ID: 1145927667

View in Genome Browser
Species Human (GRCh38)
Location 17:28659712-28659734
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10113
Summary {0: 1163, 1: 2416, 2: 2885, 3: 2217, 4: 1432}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927667_1145927671 3 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927671 17:28659738-28659760 GCCCTCCTCATATCCCAGACGGG 0: 1
1: 7
2: 800
3: 1930
4: 5854
1145927667_1145927675 7 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927675 17:28659742-28659764 TCCTCATATCCCAGACGGGGCGG 0: 7
1: 750
2: 3795
3: 5681
4: 8373
1145927667_1145927677 12 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927677 17:28659747-28659769 ATATCCCAGACGGGGCGGCCAGG 0: 2
1: 75
2: 1068
3: 2815
4: 5171
1145927667_1145927680 18 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927667_1145927673 4 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927673 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 8
2: 752
3: 4349
4: 4420
1145927667_1145927670 2 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927670 17:28659737-28659759 GGCCCTCCTCATATCCCAGACGG 0: 1
1: 10
2: 1043
3: 1584
4: 6799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927667 Original CRISPR TGCCCGGCCGCCACCCCGTC TGG (reversed) Intronic