ID: 1145920995

View in Genome Browser
Species Human (GRCh38)
Location 17:28609967-28609989
Sequence CACTTCAACCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145283
Summary {0: 6, 1: 484, 2: 9491, 3: 42040, 4: 93262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145920992_1145920995 8 Left 1145920992 17:28609936-28609958 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1145920995 17:28609967-28609989 CACTTCAACCCAGGAGACGGAGG 0: 6
1: 484
2: 9491
3: 42040
4: 93262
1145920990_1145920995 9 Left 1145920990 17:28609935-28609957 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1145920995 17:28609967-28609989 CACTTCAACCCAGGAGACGGAGG 0: 6
1: 484
2: 9491
3: 42040
4: 93262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145920995 Original CRISPR CACTTCAACCCAGGAGACGG AGG Intronic
Too many off-targets to display for this crispr