ID: 1145927673 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:28659739-28659761 |
Sequence | CCCTCCTCATATCCCAGACG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 9530 | |||
Summary | {0: 1, 1: 8, 2: 752, 3: 4349, 4: 4420} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1145927666_1145927673 | 5 | Left | 1145927666 | 17:28659711-28659733 | CCCAGACGGGGTGGCGGCCGGGC | 0: 1254 1: 2879 2: 4285 3: 2853 4: 1827 |
||
Right | 1145927673 | 17:28659739-28659761 | CCCTCCTCATATCCCAGACGGGG | 0: 1 1: 8 2: 752 3: 4349 4: 4420 |
||||
1145927657_1145927673 | 28 | Left | 1145927657 | 17:28659688-28659710 | CCGGGCAGAGGTGCTCCTCACTT | 0: 189 1: 5103 2: 10469 3: 9233 4: 2471 |
||
Right | 1145927673 | 17:28659739-28659761 | CCCTCCTCATATCCCAGACGGGG | 0: 1 1: 8 2: 752 3: 4349 4: 4420 |
||||
1145927662_1145927673 | 13 | Left | 1145927662 | 17:28659703-28659725 | CCTCACTTCCCAGACGGGGTGGC | 0: 1882 1: 2591 2: 6222 3: 11614 4: 5578 |
||
Right | 1145927673 | 17:28659739-28659761 | CCCTCCTCATATCCCAGACGGGG | 0: 1 1: 8 2: 752 3: 4349 4: 4420 |
||||
1145927667_1145927673 | 4 | Left | 1145927667 | 17:28659712-28659734 | CCAGACGGGGTGGCGGCCGGGCA | 0: 1163 1: 2416 2: 2885 3: 2217 4: 1432 |
||
Right | 1145927673 | 17:28659739-28659761 | CCCTCCTCATATCCCAGACGGGG | 0: 1 1: 8 2: 752 3: 4349 4: 4420 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1145927673 | Original CRISPR | CCCTCCTCATATCCCAGACG GGG | Intronic | ||