ID: 1145927666

View in Genome Browser
Species Human (GRCh38)
Location 17:28659711-28659733
Sequence GCCCGGCCGCCACCCCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13098
Summary {0: 1254, 1: 2879, 2: 4285, 3: 2853, 4: 1827}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927666_1145927673 5 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927673 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 8
2: 752
3: 4349
4: 4420
1145927666_1145927680 19 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927666_1145927675 8 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927675 17:28659742-28659764 TCCTCATATCCCAGACGGGGCGG 0: 7
1: 750
2: 3795
3: 5681
4: 8373
1145927666_1145927677 13 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927677 17:28659747-28659769 ATATCCCAGACGGGGCGGCCAGG 0: 2
1: 75
2: 1068
3: 2815
4: 5171
1145927666_1145927670 3 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927670 17:28659737-28659759 GGCCCTCCTCATATCCCAGACGG 0: 1
1: 10
2: 1043
3: 1584
4: 6799
1145927666_1145927671 4 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927671 17:28659738-28659760 GCCCTCCTCATATCCCAGACGGG 0: 1
1: 7
2: 800
3: 1930
4: 5854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927666 Original CRISPR GCCCGGCCGCCACCCCGTCT GGG (reversed) Intronic