ID: 1145927671

View in Genome Browser
Species Human (GRCh38)
Location 17:28659738-28659760
Sequence GCCCTCCTCATATCCCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8592
Summary {0: 1, 1: 7, 2: 800, 3: 1930, 4: 5854}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927667_1145927671 3 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927671 17:28659738-28659760 GCCCTCCTCATATCCCAGACGGG 0: 1
1: 7
2: 800
3: 1930
4: 5854
1145927657_1145927671 27 Left 1145927657 17:28659688-28659710 CCGGGCAGAGGTGCTCCTCACTT 0: 189
1: 5103
2: 10469
3: 9233
4: 2471
Right 1145927671 17:28659738-28659760 GCCCTCCTCATATCCCAGACGGG 0: 1
1: 7
2: 800
3: 1930
4: 5854
1145927666_1145927671 4 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927671 17:28659738-28659760 GCCCTCCTCATATCCCAGACGGG 0: 1
1: 7
2: 800
3: 1930
4: 5854
1145927662_1145927671 12 Left 1145927662 17:28659703-28659725 CCTCACTTCCCAGACGGGGTGGC 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
Right 1145927671 17:28659738-28659760 GCCCTCCTCATATCCCAGACGGG 0: 1
1: 7
2: 800
3: 1930
4: 5854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927671 Original CRISPR GCCCTCCTCATATCCCAGAC GGG Intronic