ID: 1145927670 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:28659737-28659759 |
| Sequence | GGCCCTCCTCATATCCCAGA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9437 | |||
| Summary | {0: 1, 1: 10, 2: 1043, 3: 1584, 4: 6799} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1145927662_1145927670 | 11 | Left | 1145927662 | 17:28659703-28659725 | CCTCACTTCCCAGACGGGGTGGC | 0: 1882 1: 2591 2: 6222 3: 11614 4: 5578 |
||
| Right | 1145927670 | 17:28659737-28659759 | GGCCCTCCTCATATCCCAGACGG | 0: 1 1: 10 2: 1043 3: 1584 4: 6799 |
||||
| 1145927666_1145927670 | 3 | Left | 1145927666 | 17:28659711-28659733 | CCCAGACGGGGTGGCGGCCGGGC | 0: 1254 1: 2879 2: 4285 3: 2853 4: 1827 |
||
| Right | 1145927670 | 17:28659737-28659759 | GGCCCTCCTCATATCCCAGACGG | 0: 1 1: 10 2: 1043 3: 1584 4: 6799 |
||||
| 1145927667_1145927670 | 2 | Left | 1145927667 | 17:28659712-28659734 | CCAGACGGGGTGGCGGCCGGGCA | 0: 1163 1: 2416 2: 2885 3: 2217 4: 1432 |
||
| Right | 1145927670 | 17:28659737-28659759 | GGCCCTCCTCATATCCCAGACGG | 0: 1 1: 10 2: 1043 3: 1584 4: 6799 |
||||
| 1145927657_1145927670 | 26 | Left | 1145927657 | 17:28659688-28659710 | CCGGGCAGAGGTGCTCCTCACTT | 0: 189 1: 5103 2: 10469 3: 9233 4: 2471 |
||
| Right | 1145927670 | 17:28659737-28659759 | GGCCCTCCTCATATCCCAGACGG | 0: 1 1: 10 2: 1043 3: 1584 4: 6799 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1145927670 | Original CRISPR | GGCCCTCCTCATATCCCAGA CGG | Intronic | ||