ID: 1145925515

View in Genome Browser
Species Human (GRCh38)
Location 17:28644270-28644292
Sequence CAAAAGGTCGTTCCTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145925505_1145925515 29 Left 1145925505 17:28644218-28644240 CCTTTTTCCAATGATGGTTTCCC 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1145925512_1145925515 1 Left 1145925512 17:28644246-28644268 CCTTGCTGGTCTTTCAAAGCCTT 0: 1
1: 0
2: 1
3: 22
4: 250
Right 1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1145925506_1145925515 22 Left 1145925506 17:28644225-28644247 CCAATGATGGTTTCCCTCACCCC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1145925508_1145925515 9 Left 1145925508 17:28644238-28644260 CCCTCACCCCTTGCTGGTCTTTC 0: 1
1: 0
2: 1
3: 39
4: 418
Right 1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1145925509_1145925515 8 Left 1145925509 17:28644239-28644261 CCTCACCCCTTGCTGGTCTTTCA 0: 1
1: 0
2: 3
3: 26
4: 232
Right 1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1145925510_1145925515 3 Left 1145925510 17:28644244-28644266 CCCCTTGCTGGTCTTTCAAAGCC 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1145925511_1145925515 2 Left 1145925511 17:28644245-28644267 CCCTTGCTGGTCTTTCAAAGCCT 0: 1
1: 0
2: 3
3: 23
4: 232
Right 1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145925515 Original CRISPR CAAAAGGTCGTTCCTGAAAC TGG Intronic
900589599 1:3453822-3453844 CAACAGGCCTTTCCTGAAAAGGG + Intergenic
902646189 1:17799859-17799881 ATAAAGGTGGTTCCTGAAACCGG - Intronic
902846483 1:19114675-19114697 CAAAAGCTGGGCCCTGAAACTGG + Intronic
906820402 1:48923863-48923885 CAATAGGTCCTTCATAAAACAGG - Intronic
910192315 1:84606596-84606618 CAAAAGGAAGTTGCTGAAACAGG + Intergenic
918116305 1:181501038-181501060 CAAATTCTCGTTTCTGAAACAGG + Intronic
919550783 1:198983825-198983847 CAAAAGGTCATAACTTAAACTGG + Intergenic
919632706 1:199974540-199974562 AGAAAGGGCGTTCCTGAAAGAGG + Intergenic
920786358 1:209045879-209045901 CAAAAGTTCATTGCTGGAACAGG - Intergenic
1063461576 10:6218034-6218056 CAAATAGCCCTTCCTGAAACAGG - Intronic
1064899579 10:20279474-20279496 CAAATGGTCTTTCCTGTGACAGG + Intronic
1068625603 10:59243378-59243400 CTAAAGGAAGTTTCTGAAACAGG + Intronic
1072518463 10:96209808-96209830 CAAAAGCTGCTTCCTGCAACAGG + Intronic
1074765237 10:116695359-116695381 CAAAAATCCGTTCCTGAGACCGG - Intronic
1077559090 11:3245969-3245991 CAAAACGTGGTGCCTGAAAGGGG + Intergenic
1079487076 11:20946247-20946269 CAAAAGGTAGTTCCCAACACAGG - Intronic
1079921769 11:26441816-26441838 CAATAGTTCATTCCTGAAACAGG + Intronic
1080634945 11:34115663-34115685 CAAATGGTATTTGCTGAAACTGG - Intronic
1082932172 11:58619569-58619591 CAAAATGTCATTTCTGAAAGAGG + Exonic
1084724975 11:70935598-70935620 CATGAGGTCTTTTCTGAAACTGG + Intronic
1085640627 11:78190442-78190464 CAAAAGTACCTTCCAGAAACTGG - Intronic
1087368597 11:97252498-97252520 CAAAAGGTCACACCTTAAACTGG - Intergenic
1088065734 11:105717203-105717225 TAAAAGGTGGTTTATGAAACTGG - Intronic
1089408801 11:118221057-118221079 CAAAAGGTATTTCCAGAAAGGGG - Intronic
1091689055 12:2583444-2583466 CAAAAGCTCCTTCCTGATCCCGG + Intronic
1093078156 12:14778371-14778393 CAAAAGGTAACTCCTGCAACTGG + Intergenic
1096152006 12:49320239-49320261 GAAAAGGACATTCCAGAAACAGG + Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1099407783 12:82284489-82284511 GATAAAGACGTTCCTGAAACAGG - Intronic
1101247287 12:102896127-102896149 CAAATGGGCATTCCTGAGACAGG + Intronic
1101374172 12:104156651-104156673 AAAATGGTCTTTCATGAAACTGG - Intergenic
1105865875 13:24458772-24458794 CAAAAGATAATTTCTGAAACAGG + Intronic
1106133140 13:26955614-26955636 CTCAAAGTCATTCCTGAAACAGG + Intergenic
1106142226 13:27020900-27020922 AAAAATGTCTTTCATGAAACCGG + Intergenic
1108005959 13:45946715-45946737 CAAACGGTGATTCCTGAATCAGG - Intergenic
1108760222 13:53553645-53553667 CAAAAGTTTGTTCCAGAACCTGG - Intergenic
1109451926 13:62527037-62527059 CAAAATGTCATTCCTAAAATAGG - Intergenic
1113391013 13:109897126-109897148 CAAAAGGTAGCTCCTATAACTGG - Intergenic
1120012902 14:79437249-79437271 CAAAAGATCATTCCAGACACTGG - Intronic
1121848858 14:97200692-97200714 GAAAAGGTTGTCCCAGAAACTGG - Intergenic
1122706225 14:103623805-103623827 CAAAAGGTTATGCCAGAAACTGG - Intronic
1126986240 15:54312912-54312934 AAAAAGTTCCTTCCAGAAACTGG + Intronic
1129092872 15:73170019-73170041 TACAAAGTAGTTCCTGAAACTGG + Intronic
1130637397 15:85637563-85637585 CAAAAGCTGGTTCCTTAAAAGGG - Intronic
1132308004 15:100831630-100831652 CTAAAGGTTGTTCCTGGAACAGG - Intergenic
1135227798 16:20676394-20676416 CAAAAAGTCTTTCTTAAAACTGG - Intronic
1144449524 17:15364555-15364577 CAAAACTTCATGCCTGAAACTGG + Intergenic
1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG + Intronic
1158025191 18:52887432-52887454 CAAAAGGTAGTTCCAGCAAAAGG + Intronic
1159988696 18:74876701-74876723 CCAAAGGTGTTTCCTGAACCAGG - Intronic
1160218951 18:76958544-76958566 CAGAAGGTGGTCCCAGAAACAGG + Intronic
1165993613 19:39829946-39829968 CAAAAAGGCTTTCCTGAACCAGG - Exonic
1166726205 19:45029390-45029412 CAAATGGCCCTTCCTCAAACAGG + Intronic
1168090107 19:54076973-54076995 CAAATGGTCATTCCAGAAAGGGG + Intronic
925722741 2:6844320-6844342 CAAAAGGAAGTTGCAGAAACTGG - Intronic
926712171 2:15890449-15890471 CAAAGGGTGGTCCCTGAACCAGG + Intergenic
930066428 2:47331292-47331314 AAAATGGTCTTTCATGAAACTGG - Intergenic
934865949 2:97811441-97811463 AAAAAGCTGGTTCCTGAAAGAGG + Intronic
947603593 2:231469354-231469376 CAAGAGCTTGTTCCTGAAAAAGG - Intronic
947721934 2:232375266-232375288 CCAAAGGGCGGTACTGAAACAGG + Intergenic
1170663317 20:18363519-18363541 AAAAATGTCTTTCATGAAACCGG - Intergenic
1171539214 20:25932506-25932528 CAATAGCTCTTTCCTGAAAATGG + Intergenic
1171801820 20:29627750-29627772 CAATAGCTCTTTCCTGAAAATGG - Intergenic
951634474 3:24757614-24757636 CAGAAGGTAGTGCCTGAATCTGG + Intergenic
951745588 3:25974048-25974070 CAACAGGTCCTTCCTTAAAGGGG - Intergenic
952005191 3:28835531-28835553 CAAAGTGTAGTTCCTGGAACAGG - Intergenic
952529559 3:34249265-34249287 CAAAGTGTGGTTCCTGAACCAGG + Intergenic
955094625 3:55785074-55785096 CAAGAAGTCTTTCCTGAAGCTGG - Intronic
966982446 3:185150941-185150963 CACAATGTCTTTCCTGAAATAGG - Intronic
967472615 3:189880075-189880097 CACAAGCTCATTCCTGAAGCAGG - Intronic
969699217 4:8757207-8757229 AAAATGGTCTTCCCTGAAACTGG + Intergenic
973784054 4:54318618-54318640 CAAAAGATCGTCCTGGAAACAGG - Intergenic
974194679 4:58557531-58557553 GAAAATGTCATTCCTGAATCAGG + Intergenic
975865746 4:78722130-78722152 CAAAGGGTGGTTCATGAAAGAGG - Intergenic
976339595 4:83932290-83932312 AATAAGGTCTTTCCTGACACAGG + Intergenic
977150802 4:93508995-93509017 CAAAAGGTTGTTTCTGAGAATGG + Intronic
978288285 4:107105345-107105367 CTGAAGGTAGTTCCTGAAAAAGG - Intronic
978752939 4:112272516-112272538 CAAAAGGCCCTTCCAGATACTGG + Intergenic
979095634 4:116546603-116546625 AAAAATGTCGTTCATGAAACTGG - Intergenic
984772859 4:183453375-183453397 AAAATGGTCTTCCCTGAAACTGG - Intergenic
989544682 5:42659569-42659591 CAAAAGGACATACCTGAGACTGG + Intronic
993958441 5:94265841-94265863 CATAAGGGCATTCCTGAGACTGG - Intronic
995461739 5:112410680-112410702 TAAAGGGTCTTTCCTGAAGCTGG - Intronic
997139718 5:131365503-131365525 TAAAATGTGGTTCCTGAAAATGG - Intronic
1009069683 6:58614519-58614541 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009086520 6:58849323-58849345 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009099018 6:59023486-59023508 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009103642 6:59087665-59087687 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009106898 6:59133007-59133029 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009107120 6:59136065-59136087 CAAAAAGTCGTTTCTGAGATTGG - Intergenic
1009130797 6:59465429-59465451 CAAAAAGTCGTTTCTGAGATTGG - Intergenic
1012530949 6:100235703-100235725 CTAAATGTAGTTCCTGAAAAGGG - Intergenic
1013422231 6:109977830-109977852 AAAAATGCCGTTCCCGAAACAGG - Intergenic
1014072374 6:117197915-117197937 CAAAAGCTCCGTCCTGACACAGG + Intergenic
1021294587 7:18888848-18888870 GACAAAGTCGTTCCTGAAAAAGG - Intronic
1022813995 7:33896415-33896437 CAAAATGTATTTCCTGAACCAGG - Intergenic
1023311699 7:38894228-38894250 CAAAATATCGCTCCTGGAACTGG + Intronic
1026930549 7:74220843-74220865 CAAGAGGTGGTTCCTGGACCAGG - Intronic
1028815171 7:95134785-95134807 AAAAAATTGGTTCCTGAAACTGG - Intronic
1031245802 7:119309802-119309824 CAAATGTTGGTTCCTTAAACAGG + Intergenic
1035590369 8:808473-808495 CAAAAGGGCGTTCTGGGAACAGG + Intergenic
1038440217 8:27566196-27566218 CAAAGGGTGGCTCCTGACACAGG - Intergenic
1050079345 9:1899425-1899447 TAAAAGGAAGTCCCTGAAACAGG - Intergenic
1052748826 9:32468097-32468119 CTAAATGTCCTTTCTGAAACAGG - Intronic
1058655417 9:107216230-107216252 CAAAAGATCATTTCTGAAATTGG - Intergenic
1194436366 X:93872912-93872934 CAAAAAGAAGTTGCTGAAACAGG - Intergenic
1195641183 X:107176313-107176335 GAAAAGGTCCGTCCTGAAATCGG + Intronic
1198242735 X:134801294-134801316 CAAAAGGTATTTCCAGAAAGGGG + Intronic
1199565304 X:149209307-149209329 CAAATGGGCATTCCTGACACCGG + Intergenic
1199880923 X:151973972-151973994 CCAAAGCTCGTGCCTGAGACTGG + Intronic
1201396688 Y:13555932-13555954 CAAAAGGAAGTTGCTGAAACAGG + Intergenic