ID: 1145918150

View in Genome Browser
Species Human (GRCh38)
Location 17:28588980-28589002
Sequence AGTAGCTAAAAGACCACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145918150 Original CRISPR AGTAGCTAAAAGACCACTGT TGG (reversed) Intronic
900286692 1:1904663-1904685 AATAGCTAAAGGACCACCCTGGG - Intergenic
901913947 1:12483526-12483548 ACTGGCTAAATGACAACTGTTGG - Intronic
905921561 1:41722692-41722714 ACTAGCAAAAAGACAATTGTTGG + Intronic
906473640 1:46151941-46151963 AGAATCTAAAAGACCACCCTGGG + Intronic
911560009 1:99393618-99393640 AACAGCTAGAGGACCACTGTAGG + Intergenic
912927111 1:113922929-113922951 AGGAGCTGAAGGACCAGTGTGGG - Intergenic
916233725 1:162564577-162564599 AGAAGTTAAAAGACAACTGCAGG - Intronic
916432353 1:164743118-164743140 AATAGCTAAAATACCACTACAGG - Intronic
917369597 1:174277022-174277044 AGTAACCAAAAGTCTACTGTGGG - Intronic
918778972 1:188671640-188671662 AGTAGTAAAAAGACTACTATAGG - Intergenic
918997410 1:191780294-191780316 AAAAGATAAAAGATCACTGTTGG + Intergenic
920328416 1:205185507-205185529 TGTAGCTTAAAAAACACTGTTGG - Intronic
920801880 1:209196016-209196038 AGTATCTGAAAGATCAGTGTTGG - Intergenic
923249871 1:232169774-232169796 AGTAGCTGAAAGCCCATTGAGGG + Intergenic
1067832298 10:49617145-49617167 AGTGGCAAAAAGACAAGTGTGGG - Intronic
1074173914 10:110976517-110976539 AGGAGTTTAAAGACCACTCTGGG - Intronic
1074984507 10:118645196-118645218 AGGAGGTAAAAGACCTCTATAGG - Intergenic
1077828079 11:5831905-5831927 AGCAGCCAAAAGAGCCCTGTGGG - Intronic
1078259621 11:9693326-9693348 AGTAGTTAAATGAGCAGTGTGGG - Intronic
1080395031 11:31882363-31882385 AGTAGCTTAAAGACAATTGGAGG + Intronic
1081108734 11:39105385-39105407 AGTAACTAAAAGAGTACAGTTGG + Intergenic
1081393300 11:42555587-42555609 AGAAGCTGAAAGACTTCTGTTGG + Intergenic
1082111126 11:48275608-48275630 AGTAGCTCAAACAACTCTGTAGG - Intergenic
1085841356 11:80014865-80014887 AGGAGCTAAGAGACAATTGTGGG + Intergenic
1086600172 11:88623824-88623846 AGTAGCTAGAAGACCAAGTTTGG - Intronic
1090173880 11:124630509-124630531 ACAGGCTAAAAGATCACTGTTGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1106027265 13:25967079-25967101 AGGAGATAAAAGACCACTTTTGG + Intronic
1109388517 13:61665036-61665058 AGTAGCTGAAAGAACACTTAGGG + Intergenic
1114042315 14:18690422-18690444 AGTAGCTAAAAGAGTACAATTGG + Intergenic
1116204376 14:41843990-41844012 AATAGCTAAAAGAACAATGGAGG + Intronic
1117963846 14:61187887-61187909 AGAAGGATAAAGACCACTGTGGG - Intronic
1119181993 14:72611544-72611566 AGCAGGGAAAAGACCACTGTGGG + Intergenic
1120391476 14:83914063-83914085 AATAGCTGAAACACCACTCTAGG + Intergenic
1126804850 15:52337659-52337681 ACTGGCTAAAAGACAGCTGTGGG + Intronic
1127989414 15:64101007-64101029 AGTAGTTAAGAGACCAGTCTGGG - Intronic
1133117304 16:3584722-3584744 GGGAGGGAAAAGACCACTGTGGG + Intronic
1133654230 16:7844236-7844258 AGAAGCTTAAAGACCAATCTGGG - Intergenic
1135250486 16:20897415-20897437 ATTAGATAAATGACCATTGTGGG - Intronic
1136596541 16:31254171-31254193 AGTAGGTAAAAGTACAGTGTTGG - Intergenic
1137037711 16:35580361-35580383 AGAAGCTAAAAGTCCTCTTTGGG + Intergenic
1137553281 16:49454910-49454932 AGGTGCTCAGAGACCACTGTAGG + Intergenic
1140085765 16:71795159-71795181 AGTAGCTGAAAGTGCACAGTGGG - Intronic
1141056142 16:80816474-80816496 AGTGTCCAAAAGAACACTGTGGG + Intergenic
1141872782 16:86799818-86799840 AGTAGTCAAAAGAGCAGTGTTGG - Intergenic
1144182836 17:12768857-12768879 AGTGGCTAAAATACCAAAGTTGG + Exonic
1145918150 17:28588980-28589002 AGTAGCTAAAAGACCACTGTTGG - Intronic
1151205486 17:72503354-72503376 AGAAGCTTAAAGACCACAATGGG - Intergenic
1152674308 17:81629872-81629894 AGATGCTAAAAGACCACAGATGG - Intronic
1152741820 17:82021751-82021773 AGTAGCCAAAAGGCCACTGCCGG - Intronic
1153072121 18:1117279-1117301 AGTAGCAGAAAGAGCCCTGTGGG - Intergenic
1153596201 18:6727926-6727948 TGAAGTTAAAAAACCACTGTAGG - Intergenic
1157089501 18:44619700-44619722 CATAACTAAAAGAGCACTGTTGG + Intergenic
1157507418 18:48238601-48238623 AGCAGCAAAAAGATCTCTGTAGG + Intronic
1168581928 19:57562454-57562476 AGTAGATAAAATACAACTGAAGG - Intergenic
925268933 2:2588434-2588456 AGTAGCTAAAAGACCACACTTGG - Intergenic
928659367 2:33485372-33485394 AGAAGCTAAAAGAAGACTGCAGG - Intronic
931612300 2:64115216-64115238 AGTAGCTATAAGGCTACTGCTGG + Intronic
936060158 2:109289978-109290000 AGTTGCAAACAGACCACTGGGGG + Intronic
936716169 2:115190138-115190160 TGTAGTTAATAAACCACTGTTGG + Intronic
938106772 2:128536969-128536991 GGTTTCTAAAAGACCAATGTTGG - Intergenic
940329178 2:152455921-152455943 AGGAGTTAAAAGACCACACTGGG - Intronic
940750573 2:157622888-157622910 AGGAGCTAAAATAACACTGTAGG + Intronic
941338399 2:164273554-164273576 AATAGCAAAAAGAGCATTGTGGG - Intergenic
942158467 2:173156730-173156752 GGTTCCTAACAGACCACTGTTGG + Intronic
943015658 2:182507245-182507267 AGAAGCTAAGAGATCATTGTGGG + Intronic
943608920 2:190009089-190009111 AATAGCTAGAAGACCACTGTGGG + Intronic
944463845 2:199980543-199980565 AGTAGCTATAGGACTACTGCTGG + Intronic
949007279 2:241656771-241656793 AGCACCTGAAGGACCACTGTAGG - Intronic
1172768990 20:37367025-37367047 AGAATCTAAAAGACAAATGTTGG - Intronic
1179491779 21:41745723-41745745 AGGAGACAAAAGACCCCTGTGGG + Intronic
1180695435 22:17748864-17748886 AGTGTCCAAAAGACCACTCTGGG - Intronic
1182882940 22:33749042-33749064 ATTTGTTAAATGACCACTGTCGG + Intronic
949113523 3:292464-292486 AGTGTCTACAAGACCACTGGTGG + Intronic
950624621 3:14235803-14235825 TGGAGCTACAAGGCCACTGTGGG + Intergenic
951386336 3:22047910-22047932 ATTAGCAAAAAAACCAATGTAGG - Intronic
957243779 3:77692360-77692382 AGTATATCAAAGAGCACTGTAGG - Intergenic
957355627 3:79081926-79081948 CTTGGCTAAAAGACCAATGTAGG - Intronic
958048648 3:88317822-88317844 AGAAGCTAAAAGACTTCAGTGGG + Intergenic
959457744 3:106584289-106584311 AGTAGCTAAAAAACAAATATAGG - Intergenic
959629323 3:108490590-108490612 AATAGCAAAATGGCCACTGTGGG - Intronic
961541349 3:127601837-127601859 AGAATCAAAAAGACCAATGTTGG - Intronic
963323960 3:143840633-143840655 TATAGCAAAAAGCCCACTGTGGG - Intronic
966706566 3:182922878-182922900 AGTAGCAAAAAGAAAACTATGGG - Intergenic
966750212 3:183314803-183314825 GGTAGGTAAAAGACCACTCACGG + Intronic
967351568 3:188519509-188519531 AGTAGATAAAAGAACACTACTGG + Intronic
967413776 3:189194922-189194944 AGCAGCTAAGACACCACTCTAGG + Intronic
971173346 4:24256979-24257001 GGTGACAAAAAGACCACTGTAGG + Intergenic
973749773 4:54003036-54003058 GATAACTAAAACACCACTGTGGG + Intronic
974879569 4:67737624-67737646 AGTAGCTAAAAAAATACTCTGGG - Intergenic
974920061 4:68227869-68227891 AGGAACATAAAGACCACTGTAGG - Exonic
979218231 4:118192144-118192166 AGTAGCTCAAACAGCACTGTAGG - Intronic
981081025 4:140639551-140639573 AGTAGCTAAAGGTGTACTGTAGG - Intronic
983101158 4:163627161-163627183 AGAGGCCAAATGACCACTGTTGG - Intronic
984204777 4:176773331-176773353 AGTAACTAAAAGGCCCCAGTGGG - Intronic
986168758 5:5298324-5298346 AGTAGGTAAATGAGCACAGTAGG - Intronic
990497352 5:56361906-56361928 AGAACCCAAAAGAACACTGTTGG - Intergenic
992512726 5:77455144-77455166 AATATCTAAAAGACAAGTGTTGG - Intronic
994354565 5:98780585-98780607 AGTAACTAAACCACCACTGTGGG - Intronic
997939084 5:138140297-138140319 AGTAGCTAGAAGACATTTGTGGG - Intronic
1000852675 5:166359603-166359625 AGTTGCTAAAAGACACCTGACGG + Intergenic
1004288509 6:14345449-14345471 AGTATCTAAAAGTCTACTCTTGG - Intergenic
1004316771 6:14595495-14595517 AGTTGATAAAAGACCTCTGTAGG - Intergenic
1013178925 6:107701492-107701514 AGTAGCAACCAGACCACAGTGGG + Intergenic
1013184122 6:107743017-107743039 GGCAACTAAAAGTCCACTGTAGG + Intronic
1015268565 6:131315456-131315478 AGGAGGTAAAAGATCTCTGTAGG - Intergenic
1015425582 6:133062757-133062779 AATAGATAAAAGAGCATTGTGGG + Intergenic
1015771718 6:136774705-136774727 AATAACTAAAACACCACTGGGGG + Intronic
1016734069 6:147456854-147456876 AGGAGTAAAAAGACCACGGTTGG + Intergenic
1019113913 6:169741239-169741261 AGAAGCTACAAGACCTCTGAAGG - Intronic
1022165958 7:27762486-27762508 AGGAGTTAAGAGACCAGTGTGGG + Intronic
1023947525 7:44815206-44815228 AATTGTTAAAAGACCAGTGTAGG + Intronic
1028165635 7:87535236-87535258 AGTAGATGGAAAACCACTGTAGG - Intronic
1032852676 7:135808681-135808703 GGTAGGTCAAAGACCACCGTGGG + Intergenic
1034259752 7:149747516-149747538 AGTTGGTAAAAGACCACTTCTGG - Intergenic
1034465166 7:151223707-151223729 AGAAGCTAAAAGACTTCAGTGGG - Exonic
1036923938 8:12885563-12885585 AGTAGCTAAGAGACTGCTGAGGG - Intergenic
1037574957 8:20193358-20193380 AGTAGCTGAAGTACCACTGCTGG + Intergenic
1039024074 8:33238734-33238756 ATTACATAAAAGTCCACTGTGGG - Intergenic
1039764064 8:40609341-40609363 AGTAGCTCATAGACCAATGCTGG - Intronic
1042831373 8:73032835-73032857 AGTACCTAAAATATTACTGTGGG - Intronic
1043107916 8:76138208-76138230 AGTAACTAAAAGGCCAGTGTTGG - Intergenic
1048517114 8:135121164-135121186 AGGAGCTCACAGACCACTGAAGG + Intergenic
1050019828 9:1271239-1271261 AGTATCTCAAATACCAGTGTTGG - Intergenic
1050375984 9:4973603-4973625 AGTAGCAACAAGACCAATATGGG - Intergenic
1051971166 9:22889506-22889528 AGTAGTAAAAAGACCGCTGGTGG + Intergenic
1052569504 9:30201368-30201390 GGTAGCTAAAAGAACACTCAGGG - Intergenic
1055219575 9:73912599-73912621 AGTAGGTATAAAAGCACTGTTGG + Intergenic
1055236394 9:74128248-74128270 AGTAGAAGAAAGACCAGTGTAGG - Intergenic
1055720203 9:79164565-79164587 AGTAGCTACTAAGCCACTGTCGG + Intergenic
1057414909 9:94852606-94852628 TGTGGCTCAAAGACCACTGGGGG + Intronic
1058044507 9:100341936-100341958 TGTGGCGAAAAGACCACTGGAGG - Intronic
1060446358 9:123691846-123691868 AGTAAGTAAAAGAGCACTGACGG - Intronic
1061818713 9:133210795-133210817 AGTATCTAAAAGGACACAGTTGG - Intergenic
1062125992 9:134863413-134863435 GGTAGCTAAAAGCCCACGGCAGG - Intergenic
1062241679 9:135544239-135544261 AGCATCTAAAAGAACACAGTTGG + Intergenic
1186193981 X:7093680-7093702 AGTAGATAAATGACCACAATGGG - Intronic
1186962983 X:14757661-14757683 AGCAGCAAAAAGAGCCCTGTGGG + Intergenic
1187007384 X:15246025-15246047 AGCAGCAAAAAGCACACTGTGGG + Intronic
1187204488 X:17169376-17169398 AGTAGGTAAAGAAGCACTGTGGG + Intergenic
1187932250 X:24304138-24304160 AGTAGATAATAGACAACTATAGG + Intergenic
1191829345 X:65399308-65399330 AGGAGCTAAAACACCTCTATAGG + Intronic
1191889807 X:65928313-65928335 TGTAGTTAATAGATCACTGTTGG + Intergenic
1193240517 X:79163905-79163927 AGTACCTAAAAGATTATTGTGGG + Intergenic
1193359057 X:80559322-80559344 TGTAGCTAAAACACTACTGAGGG + Intergenic
1196221933 X:113121503-113121525 AGTAACTGAAAGAACACAGTGGG - Intergenic
1196251372 X:113464152-113464174 AGTAGCTTAAAGAACTCTCTAGG - Intergenic
1198011033 X:132554468-132554490 AGTAGTTGACAGACCACTGTGGG + Intergenic
1201565928 Y:15365346-15365368 AGTAGATAAATGACCACGTTCGG - Intergenic