ID: 1145927672

View in Genome Browser
Species Human (GRCh38)
Location 17:28659739-28659761
Sequence CCCCGTCTGGGATATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 1, 2: 9, 3: 41, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927672_1145927683 16 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927672_1145927680 -9 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927672_1145927686 24 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927686 17:28659786-28659808 ATCCCAGACGATGGGCGGCCAGG 0: 1013
1: 1801
2: 978
3: 377
4: 250
1145927672_1145927685 19 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927672_1145927682 15 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927672 Original CRISPR CCCCGTCTGGGATATGAGGA GGG (reversed) Intronic
900711687 1:4118679-4118701 TCCCGTCTGGGAAAGGAGGTAGG + Intergenic
902548394 1:17204964-17204986 GCCTGTCTGGGAGATGGGGAAGG - Intergenic
903288367 1:22291254-22291276 CTCCATCTGGGAAATAAGGATGG + Intergenic
909623134 1:77687627-77687649 CCCCGTCTGCGAAGTGAGGAGGG + Intergenic
912436973 1:109668681-109668703 CCCCGTCTGGGTAATTATGATGG + Intronic
912966807 1:114242971-114242993 CCCCATCTGGGAACTGAGGAGGG + Intergenic
914787898 1:150850819-150850841 TCCCGTCTAGGAAGTGAGGAGGG + Intronic
915139930 1:153761141-153761163 CCCCTTCAGGGATCTGAGTATGG + Intronic
917126677 1:171694028-171694050 CCCCGTCTGGGAGGGGAGGAGGG - Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917904304 1:179574350-179574372 CCTCATCTGTGATAAGAGGATGG + Intronic
918818912 1:189226056-189226078 CCCCGTCTGGGAGGTGGGGGGGG + Intergenic
918898485 1:190380176-190380198 CTAAGTTTGGGATATGAGGACGG + Intronic
920152478 1:203919942-203919964 CCCTGTCTGGGAAGTGAGGAGGG - Intergenic
920689072 1:208131967-208131989 CCCCGTTTGACAAATGAGGAAGG - Intronic
923901111 1:238327206-238327228 CCCCGTCTGGGAAGTGAGGGGGG - Intergenic
1066025973 10:31361538-31361560 CACCATCTGGGAAGTGAGGAGGG - Intronic
1067333933 10:45346639-45346661 CATTGTCTGGGATGTGAGGAGGG + Intergenic
1068594471 10:58888018-58888040 CCCCTTCTGCCATGTGAGGAAGG - Intergenic
1068832029 10:61506916-61506938 CACTGTCTGGGATATGTGGGAGG - Intergenic
1070138329 10:73715566-73715588 CCCCGTCTGGGATGTGGGGGGGG - Intergenic
1072121138 10:92406509-92406531 GCCTGTCTGTGAAATGAGGAAGG - Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1076024476 10:127100600-127100622 TCCCTTGTGGGATATGTGGAGGG + Intronic
1077330045 11:1980191-1980213 CCCCGTTTTGCAGATGAGGATGG - Intronic
1080843552 11:36006499-36006521 CCCAGTCTGGGATTCGGGGAGGG - Intronic
1081647186 11:44798347-44798369 CCCTGTCTGTGAAATGAGGATGG - Intronic
1081736528 11:45408378-45408400 CCCTGTTTGAGATATGAAGAGGG - Intergenic
1082749683 11:57002686-57002708 CCCCATCTGGGATACAAAGAAGG - Intergenic
1083272431 11:61579198-61579220 CCAGCTCTGGGGTATGAGGATGG - Intronic
1083365292 11:62138553-62138575 CCCCCTGTAGGATAGGAGGATGG - Intronic
1083687165 11:64383439-64383461 CTCTGCCTGGGATATGAGCATGG + Intergenic
1084645813 11:70457031-70457053 CCCCGTCTGGGAAATGGGGGGGG - Intergenic
1085472991 11:76769843-76769865 GCCCGTCTGGGGAAAGAGGAGGG + Intergenic
1089064037 11:115648842-115648864 CCTCGTCTGTGAACTGAGGAGGG - Intergenic
1089069271 11:115686931-115686953 CCTCCACTGGGATAGGAGGAAGG + Intergenic
1091208312 11:133835568-133835590 CCCCCTCAGGGCTCTGAGGAAGG + Intergenic
1202813022 11_KI270721v1_random:35370-35392 CCCCGTTTTGCAGATGAGGATGG - Intergenic
1091446534 12:546876-546898 CCCCATCTGTGAAACGAGGACGG - Intronic
1092199223 12:6569574-6569596 CCTGGTCTGGGACATGAGAAGGG + Intergenic
1095395131 12:41754190-41754212 CCCCTTCTGCCAAATGAGGATGG + Intergenic
1096752672 12:53771995-53772017 TCCCCTCTGGGAGAGGAGGAGGG - Intergenic
1097089603 12:56494669-56494691 CCCTGTCTGGGAAGTGGGGATGG - Intergenic
1097138461 12:56879273-56879295 TCCCGTCTAGGAAGTGAGGAGGG + Intergenic
1098023124 12:66175066-66175088 CATCGTCTGGGAGGTGAGGAGGG + Intergenic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102186346 12:110951042-110951064 CCCCGTCTGGGAAGTGAGGAGGG - Intergenic
1103457066 12:121076188-121076210 CCCCGTCTGGGAAGTGAGAAGGG + Intergenic
1103822952 12:123712787-123712809 CCCCGTCTGGACAATGGGGACGG - Intronic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104675725 12:130710709-130710731 CCCAGTGTGGGAGATGAGGGGGG - Intronic
1104821981 12:131682418-131682440 CCCAGACTGGGGGATGAGGAAGG + Intergenic
1106560223 13:30839871-30839893 CCCTGTCTGGGAAGTGAGGAGGG - Intergenic
1108702237 13:52953506-52953528 CCACGTCCTGGATATGTGGAAGG - Intergenic
1111388583 13:87561707-87561729 CCCCGTCTAGGAGGTGAGGAAGG + Intergenic
1112683522 13:101795438-101795460 GACCTTCTGGGATATGAGGAGGG + Intronic
1114427985 14:22637932-22637954 CCCCGTCCGGGAGGTGAGGGAGG + Intergenic
1114507831 14:23232140-23232162 CCCACTCTGGGAAGTGAGGAGGG + Intronic
1119249095 14:73136731-73136753 CCCCGTGTGGGAAACCAGGAGGG + Intronic
1121278998 14:92686704-92686726 CCACATCTGGGATCTGGGGAGGG + Intronic
1121970686 14:98353385-98353407 CAGGGACTGGGATATGAGGATGG + Intergenic
1128114067 15:65094521-65094543 TTACGTCAGGGATATGAGGAAGG - Exonic
1128346007 15:66852779-66852801 CCCCTTCTGTGAAATGGGGACGG - Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1131655005 15:94447119-94447141 CCCTGTCTGGGTAATGAGGAAGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132145289 15:99425774-99425796 CCCCGTCTTGGATATGGGGCTGG - Intergenic
1132373560 15:101313691-101313713 CCCCGTCTGTGAAATGGTGATGG - Intronic
1133030458 16:3008437-3008459 CCACGTCTGGGAAAAGAGGTGGG - Intergenic
1133527893 16:6624154-6624176 CACAGACTTGGATATGAGGAAGG + Intronic
1133724847 16:8527855-8527877 CCCAGTCTAGGTGATGAGGAGGG - Intergenic
1134415849 16:14042834-14042856 TCCCGTCTGGGGTATTAGCAAGG - Intergenic
1135863241 16:26076710-26076732 CAGCTTCTGGGGTATGAGGATGG + Intronic
1136112043 16:28069737-28069759 CCTCGTCTGTGAAATGAGGGCGG + Intergenic
1137530664 16:49276920-49276942 CCCGGTCTGGGAGCAGAGGAGGG + Intergenic
1137883211 16:52074435-52074457 CCCCATCTTGCAGATGAGGAAGG + Intronic
1138037733 16:53625374-53625396 CCCCGTCTGGGAACTGGGGGGGG + Intronic
1138307263 16:55989176-55989198 CCCCATCTAGGAAGTGAGGAGGG + Intergenic
1138332133 16:56223660-56223682 CCACCTTTGGGTTATGAGGATGG + Intronic
1139365245 16:66428618-66428640 CCCCATCTGGAACATGGGGAAGG + Intronic
1141132206 16:81444528-81444550 CCCCGCCTGGAATGTGGGGAGGG - Intergenic
1141587468 16:85044375-85044397 CCCCCTCTGGGATACTACGAGGG - Intronic
1142342163 16:89530853-89530875 GCCCTTCTGGGAGAGGAGGACGG - Intronic
1142350532 16:89577314-89577336 CCCCATCTGTGATCTGAGGGTGG + Intronic
1143667656 17:8373709-8373731 TCCCGTCTGGGAAGTGAGGAGGG + Intronic
1144006822 17:11107992-11108014 CCCCATTTGGGAAATCAGGACGG + Intergenic
1144866357 17:18338225-18338247 CCCCGTCTGGGAGGTGAGGAGGG + Intronic
1145927672 17:28659739-28659761 CCCCGTCTGGGATATGAGGAGGG - Intronic
1146643012 17:34555328-34555350 CCCTGCCTGGGACATAAGGAGGG + Intergenic
1146941802 17:36848515-36848537 CACCCTCTGAGATGTGAGGATGG + Intergenic
1147164129 17:38584465-38584487 CCCCGCCTGGGAAACGCGGAAGG + Intronic
1147246835 17:39127249-39127271 CCTCATCTGGGACCTGAGGAGGG + Intronic
1147757936 17:42780727-42780749 CTCAGTCTGGGACATGAGGACGG - Exonic
1147999065 17:44377083-44377105 TCCTATCTGGGAGATGAGGAGGG + Exonic
1148159030 17:45439622-45439644 CCCCGTCTGCGATCTGCGGAGGG + Exonic
1148159038 17:45439666-45439688 CCCCGTCTGCGATCTGCGGAGGG + Intronic
1148242632 17:46010593-46010615 CCCCTCCTAGAATATGAGGAAGG - Intronic
1148344706 17:46895389-46895411 CCCCATTTGTGTTATGAGGACGG + Intergenic
1150069100 17:62137468-62137490 GCCCGTGTGGGAGATGAGGCGGG + Intergenic
1150215524 17:63466736-63466758 CCCCGTCTTGGAGGTGAGAATGG + Intergenic
1150390388 17:64786756-64786778 CCCCGTCTGCGATCTGCGGAGGG + Intergenic
1152685239 17:81690664-81690686 CCCAGTCTGGGGCCTGAGGAGGG - Exonic
1154962824 18:21327342-21327364 ACAGGTCTGGGACATGAGGAAGG - Intronic
1156232884 18:35172123-35172145 CCCCATTTGCCATATGAGGAAGG + Intergenic
1160159462 18:76460259-76460281 CCTCGTCTGTGAAATGAGGGTGG - Intronic
1160939936 19:1615510-1615532 CCTCGTCTGGGCTATGGGGAGGG + Exonic
1162298570 19:9830045-9830067 CCCAGTGTGGGGGATGAGGATGG - Exonic
1162602087 19:11676946-11676968 CCCCGTCTGGGAAGTGAGGAGGG - Intergenic
1163945570 19:20530726-20530748 CCCAGTCTGGAAAGTGAGGAGGG - Intergenic
1164017454 19:21265211-21265233 CCCTGTCTGGGAAGTGAGGACGG + Intronic
1164298491 19:23937330-23937352 CCCCATCTGGGAAGTGAGGAGGG - Intronic
1165362151 19:35343471-35343493 CCTCGTCTGTGTCATGAGGAAGG - Intronic
1165700508 19:37933612-37933634 CCCCGTTTGGGGTTTGAGGAGGG + Intronic
1166254080 19:41589966-41589988 CCCCATCATAGATATGAGGAGGG - Intronic
1166827120 19:45616553-45616575 CCCCGTCTGGGGGAGGGGGAGGG + Exonic
1166916277 19:46197862-46197884 CCCCATCTGTGATGGGAGGAGGG - Intergenic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167250722 19:48397129-48397151 CCCCATCTGGGATGTGGGGTTGG - Intronic
1167649313 19:50720727-50720749 CCCCCTCTGGAAAATGGGGATGG - Intergenic
1168129029 19:54305648-54305670 CCCGGCCTGGGATAGAAGGAAGG - Intergenic
1168177492 19:54635468-54635490 CCCCATCTGGGAGCTGAGCAGGG + Intronic
1168519448 19:57036924-57036946 CCCCGTCTAGAATATGAAGCAGG + Intergenic
926246045 2:11123041-11123063 CCCTGTCAGGGATACGAGGAAGG + Intergenic
930208856 2:48614815-48614837 CCCCGTCTGGGATGTGAGGAGGG - Intronic
930396449 2:50828727-50828749 CCCAGTCTGGAAAGTGAGGAGGG - Intronic
934551381 2:95264760-95264782 CACCGTCTGACATATTAGGAAGG + Intergenic
934602830 2:95671242-95671264 CACTGTCTGGGAAATGAGAATGG - Intergenic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
936268981 2:111033853-111033875 CCCTTCCTGGGACATGAGGATGG + Intronic
937403496 2:121606596-121606618 CCAAGTATGGGAAATGAGGAAGG + Intronic
937426234 2:121801394-121801416 TCCCATCTGGAATATGAGGGAGG - Intergenic
941487812 2:166103560-166103582 CTTCTTTTGGGATATGAGGAGGG + Intronic
942630113 2:177945512-177945534 CCCCGTCTGGGAGGTGAGGAGGG + Intronic
943125709 2:183792123-183792145 CATCGTCTGGGAAGTGAGGAGGG - Intergenic
943418473 2:187637261-187637283 CCCCATCTGGGAAGTGAGGAGGG - Intergenic
943418497 2:187637335-187637357 CCCCATCTGGGAAGTGAGGAGGG - Intergenic
943418521 2:187637409-187637431 CCCCATCTGGGAAGCGAGGAGGG - Intergenic
944797866 2:203206840-203206862 CCCCGTCTGGGAAGTGAGGAGGG + Intronic
948447064 2:238041001-238041023 CCCCATCTGGAAAATGAGAAGGG + Intronic
1171091048 20:22286029-22286051 CCACGAGTGGGATATGTGGAGGG + Intergenic
1172185785 20:33030250-33030272 CCCCGTCTGTGAGATGGGGCTGG + Intergenic
1174200018 20:48800576-48800598 CCTCGTCTGTGACATGAGGGAGG - Intronic
1175540031 20:59742667-59742689 CCCTGTCTGGGACAAGAGGAAGG + Intronic
1175590795 20:60190300-60190322 CCCCGCCCCGGGTATGAGGAAGG - Intergenic
1175679248 20:60973499-60973521 CCCCATCTGTGAAATGAGTATGG + Intergenic
1182126672 22:27821065-27821087 CCACGTCTGGAAATTGAGGACGG + Intergenic
1182269523 22:29144800-29144822 CCCTGACTGAGATGTGAGGAGGG - Intronic
1182917045 22:34043629-34043651 CCCTGCCTGGGAGATGGGGAGGG + Intergenic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
950101066 3:10357239-10357261 CCCCCTCTGGGATATCATGAAGG - Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
951764888 3:26186676-26186698 CCCCGTCTGGGAGTGGAGGGTGG + Intergenic
952114655 3:30164096-30164118 CCCTTTCTGGGACAGGAGGAAGG + Intergenic
952532079 3:34273199-34273221 ACCCCTCTGGGAGTTGAGGATGG + Intergenic
952896590 3:38082098-38082120 CCCCGTCTGGGAGGTGAGGAGGG - Intronic
953239287 3:41134315-41134337 CCTCGTGTGGGATATGTGGAAGG - Intergenic
953928170 3:46992822-46992844 CCCCTTCTGAGAAATGAGGTAGG - Intronic
954399624 3:50312214-50312236 CCCTGTCTGGGAAGTGAGGAGGG - Intronic
956106965 3:65829467-65829489 CCCCTTCTGGCATGTCAGGAAGG + Intronic
958406881 3:93763455-93763477 CCCCGTCTGGGAGCTGAGGGGGG - Intergenic
958407103 3:93764244-93764266 CCCTGCCTGGGAAGTGAGGAGGG - Intergenic
959756303 3:109903797-109903819 CCCCGTTTTGCAAATGAGGAAGG - Intergenic
961132789 3:124484371-124484393 CCTCTTCTTGGAGATGAGGAAGG - Intronic
966206742 3:177413154-177413176 CCCAGTCTGGGAAGTGAGGAGGG - Intergenic
968156580 3:196385777-196385799 CCCCGTCTGGGAAGTGGGGGGGG + Intronic
969124347 4:4935405-4935427 CCCCTTCTGGGCTATGAGTCAGG - Intergenic
969294890 4:6263965-6263987 CCCAGGGTGGGATATGAGCAGGG + Intergenic
969355864 4:6625260-6625282 CCCCTTCTGCCATGTGAGGACGG - Intergenic
969710541 4:8840670-8840692 CCCAGTCAGGTATGTGAGGAAGG + Intergenic
970376018 4:15457861-15457883 CCTCTTCTGGAATATGAGGTGGG - Intergenic
971282128 4:25249755-25249777 CATCGTCTGGGATGTGGGGAGGG - Intronic
972683104 4:41325852-41325874 CCAGGTATGGGATATGTGGAGGG + Intergenic
979511143 4:121555249-121555271 CCACCTATGGGATAGGAGGAAGG + Intergenic
985327442 4:188787417-188787439 CCCCGTCAAGGATATTAAGATGG - Intergenic
992002750 5:72451752-72451774 CCAGGTCTAGGAAATGAGGATGG + Intronic
992395531 5:76366158-76366180 CCCCCTCTCGGCAATGAGGAAGG - Intergenic
1002580791 5:180208648-180208670 CCCCGTCTATGAAATGGGGACGG - Intronic
1003854224 6:10255909-10255931 CCCGGTCTGGTGTATAAGGAAGG + Intergenic
1006149067 6:31976386-31976408 CCCCGTCTGGGAGGTGAGGAGGG - Intronic
1006342451 6:33454142-33454164 CCCCGCCTGGAAACTGAGGACGG + Intronic
1006359338 6:33578817-33578839 CTCCCTCTGGGATAGGAGGAGGG - Intronic
1007984388 6:46193187-46193209 TCTAGTCTGGGCTATGAGGAAGG - Intergenic
1008909880 6:56721065-56721087 CCCCGTCTGGGAGGTGGGGGGGG - Intronic
1010001943 6:70956919-70956941 CCCCGGCGGGAATGTGAGGAAGG - Exonic
1014863437 6:126498087-126498109 CACTGTCTGGGAAGTGAGGAGGG - Intergenic
1015052880 6:128863295-128863317 CACTGTCTGGGATTGGAGGAGGG + Intergenic
1016378789 6:143451202-143451224 CCTAGTCTGGGATATGTAGAGGG + Intronic
1017581854 6:155873372-155873394 GCACGTCTCAGATATGAGGAAGG - Intergenic
1018511998 6:164534097-164534119 GCACCTCTGGGATATGAAGATGG + Intergenic
1019900104 7:4013835-4013857 CCCCTTCTTTGAAATGAGGAAGG - Intronic
1022374597 7:29801724-29801746 CCCCTTGTGGGATGTGAGGCAGG - Intergenic
1023675583 7:42626550-42626572 CTCCTTCTGGGATGTGACGATGG - Intergenic
1023990218 7:45124282-45124304 CCCTTTCTGGCATATGAGGGTGG - Intergenic
1026069157 7:67102473-67102495 ACCTGACTGGGAAATGAGGAGGG + Intronic
1026707743 7:72709846-72709868 ACCTGACTGGGAAATGAGGAGGG - Intronic
1026969930 7:74461542-74461564 CCCCGGCTGGCACATGAGAAGGG + Intronic
1028595723 7:92545270-92545292 ACCCGTCTAGGAAGTGAGGAGGG - Intergenic
1028916553 7:96265900-96265922 CCCCTTCTGCCATGTGAGGATGG - Intronic
1031914084 7:127546130-127546152 ACCATTCTGGGATCTGAGGATGG + Intergenic
1032417172 7:131744661-131744683 CCCAGGCTGGGCTCTGAGGAGGG + Intergenic
1033422109 7:141212781-141212803 CTCCTTCTGGGATCTGTGGATGG + Intronic
1035549438 8:509212-509234 ACCATTCTGGGATCTGAGGATGG + Intronic
1035673546 8:1438274-1438296 CCATGTCATGGATATGAGGAAGG + Intergenic
1036121285 8:6020443-6020465 CCCCGTCTGGGATGTTTGGCCGG - Intergenic
1036506980 8:9365138-9365160 CCCCGTCTGGGAAGTGAGGTGGG - Intergenic
1037638840 8:20724384-20724406 CTCCTGCTGGGAAATGAGGAGGG - Intergenic
1039153146 8:34528794-34528816 CCCCGTCCGGGAGGTGAGGGGGG - Intergenic
1039153199 8:34528921-34528943 CCCCGTCTGGGAGGTGAGGGGGG - Intergenic
1041851231 8:62395295-62395317 CACCGTCTGGGAAGTGAGGGGGG - Intronic
1043163732 8:76877253-76877275 ACCCCTCTGAGATATGAGGTAGG + Intergenic
1043698969 8:83259527-83259549 CCAAATCTGGGATATGATGAGGG - Intergenic
1050417555 9:5433033-5433055 CATCGTCTGGGATGTGAGGAGGG + Intronic
1052236183 9:26215087-26215109 CCCCGTCTGGGAGGTGAGGAGGG - Intergenic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1055580612 9:77703283-77703305 CCCAGTCTAGGAAGTGAGGAGGG - Intergenic
1056166822 9:83948323-83948345 CCCCGTCTGGGAAGTGAGGAGGG + Intronic
1056515124 9:87342981-87343003 TGCCCTCTGGGATGTGAGGAAGG + Intergenic
1057674842 9:97130559-97130581 CCCCGTCTGGGAGGTGGGGGGGG - Intergenic
1058017669 9:100054142-100054164 TCCCATCAGGGATAAGAGGATGG + Intronic
1061390215 9:130313485-130313507 CCTCGTCTGTGAAACGAGGAGGG + Intronic
1062040335 9:134401653-134401675 CCCCGTCGGGGAGGTGAGGGAGG - Exonic
1062590248 9:137271334-137271356 CCCCATCCGGGATACTAGGAAGG + Intronic
1186282207 X:8004792-8004814 CCCCTTCTGGGTTATGTGGGTGG + Intergenic
1186567198 X:10676346-10676368 CTCTGTCTGGTGTATGAGGACGG - Intronic
1188671038 X:32882158-32882180 CCCTCTCTGGGATAGCAGGAAGG - Intronic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1190174664 X:48138990-48139012 CCCCGTCTAGGAAGTGAGGAGGG + Intergenic
1191706333 X:64098155-64098177 CCCTGTCTGTGAAGTGAGGATGG - Intergenic
1192308347 X:69987517-69987539 CCCTGTCTGGGATATGTGAGAGG - Intronic
1194714552 X:97275230-97275252 CCCCGTCTGGGAGGTGGGGGGGG - Intronic
1194714648 X:97275423-97275445 CCCCGTCTGGGAGGTGAAGGGGG - Intronic
1195676689 X:107512182-107512204 CCCCATCTGTGAGATGGGGAGGG + Intergenic
1195979017 X:110558644-110558666 CCCCATCTGGAATGTGAGGAGGG - Intergenic
1199586370 X:149420625-149420647 CCCAGTCTGGAAAGTGAGGAGGG + Intergenic
1199874936 X:151921795-151921817 GCCCTCCTGGGAGATGAGGAAGG + Intronic