ID: 1145921989

View in Genome Browser
Species Human (GRCh38)
Location 17:28616540-28616562
Sequence CTGAGACTTCAGAACGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145921989_1145921996 11 Left 1145921989 17:28616540-28616562 CCATCCTCGTTCTGAAGTCTCAG 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1145921996 17:28616574-28616596 GTTGCTACCCTATTCTTCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 118
1145921989_1145921994 9 Left 1145921989 17:28616540-28616562 CCATCCTCGTTCTGAAGTCTCAG 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1145921994 17:28616572-28616594 GGGTTGCTACCCTATTCTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 57
1145921989_1145921995 10 Left 1145921989 17:28616540-28616562 CCATCCTCGTTCTGAAGTCTCAG 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1145921995 17:28616573-28616595 GGTTGCTACCCTATTCTTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145921989 Original CRISPR CTGAGACTTCAGAACGAGGA TGG (reversed) Intronic
901337337 1:8462469-8462491 CTGAGACTGGAGAACGAGTAGGG + Intronic
902772540 1:18653944-18653966 CTGAGACACCAGAACGAGAATGG - Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903543178 1:24108190-24108212 CTGAGACCCCAGTATGAGGAGGG - Intronic
904326450 1:29729713-29729735 TCCAGAGTTCAGAACGAGGAGGG + Intergenic
904434551 1:30485776-30485798 GTGAGACTTCAGAGTGAGGCAGG + Intergenic
905106784 1:35568033-35568055 CTGAGACTTCAGGGTGAGGAGGG + Intergenic
905947944 1:41919418-41919440 CTGAGACTGCAGAGCAAGGCAGG - Intronic
906333664 1:44909280-44909302 GTGAGTTTTCAGAAAGAGGATGG - Intronic
907157129 1:52344879-52344901 CTGAAACTTCTGAAGGAAGATGG + Exonic
915503199 1:156334496-156334518 TAGAGACTTCAGAAGGAGCATGG + Intronic
916459483 1:165008662-165008684 CTGAACCATCAGAACCAGGATGG - Intergenic
918625437 1:186651714-186651736 CTGAGAGTTCAGAAAGAAGATGG - Intergenic
921782661 1:219185596-219185618 CTAAGAATTCAGAAGGGGGATGG + Intronic
921929873 1:220746514-220746536 CTGAGACTTGAACATGAGGAGGG - Intergenic
923539727 1:234879356-234879378 ATGAGACTTCAAAAAGTGGAAGG + Intergenic
1063383955 10:5604297-5604319 CTCAGACTTCAGAAGGAGGAGGG + Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063716597 10:8533531-8533553 CTGAGGCCACAGTACGAGGAGGG + Intergenic
1063900014 10:10722875-10722897 CTGAGATTTCAGAACTGGGCAGG + Intergenic
1065641365 10:27785986-27786008 CTGAGACCTCAGAATGTGGAGGG + Intergenic
1066182487 10:32976867-32976889 CTGAGAGTTCAGAATGTGCAGGG + Intronic
1068800589 10:61135919-61135941 ATGAGACTTCAGAATTATGAGGG - Intergenic
1068805167 10:61187064-61187086 ATTAGAATTCAGAAAGAGGATGG + Intergenic
1069102658 10:64342286-64342308 CAGAGATTCCAGAACTAGGATGG - Intergenic
1071837360 10:89431791-89431813 CTGAGTCTTCAGATTGAAGAGGG - Exonic
1072720710 10:97779343-97779365 CTGAGACTGCAGAGGGAGCAGGG - Intergenic
1075318068 10:121467958-121467980 CAGAGCCTTCAGAAGGAGCATGG + Intergenic
1077813418 11:5661580-5661602 CTGAGACTTCAGATCTATGCTGG - Intergenic
1079504546 11:21138821-21138843 CTAACACTTCACAAAGAGGAAGG - Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1084432051 11:69116564-69116586 CTGAGCCTTCAGGAGGAGGCTGG + Intergenic
1085254066 11:75162481-75162503 CTGTGACCTAAGAATGAGGAAGG + Intronic
1086869638 11:92021473-92021495 TTGAAACTCCAGAAGGAGGAGGG - Intergenic
1087092161 11:94284695-94284717 GGGAGACTTCAGAATGAGGAAGG + Intergenic
1087472190 11:98590139-98590161 CTGGGACTTCAAAAAGGGGAAGG + Intergenic
1088613507 11:111601892-111601914 CGGAGACATCAAAACGTGGAGGG + Intergenic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1090637119 11:128696138-128696160 CTGACACTTCAGGCCAAGGATGG + Intronic
1091055187 11:132411221-132411243 CTGAGCCTTCAGGAAGCGGAAGG - Intergenic
1092575400 12:9777059-9777081 AAGAGACTTCAGAATGAAGACGG - Intergenic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1099254465 12:80298523-80298545 CTGAGCCTTCAGAAATAGGGAGG - Intronic
1099558485 12:84142370-84142392 CGGAGGCTTCAGAACTAAGACGG - Intergenic
1102897381 12:116609554-116609576 CTGAGGCTTCAGAACAGGCAGGG + Intergenic
1104377352 12:128276547-128276569 CTGAGAACTCAGAAGGAGAAGGG - Intronic
1106464728 13:30002968-30002990 GAGAGACTTCTGAACGTGGATGG + Intergenic
1106907784 13:34426936-34426958 CTGAGATTTCAGAAAGAAGAAGG - Intergenic
1107565889 13:41604047-41604069 CTAAGACTTGAGAATGAGTATGG - Intronic
1107879047 13:44817273-44817295 TTGTGACTTCAGAACGTGGCAGG - Intergenic
1110678013 13:78273362-78273384 CTGGTAGTTCAGAAAGAGGATGG - Intergenic
1111438297 13:88241343-88241365 TTGAGACTTCTCAATGAGGAAGG + Intergenic
1112364689 13:98746876-98746898 CAGAGGCTTAAGAAGGAGGAAGG - Intronic
1113699842 13:112376213-112376235 CTGTGACATCAGGACCAGGAAGG - Intergenic
1113699862 13:112376278-112376300 CTGTGACATCACAACCAGGAAGG - Intergenic
1113866997 13:113532882-113532904 CTGCGACTTCAGTAGGAGGGAGG - Intronic
1113867033 13:113533101-113533123 CTGCGACTTCAGTAGGAGGGAGG - Intronic
1116147927 14:41099567-41099589 CTGTGACTTCAGAGGGTGGAAGG + Intergenic
1116150912 14:41141205-41141227 CAGAGCCTTCAGAAGGAGTATGG - Intergenic
1117472393 14:56059154-56059176 CCCAGACTTCATATCGAGGATGG + Intergenic
1120183479 14:81368809-81368831 CTGGGACTAGAGAATGAGGAGGG - Intronic
1120906370 14:89624531-89624553 CTGAGCCTGCAAACCGAGGATGG - Intergenic
1121071172 14:91023133-91023155 CTGAGACTAAGGAACAAGGATGG - Intronic
1121625235 14:95380433-95380455 CTGAGACTACAGAACAAGAAAGG - Intergenic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1125129146 15:36260745-36260767 CTTAGACTTCAGTACAAGGGGGG + Intergenic
1126064920 15:44819366-44819388 CAGAGACTGCAGCAAGAGGAGGG - Intergenic
1126094914 15:45081221-45081243 CAGAGACTGCAGCAAGAGGAGGG + Intergenic
1127283116 15:57509064-57509086 CTAACACTTCAGAGTGAGGAAGG + Intronic
1128789349 15:70421652-70421674 CTGAGACTCCAGAAAAAGGGAGG + Intergenic
1129303661 15:74642344-74642366 CTGACATTTCAGAAAGAGGTGGG - Intronic
1131337564 15:91564038-91564060 CTGAAAATTCAGAACCAAGATGG + Intergenic
1132620360 16:863822-863844 CTGAGATTTTAGAAAGAGGAAGG - Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133813932 16:9182138-9182160 CTAAGTCTTCAGAAAGAGGATGG - Intergenic
1138440026 16:57028635-57028657 CTGGGATTTCAGAAAGAGGGAGG - Intronic
1140507567 16:75483423-75483445 CTGAAACTCAAGAACTAGGAAGG + Intronic
1144036991 17:11376137-11376159 CAGAGACTGCAGGACAAGGAAGG + Intronic
1145038287 17:19556473-19556495 CAGAGGCTTCAGAACCAGGCAGG - Intronic
1145921989 17:28616540-28616562 CTGAGACTTCAGAACGAGGATGG - Intronic
1148193880 17:45699470-45699492 GTGAGAGCTCATAACGAGGAAGG + Intergenic
1153499550 18:5734151-5734173 CTGATCCTTCAGAAAGATGATGG + Intergenic
1153738895 18:8101843-8101865 CTGACCCTTCAGAACCAAGATGG + Intronic
1153859009 18:9180217-9180239 AACAGACTTCAGAACGAAGAGGG - Intronic
1156229075 18:35136531-35136553 CAGAGACTTCACAGCGAAGATGG + Intronic
1159033810 18:63258183-63258205 CTGAGCCTTCAGAACAAGTGTGG + Intronic
1160242614 18:77133755-77133777 CTCAGACTTCAGCACGGGGTCGG + Intergenic
1161966689 19:7552915-7552937 CTGAGACTTGACAACTAAGATGG + Intronic
1162892283 19:13742532-13742554 GTGAAACTTCAGAACGTGAAAGG + Intronic
1164789966 19:30968435-30968457 CTGAGCCTTCAGAGAGAGCATGG + Intergenic
1167096036 19:47375571-47375593 CTGAAACGCCAGCACGAGGAGGG + Exonic
929986188 2:46735117-46735139 CAGAGACTTCAAAATAAGGATGG + Intronic
931586212 2:63832284-63832306 CTGAGACTGCTGCATGAGGAAGG - Intergenic
933412192 2:81940520-81940542 CTGAGACTTAAGATAGAGGCAGG - Intergenic
936084457 2:109456893-109456915 CTGAGCCTTCAGAAAGTGGCAGG + Intronic
937376509 2:121339839-121339861 CTGAGAAGTCAGAACTAAGATGG + Exonic
939440903 2:142248089-142248111 CTCAGACTTAAGAAGAAGGAAGG + Intergenic
940756249 2:157686391-157686413 ATGAGAGTGCAGAACGAGAAAGG + Intergenic
941873746 2:170412448-170412470 CTGAGTCTTCAGACAGAAGAAGG - Intronic
944540307 2:200747953-200747975 CTGAAATTTCAGAATGATGACGG - Intergenic
948642682 2:239385519-239385541 CTGAGACTTCAGAGGGAACAGGG - Intronic
1168807141 20:678281-678303 CTGAGTCTTGAGAACAAGTAGGG - Intergenic
1169081923 20:2802558-2802580 CTAAGACATCAGAACCGGGAAGG - Intergenic
1170035531 20:11985638-11985660 CTCAGACTTCAGTACAGGGAGGG - Intergenic
1171246269 20:23612214-23612236 TTTTGACTTCAGAATGAGGATGG - Intergenic
1172620432 20:36315320-36315342 CTGAGACCTGAGAGTGAGGAGGG + Intronic
1173997029 20:47346315-47346337 CAGGGACTTCAGAGCAAGGAAGG - Intronic
1174582458 20:51581689-51581711 CTAAGTCTTAAGAATGAGGATGG - Intergenic
1174915052 20:54645243-54645265 CTGAGGGTTCAGAGCGAGCATGG - Intronic
1176152001 20:63596191-63596213 CTGTGCCTTTAGAAGGAGGAAGG - Intronic
1181455858 22:23059799-23059821 TTGAGACTGCACAAGGAGGAGGG - Intronic
1181725427 22:24807570-24807592 CTGAGACTGAAGAATGGGGAGGG - Intronic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182342474 22:29634865-29634887 CTCAGCCTTAAAAACGAGGAAGG + Intronic
1183098189 22:35567129-35567151 CTGAGGCTTCAGGAGGAGAAGGG - Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1185052178 22:48559678-48559700 CTGAGCCTTGAGGAGGAGGAAGG + Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951513280 3:23528515-23528537 CGGAGACTTAAGAAAGAGGCAGG - Intronic
955398175 3:58572428-58572450 CTGACAGTTGAGAATGAGGAAGG + Intronic
955807752 3:62755097-62755119 CTGAGACTTCAGAGAGGGGAAGG + Intronic
958598893 3:96267688-96267710 TTGAGACTTTAGAGAGAGGAAGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
961485316 3:127211825-127211847 CTGAGGCTTCAGTTGGAGGAGGG + Intergenic
963226349 3:142866364-142866386 CAGAGACCTGAGAACCAGGAGGG - Intronic
966292179 3:178372606-178372628 ATGACACTTGAGAAGGAGGAGGG - Intergenic
966508781 3:180736951-180736973 CTGAGATTCCAGAATGAGGCAGG + Intronic
968228007 3:196988033-196988055 CTGAGACTTCACAAAGGAGAGGG - Intergenic
971467522 4:26979465-26979487 CTGAAGCTTAAGAACGTGGAAGG + Intronic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
973676481 4:53268577-53268599 CAGAGCCTGCAGAATGAGGAGGG + Intronic
975885386 4:78958699-78958721 CAGAGACTTCAGAGGGAGCATGG + Intergenic
977920906 4:102641436-102641458 CTGAGACTACTGAAGGAGGAAGG + Intronic
978197691 4:105990317-105990339 ATGAGAGTTCAGAATGGGGAAGG + Intronic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
978806008 4:112801103-112801125 GTGTGAATTCAGAATGAGGAGGG + Intergenic
988802553 5:34710205-34710227 CAGAGACTTCAGAGGCAGGATGG - Intronic
989082533 5:37638838-37638860 CTCAGACTTCAGAAGGAGAAAGG + Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
990091463 5:52056211-52056233 CTGAGATATCAGAAGGAGAAAGG + Intronic
990160161 5:52929233-52929255 CTGAGATAGCAGAACCAGGAAGG + Intronic
990432408 5:55749209-55749231 CTGGGAGTTCAGAACCAGCATGG + Intronic
997735019 5:136206800-136206822 CTGAGGCTGCAGGAAGAGGATGG - Intergenic
998172696 5:139881851-139881873 CTGGGGCTTCAGAAAGAAGAGGG - Intronic
999933234 5:156456440-156456462 CTGACACTTTACAACAAGGATGG - Intronic
1001665121 5:173426435-173426457 CTGGGACTCAAGAACAAGGAGGG + Intergenic
1003162096 6:3644802-3644824 CTGTGACTTCTGAAGAAGGAAGG + Intergenic
1004289350 6:14352081-14352103 GTGAGATTTCAGAAAGAGGCTGG + Intergenic
1008148465 6:47920908-47920930 CTGAGATTATAGAAAGAGGAAGG + Intronic
1011880353 6:92016343-92016365 CTGTGACTTGAGAACAAGCACGG - Intergenic
1012132079 6:95508657-95508679 CTGAGATTTCAGAATGTGGCTGG + Intergenic
1013578680 6:111510525-111510547 CTGAGACTTCAGAAGGGCTAGGG - Intergenic
1015135741 6:129867990-129868012 CTGAGACTCCAGAGCACGGAAGG + Intergenic
1018391038 6:163342280-163342302 CAGAGACTGCAGAACCAGGTAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1024248833 7:47491079-47491101 CTGTGGCTTCAGCACGAGGCGGG + Intronic
1025110392 7:56211584-56211606 CTGATACTTCAGGGGGAGGAAGG - Intergenic
1029509000 7:100981532-100981554 GTGAGATTTCAGAAAGAGGAAGG + Intronic
1029812998 7:103068308-103068330 CTGAGACTTTAGAAAAAGGAGGG + Intronic
1030154789 7:106443314-106443336 CAGAGACTACAGTATGAGGAAGG + Intergenic
1033769288 7:144530669-144530691 TTGATGCTTCAGAACCAGGAAGG - Intronic
1034017178 7:147599593-147599615 CAGAAACTTCAGAAAGAGCATGG - Intronic
1036898791 8:12656504-12656526 CTGATATTAAAGAACGAGGATGG + Intergenic
1038832606 8:31078324-31078346 ATGACACCTCAGAACCAGGAGGG + Intronic
1039744839 8:40415380-40415402 ATGAGATTTTAGAAAGAGGAAGG + Intergenic
1040386554 8:46918290-46918312 CTGATCCTTCAGAGCCAGGATGG + Intergenic
1041640408 8:60193727-60193749 GTGAAACTTCAGAACATGGAGGG - Intronic
1043871831 8:85441660-85441682 CTGAGACCACAGAACTAGCAAGG + Intronic
1046658835 8:116926646-116926668 CTGCGAGTTCAGAAAGAGTAGGG + Intergenic
1047344505 8:124014033-124014055 GTGAGCCTTCAGAGAGAGGAGGG - Intronic
1049154817 8:141060018-141060040 CAGAGACTTCAGAGCGGGCAGGG - Intergenic
1049536675 8:143185829-143185851 CTGAGGCTTGGGACCGAGGAGGG - Intergenic
1050016746 9:1241725-1241747 ATGAGCCTACAGAACTAGGATGG - Intergenic
1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG + Intergenic
1053052677 9:34974962-34974984 CTGAGACATGAGAATGAAGAAGG - Intronic
1055249678 9:74288583-74288605 CTGAGACTTGAAACAGAGGAAGG - Intergenic
1057195339 9:93113285-93113307 CTGAGACTGAGGAACGAGGCAGG - Intergenic
1058418349 9:104811239-104811261 CTCAGTCTTCAGGAGGAGGAAGG - Intronic
1059670171 9:116483820-116483842 CTGACACTGCAGAACAGGGAAGG + Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1060664369 9:125424038-125424060 CTCAGGCTCCAGAACCAGGACGG - Intergenic
1190066062 X:47242523-47242545 GTGAGACTGCAGAAGGAGGCTGG + Intronic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1192055544 X:67769530-67769552 CTCAGACTTCAGAATAAGGAAGG + Intergenic
1192544135 X:71998713-71998735 CTGAGAGTGCAGAAAGATGAAGG - Intergenic
1194826736 X:98574543-98574565 CAGAGACTTAAGAAAGAGGAGGG - Intergenic
1196882129 X:120208043-120208065 CTGAGACTTCATCATTAGGAAGG + Intergenic
1199326958 X:146510607-146510629 CAAAGACTTAAGAACCAGGAGGG - Intergenic
1199361470 X:146924420-146924442 TGGGGACTTCAGAAGGAGGAGGG - Intergenic
1200961845 Y:9003101-9003123 CAGAGATTTCAGAGAGAGGAAGG + Intergenic