ID: 1145927669

View in Genome Browser
Species Human (GRCh38)
Location 17:28659728-28659750
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19192
Summary {0: 1, 1: 8, 2: 1074, 3: 3522, 4: 14587}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927669_1145927677 -4 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927677 17:28659747-28659769 ATATCCCAGACGGGGCGGCCAGG 0: 2
1: 75
2: 1068
3: 2815
4: 5171
1145927669_1145927680 2 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927669_1145927675 -9 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927675 17:28659742-28659764 TCCTCATATCCCAGACGGGGCGG 0: 7
1: 750
2: 3795
3: 5681
4: 8373
1145927669_1145927683 27 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927669_1145927685 30 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927669_1145927682 26 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927669 Original CRISPR ATATGAGGAGGGCCTCTGCC CGG (reversed) Intronic