ID: 1145927672

View in Genome Browser
Species Human (GRCh38)
Location 17:28659739-28659761
Sequence CCCCGTCTGGGATATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 1, 2: 9, 3: 41, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927672_1145927682 15 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927672_1145927686 24 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927686 17:28659786-28659808 ATCCCAGACGATGGGCGGCCAGG 0: 1013
1: 1801
2: 978
3: 377
4: 250
1145927672_1145927685 19 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927672_1145927680 -9 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927672_1145927683 16 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927672 Original CRISPR CCCCGTCTGGGATATGAGGA GGG (reversed) Intronic