAA TGG Intronic
900329185 1:2125658-2125680 CATGGAATGCGGATGGAAAGCGG - Intronic
906318649 1:44803663-44803685 CCTGGCATCCTGATGGCCAACGG - Exonic
906948641 1:50316735-50316757 CATGGGGTGCTGCAGGAGAAGGG + Intergenic
907459074 1:54594472-54594494 CATGGCATGGTGCTGGGGACAGG + Intronic
907707595 1:56846085-56846107 CATGGCATGGTGATGGGCAGGGG + Intergenic
907940684 1:59084306-59084328 CCTGGCATCCTGTTGGAGGAAGG + Intergenic
908983136 1:69983279-69983301 CATGGGAAGCTGAGGGAGCAGGG + Intronic
910973355 1:92879586-92879608 AATGGCATGCTGAAAGAAAAAGG - Intronic
911732403 1:101304764-101304786 GATGGCTTGCTGGTGGACAAAGG + Intergenic
913142676 1:115956803-115956825 CTTGGCATGTTGATGTAGCAGGG - Intergenic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
916552042 1:165858797-165858819 AATGGAATGCTGATGGGGCAAGG + Intronic
916944826 1:169716000-169716022 CATGGGAGGCTGAGGGAGAAGGG - Intronic
917430230 1:174959230-174959252 CATAGCATGCTGCTTTAGAAAGG + Intronic
917511257 1:175671027-175671049 CATGACATGGAGATGGAGAGAGG + Intronic
918359416 1:183740400-183740422 CATGGCTTACAGATGGAGCATGG + Intronic
918732783 1:188019145-188019167 CATGAAATGGTTATGGAGAAAGG - Intergenic
919247957 1:195013745-195013767 CAGGTCATGCTGATAGAGAAGGG + Intergenic
919779426 1:201212731-201212753 CAGGGCCTGCTGATAGACAAGGG + Exonic
920123188 1:203673895-203673917 CATGTCATGCTTATGGAGAGGGG - Intronic
920386711 1:205575066-205575088 CAGGCCAGGCTGATGGGGAAGGG - Intronic
920703790 1:208237050-208237072 TAAGGGATGCTAATGGAGAAAGG - Intronic
921297793 1:213721240-213721262 CATCACATGCTGAAGAAGAAGGG - Intergenic
921594280 1:217037955-217037977 CAGGTCATGCTGATGCAAAAGGG + Intronic
922557256 1:226541872-226541894 TATGGGATGATGATGAAGAAGGG - Intergenic
923426875 1:233879368-233879390 TATTGCTTGCTGATGGAGATTGG + Intergenic
1067718429 10:48707797-48707819 CAGGGAATGCGAATGGAGAATGG + Intronic
1070032994 10:72694904-72694926 AATGACATACTAATGGAGAAGGG - Intronic
1071416310 10:85444973-85444995 CAGGCCTGGCTGATGGAGAATGG - Intergenic
1071765117 10:88655344-88655366 CATGGCATGCAGCTGGAGACTGG - Intergenic
1076429253 10:130390176-130390198 CATGGCATGAACATGGGGAAAGG - Intergenic
1076838502 10:133033082-133033104 CATGTCATGGGGACGGAGAAAGG - Intergenic
1078600077 11:12722443-12722465 CAAGGCAGGCTGATGAGGAAAGG - Intronic
1078742773 11:14082810-14082832 CTGGGCATGATGATAGAGAATGG - Intronic
1079088516 11:17464310-17464332 CACAGCATGATGATGGAGCAGGG + Intronic
1080014503 11:27490432-27490454 CTTGGCATGTTAATGGAGCAAGG + Intergenic
1080694814 11:34594104-34594126 CATGGTGAGATGATGGAGAATGG - Intergenic
1082830694 11:57614750-57614772 CATGGCAGGGCCATGGAGAAGGG - Exonic
1083271517 11:61575216-61575238 CATGGCTGACTGAAGGAGAAAGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1089286756 11:117412396-117412418 CATGGCAAGCTGATGGCGTGCGG + Exonic
1089342689 11:117770097-117770119 TAAGGCATGCTGAAGGAGACGGG - Intronic
1089667613 11:120030389-120030411 AATGGCCTACTGCTGGAGAATGG - Intergenic
1090476648 11:127028015-127028037 CATGTCATGCTGAGTGAGAGAGG + Intergenic
1091311140 11:134576069-134576091 CATGGCTTGCCGATGGACACAGG - Intergenic
1091652171 12:2318760-2318782 GATGGCATGGGGATGGAGGATGG + Intronic
1092056640 12:5513126-5513148 CATAGCATGCTGGAGCAGAAGGG + Intronic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1095210863 12:39492947-39492969 CCTGGCATGCTGCTTAAGAAGGG + Intergenic
1095891186 12:47236031-47236053 CATTCCCTGGTGATGGAGAATGG - Exonic
1096148721 12:49295828-49295850 CTTGGGCTGCTGATGGAGAGGGG - Intronic
1098170406 12:67741245-67741267 CATGCCTTGCTGAAGGAGAGAGG + Intergenic
1098450838 12:70616652-70616674 CAGGACATGCTGATTGAGAGGGG - Intronic
1099017899 12:77366983-77367005 CATTGAATGCTTATAGAGAAAGG - Intergenic
1099748689 12:86742491-86742513 CATGTCATACTCATGGAGCAAGG - Intronic
1100283215 12:93138457-93138479 CATGGGCTCCTGATGGATAATGG - Intergenic
1101497146 12:105265534-105265556 CATGGCATGCTTAGCAAGAAAGG + Intronic
1102859328 12:116321696-116321718 CATGGAACTCTGATTGAGAAAGG - Intergenic
1103214335 12:119189894-119189916 CATGTCATAGTGATGGAGGAGGG - Intronic
1104483756 12:129131084-129131106 CATGGCATGCAGATCAAAAAGGG + Intronic
1104803032 12:131567715-131567737 CATGGCCTTCTGTTTGAGAATGG - Intergenic
1105510140 13:21044835-21044857 CATGGGATGCTGAGGCAGGAGGG - Intronic
1105816817 13:24043727-24043749 CATGGCCTGCTGGTCGTGAAAGG + Intronic
1105830965 13:24162386-24162408 CCAGGGATGCTGATGGAGCATGG - Intronic
1105865990 13:24460340-24460362 CGTGGCAGGCAGATGGAGAGGGG + Intronic
1105987246 13:25579718-25579740 TTGGGCATGCTGATGGAAAAGGG + Intronic
1107998121 13:45881440-45881462 CATGGCCTTCTGCTGGAGGAAGG - Intergenic
1108681491 13:52784595-52784617 GATGCCCTGCTGCTGGAGAAGGG - Intergenic
1110594793 13:77308350-77308372 CATAGCAGGCTGAAGGAAAAGGG - Intronic
1111595344 13:90403928-90403950 GATGGCAAGTTGATGGAGACAGG + Intergenic
1113011825 13:105776313-105776335 AATGGGATGCTGAGGGAGTATGG - Intergenic
1113564312 13:111309626-111309648 CCAGGCATGCTGGTGGAGCAAGG + Intergenic
1114298944 14:21356630-21356652 CTTGGGATGCTGATGCAGGAAGG + Intronic
1114491434 14:23104669-23104691 CTTGGGATCCTGAGGGAGAAGGG - Intergenic
1115027337 14:28760269-28760291 CATGGCCTCGTGTTGGAGAAGGG + Intergenic
1119232185 14:72989033-72989055 CTTGGGATGCTGAGGCAGAATGG - Intronic
1120824508 14:88943276-88943298 CAGGGCAGACTCATGGAGAAGGG - Intergenic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121783593 14:96638405-96638427 CATGGAGTGGTGATGGAGAAGGG + Intergenic
1124113594 15:26817450-26817472 CATTGTATGATGATGGTGAAGGG - Intronic
1125376744 15:39038266-39038288 CATGGCATACTGAATGAGCAGGG - Intergenic
1131443185 15:92474204-92474226 CAAGGCAAGCTGTTGGAGCAAGG - Intronic
1132535101 16:475016-475038 AAGGGCATGCTGTTGGAGACCGG - Intronic
1133138569 16:3728951-3728973 CATGGGCTGCTGCTGGGGAAGGG + Exonic
1133485907 16:6218200-6218222 CCTGGCATACTCAAGGAGAATGG - Intronic
1137399201 16:48139625-48139647 CAAGGAAGGCTGAGGGAGAAGGG - Intronic
1138269498 16:55685038-55685060 AAATGCATGCTGATGGAGACAGG - Intronic
1138593580 16:58017009-58017031 ATTGGAATGATGATGGAGAATGG + Intronic
1139214004 16:65109726-65109748 CTTGGCATGTGGATGGAAAATGG - Intronic
1139666962 16:68464036-68464058 CAAGGCCTGCTGGGGGAGAAGGG - Intergenic
1140249398 16:73282200-73282222 CATTGCTTACTGATGGAAAAGGG - Intergenic
1144923816 17:18786041-18786063 CATGGCATTAAGATGGGGAAGGG - Intronic
1145918048 17:28588267-28588289 CATGGCATGCTGATGGAGAATGG + Intronic
1147609282 17:41792196-41792218 CATGGCAGCCCCATGGAGAACGG - Intergenic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148985295 17:51615618-51615640 CATTGCATGCTGCTGGTGGAAGG + Intergenic
1149292818 17:55233867-55233889 AATGTCATGGTGATAGAGAAAGG - Intergenic
1150781588 17:68127417-68127439 GAAGGCATGCCCATGGAGAAGGG + Intergenic
1150913571 17:69413501-69413523 CACAGCACCCTGATGGAGAACGG - Intergenic
1152608379 17:81304034-81304056 CCTGGCATGCAGAGAGAGAAGGG - Intergenic
1153795010 18:8613694-8613716 CATGCAATGCTGTTGGAGCAAGG - Intronic
1155215743 18:23641637-23641659 GATGGCATGTTGATGGTGAGAGG + Intronic
1155552511 18:26980572-26980594 AAAGGCAGGCTGATGGAGAAGGG - Intronic
1157914741 18:51654375-51654397 GATCACATGCTGATGGAAAATGG + Intergenic
1158091026 18:53713624-53713646 CATGGCATGATAGTGGTGAATGG + Intergenic
1158411807 18:57212197-57212219 CCTGGCATGATGAAGGAGCATGG - Intergenic
1163333461 19:16656569-16656591 CATGGCATGTGCATGGGGAAGGG + Intronic
1166356238 19:42229211-42229233 CAGAGCAAGCTGATGGATAAGGG - Intergenic
1167203588 19:48085098-48085120 CTTGGCAGGTTTATGGAGAAGGG - Exonic
925512226 2:4640887-4640909 CATGGCATGCAGATGGACAATGG - Intergenic
926772670 2:16392356-16392378 CCTGACAAGCTGATGGACAAGGG + Intergenic
926805530 2:16707226-16707248 CAAGGCATGCAGATTTAGAATGG + Intergenic
928293432 2:30060562-30060584 CATGCCATGCTGCAGGGGAATGG - Intergenic
929374653 2:41270597-41270619 CATTGCTTGCGGATGGAGACAGG + Intergenic
931489187 2:62725731-62725753 CATGGGCAGCTGATGGAGCAAGG + Intronic
931987870 2:67758634-67758656 GATAGCATGTTGAAGGAGAAGGG - Intergenic
933630971 2:84657090-84657112 AAAGGCAATCTGATGGAGAAAGG - Intronic
938227079 2:129625471-129625493 AACAGCATGATGATGGAGAATGG + Intergenic
939447823 2:142333205-142333227 CATGACATGTTAATGCAGAAGGG + Intergenic
941432313 2:165427161-165427183 GATGGCATGTTGATGGCAAAAGG + Intergenic
942582963 2:177440951-177440973 CATGGCATGCTGTTGAAAAAAGG - Exonic
944302856 2:198144123-198144145 CATGCCATGCTGTGGGAAAAGGG + Intronic
947017377 2:225636397-225636419 CTTGGCATCCTGAAGGAGATGGG - Intronic
1170314965 20:15031900-15031922 GATGGCATGCTGATGGCGGGAGG - Intronic
1170697354 20:18671118-18671140 CAAGGCAGGTGGATGGAGAAAGG + Intronic
1172020086 20:31907984-31908006 CCTGGCATGGTGGTGGAGAATGG + Intronic
1172080798 20:32339074-32339096 GATGGAATGGGGATGGAGAACGG + Intergenic
1172655484 20:36534285-36534307 CATGGGAGGCTGAGGCAGAAGGG + Intergenic
1173407223 20:42777166-42777188 CAGGGAGTGCTGCTGGAGAAGGG - Intronic
1173439496 20:43063414-43063436 CATGGAGTGGTGATGGAGGAAGG - Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1175821566 20:61912941-61912963 CATGGGAAGGTGATGGAGACTGG + Intronic
1176069979 20:63221218-63221240 GATGTCATGCCGATGGAGCAGGG - Intergenic
1178282715 21:31297302-31297324 GATGGCAAGCTGTTGGTGAATGG + Intronic
1178946185 21:36949684-36949706 CATGTCATTCTCATGCAGAAGGG - Intronic
1179534383 21:42041952-42041974 CAGGGCAGGCTGAAGGACAAAGG + Intergenic
1180902526 22:19385162-19385184 CATGGCTTCCAGATGAAGAAGGG + Intronic
1184775798 22:46622086-46622108 CATTGCATTCTGATGGTGACAGG + Intronic
949140029 3:620731-620753 CATGGCAGACAGATGTAGAATGG - Intergenic
950997324 3:17516858-17516880 CAGAGCATGTTGAGGGAGAAGGG - Intronic
951739606 3:25905914-25905936 CTGGGCAGTCTGATGGAGAATGG + Intergenic
951938948 3:28055792-28055814 AGTGGCAGGGTGATGGAGAATGG - Intergenic
953215841 3:40917350-40917372 CAGGAAATCCTGATGGAGAATGG - Intergenic
953718293 3:45334286-45334308 CAGTGCATGTTGATGGAGCACGG - Intergenic
954976405 3:54699277-54699299 CATGGGATGCTGGAGGAGCAAGG + Intronic
955095132 3:55789690-55789712 CATGGTATGCTGGAAGAGAAAGG + Intronic
955593200 3:60559945-60559967 CATGCCAGGCTGTTGGGGAAAGG + Intronic
956272325 3:67461440-67461462 GATGGCATTCTGAGGGGGAAGGG + Intronic
957555229 3:81758353-81758375 CATGGCAAGCTGATGGGCACTGG + Intronic
961522647 3:127476005-127476027 CATGGCATGTTGCTGGGAAATGG - Intergenic
966701517 3:182857955-182857977 CATGGCAAGCTGAAGAAAAATGG + Exonic
971030279 4:22629339-22629361 AAAGGCAGGCTGATGGAGAAGGG - Intergenic
972050928 4:34732303-34732325 CAAGGCCTGCTTATGGAGATAGG - Intergenic
972916372 4:43884888-43884910 CCTGGAATGAAGATGGAGAAAGG + Intergenic
975757404 4:77584328-77584350 CAAGGCATGCTGATGGACTTAGG - Intronic
976149938 4:82081565-82081587 CATGGCATGCCGATGGCGGGAGG - Intergenic
976244091 4:82990150-82990172 CATGGCATTCTGAAGGAGGAAGG - Intronic
977983620 4:103356712-103356734 CATGGGATGATGAAGTAGAAAGG - Intergenic
980257679 4:130403125-130403147 AAATGCATGCTGATGGAAAAGGG + Intergenic
983830353 4:172319180-172319202 CATGGCTTGCTGATTTGGAAAGG - Intronic
984314005 4:178102823-178102845 CTTGGCAGGCTGAGGCAGAATGG - Intergenic
987574512 5:19707909-19707931 CATGGCATGCAGATGGAGAAGGG - Intronic
987749172 5:22017648-22017670 AATGGCATGCAGCTAGAGAAAGG + Intronic
989186779 5:38633629-38633651 CATGGCGTGCCAATGTAGAAGGG - Intergenic
989798915 5:45511123-45511145 CATGGAGAGCTCATGGAGAATGG - Intronic
990515805 5:56529958-56529980 CAGGGCCTGCTTGTGGAGAAGGG - Intronic
990552280 5:56894942-56894964 CATGGAATCCTGAAGGAAAATGG + Exonic
993222877 5:85124933-85124955 CAAGGCAATCTGATGGGGAAAGG - Intergenic
995429914 5:112062808-112062830 CATGTACTGGTGATGGAGAATGG + Intergenic
996205259 5:120726519-120726541 AATGGCATGCAGATGGGAAAAGG + Intergenic
997779504 5:136642505-136642527 CATGGTTTGGTGATAGAGAATGG + Intergenic
998616029 5:143741498-143741520 CATGGCATTCTGAGAGAGATCGG + Intergenic
999523573 5:152378141-152378163 CATGCCAGGCTCATGGATAAAGG + Intergenic
1000089242 5:157915838-157915860 CAGGCCAGGCTGCTGGAGAATGG + Intergenic
1001585669 5:172832559-172832581 CCTGGCAGCCAGATGGAGAAAGG + Intergenic
1001591913 5:172871405-172871427 CATGACATGCAAATGGAGATCGG - Intronic
1002639862 5:180625641-180625663 CTTGGCCAGCTGATGGAGGATGG + Intronic
1002678053 5:180935296-180935318 GATGGCATGTTGATGGTGGAAGG - Intronic
1002700981 5:181124652-181124674 GAGGCCATGATGATGGAGAAGGG + Exonic
1002783580 6:384694-384716 CAGGGCGTGCTGTGGGAGAAGGG + Intergenic
1005089746 6:22043818-22043840 CATGCTGTGCTGATGGAGGAGGG + Intergenic
1007875032 6:45088285-45088307 CATGACATGCTAAAGCAGAAGGG + Intronic
1008128558 6:47695064-47695086 CATGTGGTGCTGATGGAGGAGGG + Intronic
1008140539 6:47826808-47826830 CATGCTATGCAGTTGGAGAAGGG + Intronic
1008811008 6:55498913-55498935 CCTGACATTCTGATGGAGATTGG + Intronic
1010741540 6:79511288-79511310 CATGGAATACTCAGGGAGAAAGG + Intronic
1011425029 6:87218602-87218624 CATGAAAAGCTGATGGAGAATGG + Exonic
1015006551 6:128288958-128288980 CATGGGATTCAGATGGAAAATGG - Intronic
1016126385 6:140408810-140408832 CAGGGCTTGCTGATGCAGAGTGG - Intergenic
1016674064 6:146743006-146743028 CAAGGCATTCTGCTGCAGAAAGG - Intronic
1017754849 6:157520782-157520804 CATAGAATGCTGATAAAGAATGG + Intronic
1018042098 6:159933830-159933852 CAGGGGAAGCTGATGGGGAATGG + Intergenic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1018566810 6:165163180-165163202 CAGGGCATGATGATGGAAGAAGG + Intergenic
1020155618 7:5721643-5721665 CATGCATTGCTGATGGAGGAAGG - Intronic
1021339251 7:19442638-19442660 TATTGCATGCTGTAGGAGAAGGG - Intergenic
1021441447 7:20681586-20681608 GATGGAATGCTGGCGGAGAAAGG + Exonic
1021486698 7:21175717-21175739 CTTGGGAAGCTGATGGAGAAGGG + Intergenic
1022502747 7:30892874-30892896 GGTGGCCTGCTGATGAAGAAGGG + Intergenic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1024643258 7:51349397-51349419 CTTGGGAGGCTGATGCAGAATGG - Intergenic
1024852795 7:53741084-53741106 GATGGCATGCTGGTGGGGATGGG - Intergenic
1026422951 7:70259469-70259491 CCTGGCATGCCCATTGAGAAGGG + Intronic
1026675421 7:72424270-72424292 CATAACTTGCTGATGGAGGAAGG - Intronic
1027936609 7:84612121-84612143 AATGGCATGCTAACGGGGAAGGG + Intergenic
1028837635 7:95392959-95392981 CAAGGGATTCTGTTGGAGAAGGG - Intronic
1029846413 7:103416694-103416716 TATGGCAAGCAGATGGACAAGGG - Intronic
1029900770 7:104036761-104036783 CAGGGCTTGCTTATGGAGAAAGG + Intergenic
1029947554 7:104549110-104549132 CCTGGTACGCTGGTGGAGAAAGG + Intronic
1030741552 7:113115692-113115714 CATTGGGTGCTGATGTAGAAAGG - Intergenic
1032697711 7:134351717-134351739 CCTGGCTTGCTGCTGGAGTATGG - Intergenic
1033024450 7:137759017-137759039 CATGGCATACTGGTGGGGATTGG + Intronic
1034541333 7:151760186-151760208 CAAAGCAGGCTGATGGAGACAGG - Intronic
1034908091 7:154968710-154968732 CAGGGCATGCTGCTGCTGAAAGG + Exonic
1039100536 8:33937029-33937051 GATGGCATACTCATGGAGACAGG + Intergenic
1042485702 8:69343378-69343400 CATTGAATGCTCAGGGAGAAGGG - Intergenic
1043270191 8:78323493-78323515 CAATCCATGCTGATGGAGTAAGG - Intergenic
1045048382 8:98300858-98300880 CATGACCTGCTGATGGGGCAGGG + Intergenic
1045108979 8:98921440-98921462 CATGGAGTGCTGAGGGAGGAAGG + Intronic
1045210459 8:100092614-100092636 CATGGCATGATGTGGGAGGAAGG + Intronic
1045886473 8:107104236-107104258 CATGGCATTCTAATAGAAAATGG - Intergenic
1046071412 8:109259469-109259491 GATGGAATGCTGACAGAGAAAGG + Intronic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1048334196 8:133490875-133490897 CAAGTCATGCTCATGGAGACCGG - Intronic
1053173739 9:35908162-35908184 CAGGGCATGGGAATGGAGAAGGG - Intergenic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1057763225 9:97892875-97892897 CATGGGGTGCTGAGGGAGAAAGG - Intergenic
1058111408 9:101034255-101034277 CTTTGCATGCTCTTGGAGAAAGG - Intronic
1058680769 9:107438503-107438525 ATTGGCATGCAGATGGAGAAGGG - Intergenic
1059724080 9:116988944-116988966 CATGGCATTCTCATGAATAAGGG - Intronic
1061251359 9:129428341-129428363 CCTTGCAGACTGATGGAGAAAGG + Intergenic
1061873022 9:133530689-133530711 CCTGGGATGGTGGTGGAGAAAGG - Intergenic
1061875679 9:133542404-133542426 CAGGGCATGCAGAGGGAGAGTGG + Intronic
1062564921 9:137160054-137160076 CATGGCATGGGGGTGGGGAAGGG - Intronic
1189290196 X:39879437-39879459 CATGGCAGGCTTGTGCAGAAGGG + Intergenic
1189397459 X:40635728-40635750 CATGGCATGGGGCTGGAAAAGGG - Intronic
1194985436 X:100485124-100485146 TTTGGCATGCTGATGCTGAAAGG - Intergenic
1195958623 X:110361681-110361703 CATGGAAGGCAGATAGAGAATGG - Intronic
1197084793 X:122459142-122459164 CAAGGAATGTGGATGGAGAAGGG + Intergenic
1197135497 X:123055090-123055112 TATGCCTTGCTGATGGGGAAGGG - Intergenic
1197638458 X:128942290-128942312 ATTGGGATGCTGATGGAGAATGG + Intergenic
1198411820 X:136377573-136377595 CATGGCTTCCTGATAGACAAAGG - Intronic
1198973726 X:142311176-142311198 CATGGCATGCTCATACAAAATGG - Intergenic
1200115488 X:153768072-153768094 CATAGCATCCAGAGGGAGAAAGG - Intronic