ID: 1145923032

View in Genome Browser
Species Human (GRCh38)
Location 17:28625717-28625739
Sequence CAGTGGGAATGGAGATAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 472}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145923032_1145923040 27 Left 1145923032 17:28625717-28625739 CCATCTTATCTCCATTCCCACTG 0: 1
1: 0
2: 6
3: 52
4: 472
Right 1145923040 17:28625767-28625789 TTTTTTTTCTTCCCTTGAGATGG 0: 1
1: 37
2: 455
3: 4654
4: 95022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145923032 Original CRISPR CAGTGGGAATGGAGATAAGA TGG (reversed) Intronic
900037136 1:423881-423903 TAGTGGAAATAGAGATAAGGAGG + Intergenic
900058766 1:659622-659644 TAGTGGAAATAGAGATAAGGAGG + Intergenic
901004398 1:6164900-6164922 CAGGGGGAAGAGAGAAAAGACGG + Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902136659 1:14312082-14312104 TGGTGGGAATAGAAATAAGAGGG + Intergenic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904463304 1:30693151-30693173 CAGTGGGGAGAGAGATATGATGG - Intergenic
904765916 1:32846545-32846567 CAGTAAGTATGGAGATAAAATGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905272916 1:36798506-36798528 CAGTGGGCATGGAGCTGAGCTGG - Exonic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906918726 1:50040583-50040605 CACTGGGAAGGGACATAAGGTGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907307822 1:53523335-53523357 CAGTGGGAAAGAAGATGGGAGGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
909216343 1:72895279-72895301 CAGTGGGAATCTAGATCATATGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909865739 1:80667953-80667975 CTGGAGGAATAGAGATAAGATGG + Intergenic
910063562 1:83123991-83124013 CACTTGGAATGGACTTAAGAGGG - Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
911855033 1:102865749-102865771 CAGTGGTAATGAAGATAAAGAGG + Intergenic
911961560 1:104310343-104310365 GAGCGGAAATGGAGATAACATGG + Intergenic
912255330 1:108052645-108052667 CAGTGGGACTGGGCATAGGAAGG + Intergenic
912570891 1:110620201-110620223 CAGAGGGAAAGGAGAAGAGAGGG - Intronic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
912921764 1:113875213-113875235 AAGTGGGAATGGGGCTAAGTGGG - Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913405422 1:118485736-118485758 CAGTCTGCATGGAGATAAGGAGG - Intergenic
914199579 1:145472936-145472958 CAGTTGCTATGGAGATCAGATGG + Intergenic
914478694 1:148046069-148046091 CAGTTGCTATGGAGATCAGATGG + Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915309097 1:154998392-154998414 GAGTAGGAATGGAGACAGGAGGG + Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915887658 1:159740473-159740495 CAGAGGGTCTGGGGATAAGATGG + Intergenic
916117106 1:161495038-161495060 CAGGGGGTATGAATATAAGAAGG - Intergenic
916478513 1:165193403-165193425 GAATGGGAATGGAGATAAAAGGG - Intergenic
916612652 1:166408524-166408546 CAGTGAGAATGGAAACAAGTTGG - Intergenic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917165505 1:172108016-172108038 GAGTGAGAATGGAGACCAGAAGG - Intronic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
918666652 1:187159488-187159510 CAGTGGGTAAGGACATAAAAAGG + Intergenic
918743306 1:188165121-188165143 CAATGGGAATAGAGATATTAGGG - Intergenic
919071703 1:192763940-192763962 CAGAGGGAAGGAAGATGAGATGG - Intergenic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
920341113 1:205275709-205275731 CAGGAGGAATGGAGATGACATGG + Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921540310 1:216406054-216406076 CAGTGGGCATGGTTATAAAAAGG + Intronic
921601010 1:217106484-217106506 CAGTGTGAATTGAGATGACAGGG + Intronic
921684753 1:218076991-218077013 CAGTGAGAACAGATATAAGAAGG - Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923831800 1:237566411-237566433 AAATGGGAAAGAAGATAAGAAGG + Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924284694 1:242474458-242474480 CAGTGGGAATTGAGAAGAAAGGG - Intronic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063288422 10:4714938-4714960 CAGAGGAAATGGAGATTGGATGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063696476 10:8340316-8340338 CAGTAGGAAGTCAGATAAGAAGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064686477 10:17867178-17867200 CAGGAGGAAGGGAGAAAAGATGG - Intronic
1065492002 10:26291569-26291591 CAATTGTAATGGAGATGAGATGG - Intronic
1065532152 10:26682249-26682271 AAGTGAGAATGCAGATAAGGGGG + Intergenic
1066062040 10:31732796-31732818 CACTGGGAGTGGAGAAAACAGGG - Intergenic
1067012677 10:42729108-42729130 CTTTGGGAAAGGAGCTAAGATGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067310912 10:45112760-45112782 CTTTGGGAAAGGAGCTAAGATGG - Intergenic
1068133966 10:52932069-52932091 AGGTGGGAATGGAGAAAAAAGGG + Intergenic
1068379607 10:56234037-56234059 TAGTGGAAATGGAGATAACTGGG - Intergenic
1068387553 10:56351660-56351682 CAGGGAGAATGGAAATAAGATGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070918967 10:80172156-80172178 CTGTGGGAAAGGAAATATGAGGG - Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1074144074 10:110701194-110701216 CACTGGGAACGGAGTTGAGAAGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1075356239 10:121779475-121779497 CAGTGGGAGTGAAGATAAAACGG - Intronic
1075432599 10:122401073-122401095 CAGTGGTAAAGGATATAAGCAGG - Intronic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076457847 10:130614716-130614738 CACTGGAAAAGGAGATAAAACGG - Intergenic
1076542680 10:131224097-131224119 CAGGGGGAAAGGAGACAGGAAGG - Intronic
1076963863 11:61803-61825 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077725011 11:4666008-4666030 CAGTGGGATGAGAGATGAGAAGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077964936 11:7119675-7119697 CCATGTGAATGGAAATAAGAAGG - Intergenic
1078056750 11:8015428-8015450 CAGTGGGAATGGAAACTAAAGGG + Intergenic
1078223056 11:9367253-9367275 CAATGGGACTGAGGATAAGAGGG + Intergenic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078643385 11:13116293-13116315 CAGCGGGAATGAAGATAAATGGG - Intergenic
1078813954 11:14800754-14800776 CAGGGGGAATGGAGCCAAGTTGG - Intronic
1078867165 11:15308544-15308566 CAGAGGGAAAGGAGAAAAGGTGG - Intergenic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079619220 11:22533122-22533144 CAGTGGGAAGGGAAATTATAGGG - Intergenic
1080858758 11:36135000-36135022 CAGGGAAAATGGAGAAAAGAAGG - Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1082206111 11:49436051-49436073 CTGTGGAAACGGAGATAACATGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083811814 11:65110626-65110648 CAGGGGGAAGGGACAAAAGAGGG + Intronic
1083855907 11:65393009-65393031 CAGTGAGAGAGGAGATAAGGTGG + Intronic
1085544838 11:77308493-77308515 CAGTGGGTATGGCTATAAAAGGG + Intergenic
1085610434 11:77943381-77943403 CAGTGGAAATGGAGAAGGGATGG + Intronic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1087199654 11:95332768-95332790 AAGTGGTCATGGAGATGAGAAGG - Intergenic
1087795302 11:102450132-102450154 GAGTGGCAATGGAGATAAAAGGG - Intronic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1089873926 11:121701766-121701788 CAGCGGCAATGGAGATGAAAAGG + Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1091034984 11:132224739-132224761 TAGTGGGAGTGGAGAAGAGAGGG + Intronic
1092062258 12:5561097-5561119 CAGTGGGCCTGGAGATAGCACGG + Intronic
1093925658 12:24905969-24905991 CAGCAAGAATGGAGATAAGGTGG + Intronic
1094874143 12:34622056-34622078 CATTGGGAATGGTGACAAAAAGG - Intergenic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096253366 12:50047835-50047857 CAGTGGCAATGGAAATAAAAAGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097994496 12:65872741-65872763 CAGTGATAATGGAGGTAAGCTGG - Intronic
1098104939 12:67059629-67059651 CAGTGGGAATGGAAACTTGAAGG + Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098441313 12:70522197-70522219 CATTTAGAATGGAGATAAGAGGG + Intronic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1098724324 12:73943807-73943829 CAGTGGGAAAGGAGATTTCAAGG - Intergenic
1099338679 12:81398503-81398525 CAGGGGGATTGGAGATAAACAGG - Intronic
1099671479 12:85699798-85699820 CAAAGGGAATGGAGTTAAGAGGG - Intergenic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100662435 12:96714728-96714750 CAGAGTGAATGGAGATAAATGGG + Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102305224 12:111799724-111799746 CAGAGGGAATGGAGCTAACAGGG - Intronic
1103260877 12:119587438-119587460 AAGTGGTAATGGAAATCAGAGGG - Intergenic
1103781579 12:123402313-123402335 CAGTGGGAATGGAGATGGAGAGG + Intronic
1104772699 12:131373469-131373491 AAGTGGGAATGGAGATGTGAAGG - Intergenic
1106430550 13:29676534-29676556 CAGTCCTCATGGAGATAAGAAGG - Intergenic
1106977233 13:35234561-35234583 CAGTGGGAAATGAGACTAGATGG + Intronic
1107338916 13:39385397-39385419 CAGTGGGAATGGAAAAGAGCTGG + Intronic
1107867387 13:44716039-44716061 CTGTGGGAAAGGAGATTAGCTGG - Intergenic
1108179772 13:47829231-47829253 CCCTGGGAATGGAGGTAAGCTGG - Intergenic
1108286895 13:48917733-48917755 CAGTCGGAAGAGAGATTAGAAGG - Intergenic
1108911976 13:55565645-55565667 AAGTAGGAATGCAGATAAGTAGG + Intergenic
1109035951 13:57260476-57260498 CAGTTGCTATGGAGATCAGATGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110598018 13:77340316-77340338 CAGTTGGTATAGAGAAAAGAGGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1115088997 14:29551375-29551397 CAGTCACAATGGAGATAACAGGG - Intergenic
1115671415 14:35616623-35616645 CAGGGGGAATGGAGAATATATGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116028856 14:39546840-39546862 CAGTGTGCAAGAAGATAAGAGGG + Intergenic
1116283719 14:42945354-42945376 AATTGGAAATGGAGATAAGATGG + Intergenic
1116348151 14:43822828-43822850 CCATGGGGATGGAGATGAGATGG + Intergenic
1117447551 14:55819096-55819118 CAGTGGGAATGCACGAAAGAAGG + Intergenic
1118014615 14:61646854-61646876 CAGTGGGAACTGATCTAAGAAGG - Intronic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121607659 14:95253135-95253157 CAGTGGGCATGGAGCTCAGGAGG - Intronic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1125532590 15:40423327-40423349 GAGTGGGAATGGGGATAGGAGGG - Intronic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1125767256 15:42144047-42144069 CAGTGGGAACGGAGAGTTGATGG + Exonic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1127011874 15:54640132-54640154 TAGTGGGAATACAGATTAGATGG - Intergenic
1127344286 15:58078785-58078807 CAGTGGGAAGGAAGAAAGGAAGG + Intronic
1127597526 15:60501306-60501328 CAGTGGCAATGGTGATGTGATGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128457051 15:67836952-67836974 CAGAGGAAATGGAGATGGGAAGG - Intergenic
1128680444 15:69647706-69647728 CATGGGGAAGGGAGATGAGAGGG + Intergenic
1128728497 15:70005169-70005191 CCCTGGGAATGGGGCTAAGAGGG + Intergenic
1128750190 15:70143258-70143280 GGGTGGGAATGGAGATTGGAGGG + Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130519070 15:84648440-84648462 GGGTGGGAATGGAGATGAGGAGG + Intronic
1130742566 15:86616452-86616474 CAGTGGGCAGGGTGATAAAATGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131289052 15:91089210-91089232 GAGTGGGAATGGAAATGAGGAGG + Intergenic
1131587062 15:93706791-93706813 GAGTGGGATTGGATATCAGATGG + Intergenic
1131937130 15:97519095-97519117 CAGTGGGAGTGGGGAATAGATGG + Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132444687 15:101903368-101903390 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133080160 16:3312263-3312285 CAGAAGGAATTGAGATCAGATGG + Intronic
1134833140 16:17339854-17339876 CAGATGGAAGGGAGAAAAGACGG - Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135943175 16:26840566-26840588 AAGGGGGAAGGGAGAGAAGATGG + Intergenic
1137637821 16:50002428-50002450 CAGTTGGAAGGGAGAGAACAGGG + Intergenic
1138077092 16:54053302-54053324 GAGCGGGCATGGAGATACGAAGG - Intronic
1138318317 16:56089374-56089396 AGGTGGGAATGGAGCTCAGAGGG + Intergenic
1139148537 16:64351870-64351892 CACTGGGACTCGGGATAAGAAGG - Intergenic
1139482786 16:67239921-67239943 GAAGGGGAATGGAGAGAAGATGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140723337 16:77789765-77789787 CAGGGGGAATGGGGAATAGAGGG - Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141118233 16:81330092-81330114 CAGTGGCAATGGTGAAGAGAAGG - Intronic
1141498823 16:84429626-84429648 CAGTGGGGATGGAGAATCGATGG + Intronic
1142631155 17:1227809-1227831 GAGTGGGAATGGGGCTAAGGAGG - Intronic
1143646761 17:8235238-8235260 CAGTGGGAGGGGGGACAAGAAGG - Exonic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144435180 17:15233596-15233618 CAAAGGGAATGGAGATGATAAGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148695486 17:49555852-49555874 CAGTGGGAAGGGGGCTGAGAGGG - Intergenic
1148825977 17:50394726-50394748 CAGTGGGAAAGGAATTGAGATGG - Intronic
1149297581 17:55274265-55274287 CAATGAAAATGGAGGTAAGAGGG + Intronic
1150014188 17:61537029-61537051 AATTGGGAATAGAGATAGGAAGG - Intergenic
1151391610 17:73791065-73791087 CACTGGGAAGGGACACAAGAAGG + Intergenic
1152274737 17:79349666-79349688 CAGGGGGAAAGGAAATAAGCAGG - Intronic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1155148886 18:23106630-23106652 GAGTGAGAATGGAGCTAAGGTGG - Intergenic
1155559487 18:27060511-27060533 GAGTGGGAATGTTGAAAAGAGGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1158410779 18:57203966-57203988 CAGTGGAAAGAGAGATAAGGGGG + Intergenic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1160640667 19:131435-131457 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1161689807 19:5725088-5725110 AAGTGGGAATAGAACTAAGATGG + Intronic
1162548494 19:11345462-11345484 GGGTGGGGATGGAAATAAGAGGG - Intronic
1164182372 19:22831078-22831100 CAATGGGCATGGATATAGGAGGG - Intergenic
1165951517 19:39476184-39476206 CAGGGGGCAAGGAGATAAGATGG + Intronic
1166915466 19:46192822-46192844 AAGTGAAAGTGGAGATAAGAGGG - Intergenic
1167449529 19:49558797-49558819 CAGAGGGAACTGAGATCAGAGGG + Intronic
1167770649 19:51513953-51513975 AAGTGTTAATGGAGATAAAAGGG - Intergenic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1167856719 19:52247899-52247921 CAGTGGTTATGGGGATAAAAGGG + Intergenic
1168138924 19:54371769-54371791 CAGTGGAAATGGAGAAACGCAGG - Intergenic
1168159010 19:54496094-54496116 CAGTGGAAATGGAGAAACGCAGG + Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
927099115 2:19774362-19774384 CAGTGTAGATGGAGATATGAGGG + Intergenic
927476345 2:23417108-23417130 CAGAGGCAATGAAGAGAAGAAGG - Intronic
927726165 2:25424967-25424989 CTGTGGGATGGGAGATAATAGGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
931050436 2:58407671-58407693 CAGTGGCAATGGAGATGGGATGG - Intergenic
931877375 2:66528626-66528648 CAGTGGCAATGGAGCTAGGTGGG - Intronic
931946387 2:67313237-67313259 TAGTGGGACTGGAGACAATATGG - Intergenic
932107028 2:68953313-68953335 CAGAGGGAACGGATATGAGACGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933158702 2:79001390-79001412 CAATAGGAATGAAGAGAAGAGGG - Intergenic
933271061 2:80233443-80233465 CAGCTGCAATTGAGATAAGATGG - Intronic
935354621 2:102187309-102187331 CAGCGGGAAAGGAGAAAGGAAGG - Intronic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935487088 2:103671035-103671057 CAGTGGTAAGGGAGATATTAAGG + Intergenic
935677595 2:105609371-105609393 GAGTGTGAATGGAGATAGGATGG + Intergenic
936616406 2:114052191-114052213 CAGTGGTAATTGAAATAGGAGGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
938270262 2:129964024-129964046 CATTGGGAATGGGGAGAAAAAGG - Intergenic
938578760 2:132627566-132627588 CAATGAAAATGAAGATAAGAGGG + Intronic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
939792242 2:146592340-146592362 CAGTGGCAAGAGAAATAAGATGG - Intergenic
941139196 2:161756597-161756619 CAGTGGGCAAGGAGATTAGGTGG - Intronic
944101603 2:196033439-196033461 CAGGGGGAATGGGGAGATGATGG - Intronic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
945865817 2:215174166-215174188 CAGTGTGAATGTAGATAAAAAGG + Intergenic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946988000 2:225295518-225295540 TAGTGGGCATGGAGAAGAGATGG - Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948315682 2:237026812-237026834 CATTGGGAATGGAGACCAGGTGG + Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168796812 20:615765-615787 CAGTTGGAATGCAGATAGAATGG - Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169487994 20:6049451-6049473 CAGTGGCAATGGTGATGTGATGG - Intronic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1171139479 20:22728751-22728773 CAAGGGGACTGGAGCTAAGATGG - Intergenic
1171294349 20:24004601-24004623 CAGTGGATAAGGAGATAACAGGG - Intergenic
1172369442 20:34376828-34376850 CAGTGGGAATGAAAATAAAGGGG + Intronic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174744469 20:53047945-53047967 CAGTGGAAACGGAGGTCAGAAGG + Intronic
1174892294 20:54408971-54408993 CATTGGGGATGGAGATGGGAAGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1177096092 21:16835229-16835251 TACTGGAAATGGAGATAAAAGGG + Intergenic
1178470108 21:32884871-32884893 CAGAGGGACTCGAGATCAGAGGG + Intergenic
1181200142 22:21212569-21212591 CAGTGGGAAGGGATATGACAGGG + Intronic
1181888653 22:26041813-26041835 AAGTTGGAATGGAGAAATGAGGG + Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182917395 22:34047714-34047736 CAGTGGTGATTGAGATGAGACGG - Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184569159 22:45310961-45310983 CACTGGAAATAGAGATGAGACGG + Intronic
949735033 3:7161921-7161943 CAGGGCGAATGGAGCTGAGATGG + Intronic
950041728 3:9924033-9924055 CAGTGGGAATGGACTTGGGAAGG - Intronic
950241334 3:11372364-11372386 GAGAGGGAATGGAGGTAACAGGG + Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952372996 3:32741044-32741066 AAGTGGGTATGGCTATAAGAGGG - Intronic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
953829034 3:46279439-46279461 CAGTGGGAATGGGGATATCTGGG + Intergenic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955159686 3:56452202-56452224 CAATGTGAAAGGAAATAAGATGG + Intronic
955519612 3:59762301-59762323 AAGTGAAACTGGAGATAAGAGGG + Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956786408 3:72646285-72646307 CTCAGGGAAGGGAGATAAGAAGG + Intergenic
957343095 3:78926385-78926407 CAAAGGAAATGGAGATAAGTGGG + Intronic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959391763 3:105783667-105783689 CAGTGGGAATAAAGCTGAGATGG + Intronic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960296623 3:115952562-115952584 CAGGGGGAATGGTGAGAGGAGGG + Intronic
960546524 3:118920976-118920998 TAGAGGGAATGGACATATGAAGG - Intronic
960565490 3:119127418-119127440 CAGGGAGAATGGAAACAAGATGG + Intronic
961368818 3:126417536-126417558 CAGGGGGAATGGGGGTTAGACGG + Intronic
961535033 3:127565442-127565464 CAGTGTGGATTGAAATAAGACGG - Intergenic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962875112 3:139530031-139530053 CAGTGGGAATGAAGAAAAACAGG + Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
963532163 3:146484333-146484355 CAGAGAGAATGGAAATAAGTTGG + Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963695539 3:148562380-148562402 CAGGGAGAATGGAACTAAGATGG + Intergenic
963848131 3:150180910-150180932 AAGTCAGAAAGGAGATAAGATGG + Intergenic
963959053 3:151287437-151287459 TAATGGGAATGAAGAAAAGAGGG + Intronic
965550592 3:169961250-169961272 CAGTGGGAAAGGACATGAGGAGG + Intergenic
965888562 3:173479707-173479729 CACAGGAAATGGAGATGAGATGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967460093 3:189735605-189735627 CAATGGGAATGGAGATGATAGGG - Intronic
967553913 3:190832029-190832051 CAGTGGCAATGGAGTCCAGATGG + Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969390834 4:6890281-6890303 CAGTGGGAATGGAGACAGCTTGG + Intergenic
970653818 4:18208298-18208320 TAGTGAGAATGCAGATAAAAGGG - Intergenic
971225511 4:24748028-24748050 CAGTGGGAAGGGTCATAAGAAGG + Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972916126 4:43882456-43882478 GAGTTGGAATGCAGATAACATGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975288149 4:72644897-72644919 CAGTGTGAATGGGGTTATGAAGG - Intergenic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976577816 4:86695925-86695947 CACTGGAAAGGGAGATAGGATGG - Intronic
977268667 4:94887076-94887098 GAATGGGAAAGGAGAAAAGAAGG + Intronic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
978084704 4:104636431-104636453 CAATGAGATTGGAGATAAGAAGG - Intergenic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
982220885 4:153124249-153124271 GATTGGGATTGGAGATAAGAGGG - Intergenic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
985230041 4:187805818-187805840 TAGTGAGAATGCAGAGAAGAGGG + Intergenic
986102476 5:4626742-4626764 GAGTTGGAATGGAGATAGGGAGG + Intergenic
987261904 5:16212837-16212859 CAATGCAAATGGAGTTAAGAAGG - Intergenic
988342430 5:29990537-29990559 CAGAAGGAATGGAGAATAGAAGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
990326273 5:54678664-54678686 CAGTGGGAATGAGGATGGGAGGG + Intergenic
991513208 5:67403420-67403442 CAGTGAGAATGGAGAAAAAGGGG - Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991770000 5:70031445-70031467 CAGTTTGACTGGAGATGAGAAGG + Intronic
991849295 5:70906864-70906886 CAGTTTGACTGGAGATGAGAAGG + Intronic
994241657 5:97429461-97429483 CAGGGTGAATGGAGAAGAGAGGG + Intergenic
995355585 5:111234460-111234482 CAGTGGTCATGGAGTTGAGAGGG + Intronic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
996367955 5:122722885-122722907 CAGTAGGAAGGAAGAAAAGAGGG - Intergenic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998818534 5:146037023-146037045 CAGTTGGACTGGATTTAAGAAGG - Intronic
998876745 5:146607845-146607867 CAGTTGTAATGGAGACCAGATGG - Intronic
999610710 5:153366274-153366296 CAGTGAGCAAAGAGATAAGAAGG + Intergenic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002272800 5:178083757-178083779 CAGTGGGATGGGACATACGACGG + Intergenic
1002293313 5:178214200-178214222 CCTGGGGAATGGAGATAAAAGGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002512118 5:179727540-179727562 CAGAGAGAGTGGAGAAAAGAAGG + Intronic
1002736685 5:181394985-181395007 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1002748015 6:79838-79860 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1002979856 6:2125616-2125638 CACTGGGGAAGGGGATAAGATGG + Intronic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1007452066 6:41947744-41947766 AAGTGGAAATCGAGAAAAGAAGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008148113 6:47916520-47916542 AATTGGGAATGGAGATAAGGGGG - Intronic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010350767 6:74871666-74871688 CAGTGGTCATGGAAATGAGAAGG + Intergenic
1010986747 6:82433706-82433728 CAGTGAGAATGCTGATAATATGG - Intergenic
1011334518 6:86245578-86245600 CAGAAGGAAGGGTGATAAGAGGG - Intergenic
1011575019 6:88787792-88787814 CAGTGACAATGGAGAAAAAAGGG + Intronic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012289108 6:97429200-97429222 AAGTGGGAGTGTAGAGAAGACGG + Intergenic
1012310475 6:97718309-97718331 CAGTAGGAATGGACAAAAGAGGG + Intergenic
1012473105 6:99592030-99592052 CATTGGGAATTGAAATGAGAGGG - Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1014016385 6:116535289-116535311 CAGTGGGAATGTGGATCAGCAGG + Intronic
1014828608 6:126075482-126075504 CAGGGGGAAGAGAGATAAGTGGG - Intergenic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016569804 6:145498663-145498685 CAGGGAGAATGGAGAAAAGCAGG - Intergenic
1017647105 6:156549318-156549340 CAGTGAGAATTCAGATCAGAAGG + Intergenic
1018309326 6:162492030-162492052 CAGAGGAAATGGAAACAAGATGG + Intronic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018368325 6:163144955-163144977 CAGAGGGGATGGGGAAAAGAGGG - Intronic
1018456820 6:163960799-163960821 GAGTGGGAAAGGAGATGACAGGG - Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019241783 6:170670514-170670536 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020846293 7:13288471-13288493 CAGTGGGGAGGAGGATAAGAAGG + Intergenic
1021182913 7:17529223-17529245 GAGTGGGAAAGGAGATTAGGAGG - Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022255224 7:28649455-28649477 CAGTTGCAATGGAGAACAGATGG + Intronic
1023227653 7:37987905-37987927 CAGTGGGAAGGGAAATGAAATGG - Intronic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024332371 7:48169088-48169110 AAGTTGGAATGGAGATATGTGGG + Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1025170186 7:56749452-56749474 GAGTGGGAATGAAAATATGATGG - Intergenic
1025701699 7:63826266-63826288 GAGTGGGAATGAAAATATGATGG + Intergenic
1025842668 7:65165654-65165676 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1025880377 7:65530314-65530336 CAGTGGAAATGGAGAAGGGATGG + Intergenic
1025893060 7:65672290-65672312 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027475649 7:78628019-78628041 CAGAGGGAATGGAGCTATGACGG + Intronic
1027529783 7:79315897-79315919 GAGTGGGAAAGGAGCTAAGTTGG + Intronic
1029033751 7:97496014-97496036 CAGTGGGAATTCAGATTTGATGG - Intergenic
1029605887 7:101599168-101599190 CAGAGGGAATGGAACTCAGATGG + Intergenic
1030287181 7:107838600-107838622 CCTTGGGATTGGAGACAAGACGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031915906 7:127562901-127562923 GAGTGAGAATGGAAATAAAAAGG - Intergenic
1032261890 7:130345027-130345049 CAGTAGCAATGGAGATAAAAGGG - Exonic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035506333 8:137582-137604 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1036066115 8:5383379-5383401 CAGTGGGAAAGGAGACGACAAGG + Intergenic
1037740937 8:21608804-21608826 CACTGGGAATGGTGCTAAGAAGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039254541 8:35704769-35704791 CAGGGGGAATGGGGAGAACAGGG + Intronic
1039820405 8:41129563-41129585 CAGTGAGAATGAAGAAAAGCAGG + Intergenic
1041029017 8:53717271-53717293 CACTGGGAATGAGGACAAGAAGG + Intronic
1041481007 8:58319829-58319851 GTGTTGGAATGGAGATAAGGAGG + Intergenic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1043714419 8:83463885-83463907 CACTGGAAATGTACATAAGATGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044848783 8:96407831-96407853 CAGTGGTAATGAAGAGATGATGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1046780164 8:118206146-118206168 CATTGGAAATGGAGACAAGCTGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047538642 8:125743028-125743050 GAGAGGGAGAGGAGATAAGAAGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048426059 8:134324479-134324501 CAGTGAGCAGGTAGATAAGATGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1049279051 8:141734938-141734960 TACTGGGCCTGGAGATAAGAAGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1052480526 9:29019512-29019534 TAGTGGGAGTGGAGACCAGAAGG - Intergenic
1052760465 9:32585413-32585435 CGGTGGGAAAAGAGAAAAGAAGG - Intergenic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055558599 9:77500594-77500616 CAGTGGGGATGGGGATGGGAGGG - Intronic
1055686786 9:78783621-78783643 CAAGTGGAATGGTGATAAGATGG + Intergenic
1055703451 9:78971811-78971833 GAGGGAGAATGGAGAAAAGAAGG + Intergenic
1056680486 9:88713576-88713598 TAGTGGGGATGGTGATAACAGGG - Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057755500 9:97831799-97831821 AAGGGGGAGGGGAGATAAGAGGG + Intergenic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1058606885 9:106732472-106732494 CGGTGGGAAAGGCGATAACAGGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059284816 9:113163163-113163185 AAGGGAGAATGGAGATAACAGGG + Exonic
1059299537 9:113300946-113300968 CAGTGGCAGAGGAGATAAAAGGG + Intronic
1059802893 9:117768591-117768613 CAATGGGGATGGGGAAAAGACGG + Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060550683 9:124483640-124483662 CAGTGATGATGGAGACAAGATGG - Intronic
1061498375 9:130988868-130988890 AAGTGGCAATGGAGAGAGGATGG + Intergenic
1203601974 Un_KI270748v1:19748-19770 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1186817922 X:13256250-13256272 CAGGGAGAAAGGAGACAAGAAGG - Intergenic
1187796756 X:23012287-23012309 AAGTAGGAAGGGACATAAGAGGG - Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1190158424 X:48012380-48012402 CAGGGGAAAGGGAGATTAGAAGG + Intronic
1190248199 X:48704684-48704706 GAGGGGGAATGGAGAAGAGACGG - Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191626520 X:63276525-63276547 CAGTTGGACTGCAGATAAGCAGG - Intergenic
1191672756 X:63764271-63764293 CAGTCAGAATGGCGATGAGATGG - Intronic
1191932142 X:66385761-66385783 CAGTGAGTAAGGAGTTAAGAGGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192829173 X:74732234-74732256 CAGTGGTAATGGTGATAGAAAGG + Intergenic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195645894 X:107230232-107230254 CAGTGGTAATGAAAATTAGATGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196139805 X:112248630-112248652 CATTGGGAAAAGAAATAAGAAGG + Intergenic
1196873008 X:120130365-120130387 CGATGGGAATGGAGGTAAGCAGG + Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197836980 X:130705602-130705624 GGGAGGGAAGGGAGATAAGAAGG - Intronic
1198766411 X:140084398-140084420 AAGTGGGTATAGATATAAGAAGG + Intergenic
1199252473 X:145679161-145679183 CACTGGATATGGAGATGAGAAGG - Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1200306698 X:155032702-155032724 CAGTGATAATGAAGATGAGAGGG - Intronic