ID: 1145924118

View in Genome Browser
Species Human (GRCh38)
Location 17:28633185-28633207
Sequence GTGAGTGACCAGGGCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145924118_1145924135 30 Left 1145924118 17:28633185-28633207 CCCTCAGTGCCCTGGTCACTCAC 0: 1
1: 0
2: 2
3: 21
4: 200
Right 1145924135 17:28633238-28633260 CTGAGCCCCTCATCCCATGGAGG 0: 1
1: 0
2: 4
3: 11
4: 208
1145924118_1145924133 27 Left 1145924118 17:28633185-28633207 CCCTCAGTGCCCTGGTCACTCAC 0: 1
1: 0
2: 2
3: 21
4: 200
Right 1145924133 17:28633235-28633257 AACCTGAGCCCCTCATCCCATGG 0: 1
1: 0
2: 1
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145924118 Original CRISPR GTGAGTGACCAGGGCACTGA GGG (reversed) Intronic
900476321 1:2878033-2878055 TTGAGTGACGAGGGCAAAGATGG - Intergenic
900663636 1:3799059-3799081 GTGACTGATCAAGGCCCTGAAGG + Intergenic
900899841 1:5509007-5509029 GTGCCTGACCACGCCACTGACGG + Intergenic
901154043 1:7123656-7123678 GGCAGTGACCAGGGCTCAGAGGG - Intronic
902389770 1:16096388-16096410 GTGAGGGAGGAGGGGACTGACGG - Intergenic
902490053 1:16775061-16775083 GTGAGTGACCAGGACAGGGAGGG + Intronic
904872088 1:33625257-33625279 GTGGGGGACAAGGGCACTGAGGG + Intronic
905130614 1:35753825-35753847 GTGAAAGACATGGGCACTGATGG - Exonic
906612468 1:47212915-47212937 GAGAGAGGCCAGGGCACAGAAGG - Intergenic
906660013 1:47575266-47575288 CTGAGTGACCTGGGCAGAGAAGG + Intergenic
913298243 1:117343225-117343247 GTGAGGGACTAGGGCAGTGGTGG + Intergenic
914953294 1:152138377-152138399 GTGTCTGAGCAGAGCACTGAGGG - Intergenic
915585274 1:156840870-156840892 ATGGGGGTCCAGGGCACTGAGGG - Exonic
918061598 1:181066202-181066224 GTGAGTGACCATGGCCCAGGAGG - Intergenic
918542451 1:185647474-185647496 GTGAGTGACCATGGCCCGGGAGG + Intergenic
919097864 1:193059254-193059276 GTGTGTGGCCAGGGCCATGACGG - Exonic
923530384 1:234807469-234807491 GTGAGTGACCAGGACAGGGAGGG - Intergenic
924370867 1:243348498-243348520 GGGTGGGACCAGGGCACTGGGGG - Intronic
1064196079 10:13244959-13244981 GTGAGTGAGAAGCCCACTGACGG + Intergenic
1065590305 10:27256569-27256591 TGGAGTGCCCAGGGCAGTGAGGG + Intergenic
1069162539 10:65109063-65109085 GTGAATGTCCAAGGCACAGAGGG + Intergenic
1069745589 10:70713016-70713038 GAGAGTGCCCAGGGCAGTGGCGG + Intronic
1069884316 10:71614029-71614051 GTGAGGAACCAGAGCACAGAGGG + Intronic
1070329672 10:75408350-75408372 GTGAGTGATGAGGGCAGAGAAGG + Intergenic
1070669746 10:78369559-78369581 GTGAGGGCCCAGGGGCCTGAGGG - Intergenic
1070851162 10:79562559-79562581 GAGAGTGAGAAGGGCACTGAAGG - Intergenic
1071434626 10:85635676-85635698 GTGACAGAGCAGGGCACTGAGGG + Intronic
1072636843 10:97183851-97183873 GAGGGTGACCAGGCCACTGCGGG + Intronic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1075624354 10:123950971-123950993 GTGAGCCACCTGGGCTCTGAGGG + Intergenic
1077891242 11:6419355-6419377 GTGCGGGACCAGGGCGCTGCGGG - Intronic
1077923208 11:6656181-6656203 GAGGGAGACCAGGGCACTGAGGG - Intergenic
1083652672 11:64212194-64212216 AAGAGTGAACAGGGCACAGAGGG - Intronic
1083744151 11:64725996-64726018 GTGGGGGACCGGGGCACTCATGG + Intergenic
1084275771 11:68050255-68050277 GTGAGTGACCTGGCCACCGACGG + Intronic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084935551 11:72584762-72584784 GTTAGTGACCCGGCCACAGAGGG + Intronic
1087711179 11:101554573-101554595 GAAACTGGCCAGGGCACTGAAGG - Intronic
1090435498 11:126683622-126683644 ATGATTGGCCAGGGCATTGACGG + Intronic
1091302538 11:134516542-134516564 CTGAGTGACCAGTGCCCTCAAGG - Intergenic
1091663065 12:2398933-2398955 GACAGTTGCCAGGGCACTGAGGG - Intronic
1094365168 12:29672339-29672361 GTCAGTACCCAGGACACTGATGG + Intronic
1095970281 12:47897006-47897028 CTGAATGACCAGGACACTGCAGG + Intronic
1098979709 12:76943046-76943068 CAGAGTGTCCAGAGCACTGAGGG - Intergenic
1100031807 12:90201781-90201803 GTGAGAGACCAGTGCTGTGAGGG + Intergenic
1100214748 12:92435812-92435834 GAGAGGGCCAAGGGCACTGAGGG - Intergenic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1100407307 12:94282904-94282926 GTGAGTGCCGAGGGCGGTGAGGG + Intronic
1100588308 12:95999753-95999775 GTGAGGGACAGGAGCACTGACGG + Intergenic
1101304646 12:103515583-103515605 ATGAGAGGCCAGAGCACTGAGGG - Intergenic
1102574142 12:113845215-113845237 CAGAGTCACCAGGGCAGTGAAGG - Intronic
1102898211 12:116615479-116615501 GTGAGTGACCAGGTCATGGGTGG + Intergenic
1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG + Intergenic
1104412265 12:128568934-128568956 GTGAGTGCCCAGCGCAGAGAAGG - Intronic
1104470068 12:129022816-129022838 GAGAGAGCCCAGAGCACTGAGGG - Intergenic
1105685416 13:22776173-22776195 GTGACTGAACAAGGCGCTGAAGG + Intergenic
1113355479 13:109576071-109576093 AGGAGGGACCAGGGCAGTGATGG - Intergenic
1114565940 14:23632911-23632933 GTTAGTTAGCAGGGCACTCAGGG - Intronic
1114569078 14:23653355-23653377 GTTAGAGACCAGGGCACTGGAGG - Intergenic
1119063812 14:71505199-71505221 GTGAGTGACCCAGGCAATGCGGG - Intronic
1119544725 14:75463421-75463443 GTGAGTGCCTAGGGCACAGAGGG + Intronic
1121771789 14:96551217-96551239 GTGAGTTAACAGGCCACTGTTGG - Intronic
1121857473 14:97283269-97283291 GTGAGTGGCCGGGGCACTCGGGG + Intergenic
1121897399 14:97661345-97661367 GTGAGTGCCCGGGCCACAGAAGG + Intergenic
1123695703 15:22877739-22877761 GTGGGTGGCCAGGACAATGAAGG + Intronic
1128389686 15:67174591-67174613 GTCAGTCAGCAGTGCACTGAAGG + Intronic
1128553719 15:68615767-68615789 GTCCAAGACCAGGGCACTGACGG - Intronic
1129512667 15:76136547-76136569 GTCAGTGCCCAGGGTAATGAGGG - Intronic
1132469623 16:94761-94783 GTGAGGGAACAGGGCGGTGATGG - Intronic
1132507300 16:317500-317522 GTGAGCGACCAGGCCACAGTGGG - Intronic
1133683730 16:8146158-8146180 CTGAGTGACCATTACACTGATGG + Intergenic
1143267933 17:5654346-5654368 GTCAGTGTCCAGAGCACTGCAGG + Intergenic
1144372468 17:14605353-14605375 GTGGGAGACCCGGGCACTCAGGG - Intergenic
1144748067 17:17628913-17628935 ATGAGTGAGCAGGGTACAGAGGG - Intergenic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1146618452 17:34375861-34375883 GTGAGGGACCAGGGGAAAGAAGG + Intergenic
1150101796 17:62430528-62430550 AGGTGTGACCAGTGCACTGAGGG - Intronic
1150227908 17:63533766-63533788 GTGGGTGACCACGGCTCTGGTGG - Intronic
1152284525 17:79404454-79404476 CTGCGTGACCTGGGCACAGAGGG - Intronic
1155072763 18:22330651-22330673 GTAACTGACCAGGGTACTGCCGG + Intergenic
1155133156 18:22959433-22959455 TTGAGTGTCCAGTGCAATGAAGG - Intronic
1155844482 18:30688488-30688510 GTAAGTGACGAGGGGACTAAAGG - Intergenic
1157141055 18:45107002-45107024 TTGTGTGTCCAGGGCACAGAAGG - Intergenic
1157546221 18:48548451-48548473 GAGAGTGCCCAGGGTACTGTAGG - Intronic
1161024072 19:2027097-2027119 GTGCTTGAGCAGGGCACTGGTGG - Intronic
1161105903 19:2443925-2443947 GTGTGTGACCAGGGTGCTCATGG - Intronic
1161124936 19:2550579-2550601 GAGAGTGACCATGGCCCTGCTGG + Intronic
1161290861 19:3492658-3492680 GTGAGTGACCGGGGGACTGGAGG + Intronic
1161492068 19:4567628-4567650 GTGAGTGGCCACGGCATGGACGG - Intergenic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1162566387 19:11447502-11447524 GTGGGCGACGAGGGCACTGGCGG - Exonic
1163451154 19:17378263-17378285 CTAAGTGAACAGGGCACTGGGGG - Intergenic
1163817102 19:19473354-19473376 GTGCTTGACCAGGGAGCTGAAGG - Intronic
1164758009 19:30704680-30704702 GGAAGTGAGCAGGCCACTGAGGG + Intronic
1165652949 19:37507126-37507148 GTCAATGACAAGGGAACTGAAGG + Intronic
1165705958 19:37976337-37976359 GTCAGTGATCAGGGCATTCAGGG - Intronic
1165913395 19:39243801-39243823 GTGAGTGACCCGGGAAGAGAGGG - Intronic
1165917560 19:39269822-39269844 GTGAGTGACCCGGGAAGAGAGGG + Intronic
1168350762 19:55674491-55674513 GGGAGAGGGCAGGGCACTGAGGG - Intronic
925230046 2:2225319-2225341 GCCAATGACCTGGGCACTGAAGG - Intronic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
925328192 2:3038900-3038922 TGGGGTGACCAGGGCACAGAGGG + Intergenic
925357647 2:3253384-3253406 ATGAGTGACCACGGCCCTCAGGG - Intronic
927855321 2:26524033-26524055 GAGAATGCCCAGGGCACTGCTGG - Intronic
932111599 2:69006676-69006698 ATGACTTACCAGGGCACAGAAGG - Intergenic
934714298 2:96534699-96534721 GAGAGACACCAGGACACTGAGGG + Intergenic
937218585 2:120328352-120328374 TTCACTGTCCAGGGCACTGAAGG - Intergenic
937314181 2:120920497-120920519 GTTAGTGAGGAGGGCAGTGAGGG - Intronic
937991125 2:127663162-127663184 GCGAGTGGCCAGGGCACTGATGG - Intronic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
938759290 2:134409414-134409436 GTGACTGACCTGGGAAATGATGG + Intronic
939529668 2:143341790-143341812 GTGACTGATCAGGGCAATGTGGG - Intronic
940129788 2:150368486-150368508 GTATCTGACCAGGGAACTGAGGG + Intergenic
941655436 2:168138754-168138776 CTGAGAGAGCAGGACACTGAAGG + Intronic
943098491 2:183457954-183457976 TTGAGTGACTTAGGCACTGAAGG + Intergenic
946280311 2:218661492-218661514 GTCAGTGCCCAGGGCCGTGAAGG - Exonic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
1168952188 20:1810163-1810185 CTGAGTGAGAAGGGCAGTGATGG - Intergenic
1169404907 20:5315141-5315163 GTGCATGACCAGGGCGCTGTAGG + Intergenic
1170830337 20:19834011-19834033 GTGGGTTACCAGGCCACTGGGGG - Intergenic
1173227817 20:41172181-41172203 GTGTGTCACCAGCTCACTGAAGG + Exonic
1175655240 20:60764046-60764068 GTGTGTGAGGAAGGCACTGAGGG - Intergenic
1175763657 20:61578260-61578282 GGGAGAGGCCAGGGCACTGGGGG + Intronic
1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG + Exonic
1178936841 21:36870191-36870213 GTGTGTGTCCAGGTCACTGGTGG - Intronic
1179035178 21:37753257-37753279 GTGAGTGGACAGGGCCCAGATGG + Intronic
1179311309 21:40198503-40198525 GTGGGTCTCCAGGTCACTGAAGG - Intronic
1180122268 21:45761752-45761774 GTGAGTGTCCTGGGCCTTGAGGG + Intronic
1180161721 21:46001192-46001214 GGGAGGGGCCAGGGCACTGGAGG + Intronic
1180903796 22:19394319-19394341 GTGAGTGCCCAGGGAACTAAAGG - Intronic
1181436947 22:22916614-22916636 GTGAGTGACCAGGGTCCAGGGGG - Intergenic
1181437801 22:22920488-22920510 GTGAGTGACCTGGGTCCAGAGGG - Intergenic
1182173101 22:28253771-28253793 CTGAGTGACCAGGTAAATGATGG + Intronic
1182861562 22:33563896-33563918 GGGAGTGACCAGGGCAAGCAAGG + Intronic
1183466263 22:37981859-37981881 CTGGGTGAGCAGGGCACTGAGGG + Intronic
1184027253 22:41866998-41867020 GTGAATGACCGTTGCACTGAAGG - Exonic
1184790064 22:46694810-46694832 GTGCGTGTGCAGGGCACTGGTGG - Intronic
1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG + Intergenic
950503515 3:13378761-13378783 GTGAGTGCCCTGGGCAATGATGG + Intronic
950544844 3:13632184-13632206 GTGAGGGGCCAGGACACAGAAGG + Intronic
952447182 3:33392813-33392835 GTGACTGACCAGGTCTCTCAGGG - Intronic
955113822 3:55976387-55976409 GTGAGTCATCAAGGCAGTGATGG - Intronic
959302375 3:104619349-104619371 GAGAGTCACCAGGGCAGTGTAGG - Intergenic
961787145 3:129354009-129354031 GTGAGATGCCAGGGCGCTGAGGG + Intergenic
962616325 3:137130375-137130397 GGGAGTGAAAAGGGCACTGCAGG + Intergenic
966080025 3:175989388-175989410 CTCAGTGACCTGGGCACAGAAGG - Intergenic
966268894 3:178081433-178081455 GTGGGAGATCAGGGCACGGAAGG - Intergenic
967189850 3:186975792-186975814 GTGAGTGAGGCTGGCACTGAAGG + Intronic
967625731 3:191681625-191681647 GAGAGTGAGCAAGGCATTGAAGG - Intergenic
968922031 4:3527279-3527301 GCAAGTGTCCAGGGCACAGAGGG - Intronic
976921658 4:90450618-90450640 GTAAAAGACCAGGGAACTGACGG - Intronic
978568028 4:110105512-110105534 GTCAGAGACCAGAGCACTAATGG + Exonic
980270088 4:130573387-130573409 CTGGGTGACCAGGGGACTCATGG - Intergenic
983508929 4:168587086-168587108 GGGGGTGTCCAGGGCACTGTGGG - Intronic
986273205 5:6251981-6252003 AAGTGTGACCAGGGCACTGTGGG - Intergenic
987054331 5:14177093-14177115 TTGAGCGCCCAGGGCACTCATGG + Intronic
991504292 5:67308089-67308111 GTCAGTTCCCAGGGCACTCAGGG - Intergenic
994562802 5:101397717-101397739 ATGAGTAACTAGGGGACTGAAGG + Intergenic
996802367 5:127417813-127417835 GTGAGTGACTAGGGCTCTGGAGG + Intronic
998388720 5:141773390-141773412 GTGTGTGTCCAGGCCACAGATGG + Intergenic
999179484 5:149659051-149659073 CTGAGTGACCAGGTCAGCGATGG - Intergenic
999228569 5:150047758-150047780 GTGAGTGTCAAGGGCAGTGGTGG + Intronic
1000345639 5:160311829-160311851 GAGAGTGACAAGGGCAGGGAGGG + Intronic
1001784096 5:174396820-174396842 GTAACTGACCAGGGCCTTGAAGG + Intergenic
1004063492 6:12220829-12220851 GTGAGGGAGCAGGACAATGAGGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006510713 6:34519654-34519676 ATGAGTGCCCAGTGCACAGAAGG - Intronic
1007473055 6:42103276-42103298 GTGGGTGTGCAGGGCACCGAAGG - Exonic
1010766488 6:79781599-79781621 TTGAGTGATCGGGGCACTGTTGG + Intergenic
1011444734 6:87426086-87426108 GTGAGCCAGCAGGGCACTGCAGG - Intronic
1013394602 6:109722720-109722742 GTGAGTGAGCTGGGCAGGGATGG + Intronic
1013654444 6:112230961-112230983 TTGAGTGACTAGAGCACTAATGG - Intronic
1015166819 6:130207980-130208002 GTGAGAGCTCAGGGGACTGAGGG - Intronic
1016511645 6:144849349-144849371 GTGAGTGACAAAGGCAAGGAGGG + Intronic
1017008282 6:150043930-150043952 GTGTGTGAACTGGGCACAGATGG + Intergenic
1020077056 7:5265169-5265191 GTGAGGGACCAGGTCGCAGAGGG + Intergenic
1020125704 7:5531473-5531495 GTGGGTGACCTAGGCACTGCGGG + Intronic
1021616411 7:22507022-22507044 GACAGAGACCAGCGCACTGAGGG - Intronic
1022116368 7:27264601-27264623 GCCAGTGCCCAGGGCACTCAGGG + Intergenic
1022413724 7:30160272-30160294 GTGAGTGCCCAAGCCCCTGAGGG + Exonic
1023143997 7:37130709-37130731 GGGAGTGACAAGGGCAACGAGGG + Intronic
1024291579 7:47808084-47808106 GGGAGTGGCCAGGACAGTGAAGG - Intronic
1024804201 7:53117596-53117618 GTGAGTGACAGGGAAACTGATGG + Intergenic
1025104208 7:56157568-56157590 GAGACTGACAAGGGCACTTAGGG - Intergenic
1026101729 7:67389561-67389583 GTGAGAGAGCAGGGCATGGAAGG - Intergenic
1026316580 7:69232670-69232692 GAGACTGACAAGGGCACTTAGGG + Intergenic
1027348723 7:77288568-77288590 GTGAGTGGCCAGTCCTCTGATGG - Intronic
1028262481 7:88683575-88683597 GTGAGTGCCCAGGCCAGTCAGGG - Intergenic
1029713673 7:102314129-102314151 GTGATTGACCAGGCCACTGTTGG - Intronic
1031235894 7:119175953-119175975 CTGAATGGCCAGGCCACTGAAGG - Intergenic
1032030942 7:128483392-128483414 AGGTGTGACCAGTGCACTGAGGG - Intronic
1032197772 7:129799286-129799308 GTGTGAGCCCAGGGCACTGAGGG - Intergenic
1032901276 7:136311402-136311424 CTTAGTGACCAGGGCAATGAAGG - Intergenic
1033418105 7:141182172-141182194 GTAAGTGTCCTGGGCACTGGGGG + Intronic
1033660051 7:143396805-143396827 GTGACTGACCAGAGCAGTGTGGG - Intronic
1034981419 7:155480285-155480307 GTGACTGATCAGGGTGCTGAAGG - Intronic
1037777960 8:21848119-21848141 GAGGGAGACCAGGGCACTGCAGG - Intergenic
1037908572 8:22729683-22729705 GTGCTTGACTGGGGCACTGATGG + Intronic
1039514806 8:38123708-38123730 GAGAGTGAGAAGGGCACTGTAGG - Intronic
1044340318 8:91040133-91040155 CTGAGTGAACAGAGCACTGTTGG + Intronic
1045829037 8:106435841-106435863 GTGAGTGATCAGAGCACTGAAGG - Intronic
1049072273 8:140365349-140365371 GTGAGGGACCAGGGCAGGCAGGG - Intronic
1049178720 8:141209452-141209474 GTGGGTGACCGGGGCTCTGGCGG - Intronic
1049182532 8:141230411-141230433 GTGAGTGTGCAGGGCCCTGTTGG - Intronic
1049463352 8:142740064-142740086 GGGAGTAACCAGGGCAGTGGCGG - Intergenic
1049674606 8:143884025-143884047 GTGAGTGGGGAGGGCACTGCCGG - Intergenic
1051748264 9:20316320-20316342 GTGGGTGACCAGAGTACTTAGGG + Intergenic
1051956344 9:22699707-22699729 GGGGGTGACCAGGGTAGTGAAGG + Intergenic
1053565252 9:39242633-39242655 GTGACTGACCTGTGCACTGCTGG + Intronic
1053831022 9:42080483-42080505 GTGACTGACCTGTGCACTGCTGG + Intronic
1054131899 9:61376406-61376428 GTGACTGACCTGTGCACTGCTGG - Intergenic
1054599532 9:67106955-67106977 GTGACTGACCTGTGCACTGCTGG - Intergenic
1060222942 9:121773991-121774013 GTGAGTGACCCTGCCACTGGGGG - Intronic
1060729820 9:126030196-126030218 GGGAGGGACCAGGACACCGAGGG - Intergenic
1061807208 9:133143164-133143186 GTGACTGACCACGCCACTGATGG + Intronic
1062219609 9:135408057-135408079 GTGAGTGCGCTGAGCACTGAAGG + Intergenic
1062586292 9:137251434-137251456 GGGAGTGGCCAGGGGGCTGAGGG + Intronic
1189877995 X:45456668-45456690 GAGAGTGATCAGAGCACAGAAGG - Intergenic
1190056694 X:47185368-47185390 GTGAGTGCCCAAGGCAGAGAGGG + Intronic
1190115812 X:47625835-47625857 GTGACTGAACAGGTGACTGAGGG + Intronic
1190305675 X:49080163-49080185 GTGGGTGACCAAGGGGCTGAGGG - Intronic
1192200857 X:69065890-69065912 GTGAGAGGGCAGGGCATTGACGG + Intergenic
1195720805 X:107865995-107866017 GTGAGTGACCTAGGCAGGGAAGG + Intronic
1200215085 X:154364739-154364761 CTGAGGCTCCAGGGCACTGAGGG - Intronic