ID: 1145927674

View in Genome Browser
Species Human (GRCh38)
Location 17:28659740-28659762
Sequence GCCCCGTCTGGGATATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 9, 3: 55, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927674_1145927683 15 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927674_1145927682 14 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927674_1145927680 -10 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927674_1145927686 23 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927686 17:28659786-28659808 ATCCCAGACGATGGGCGGCCAGG 0: 1013
1: 1801
2: 978
3: 377
4: 250
1145927674_1145927685 18 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927674 Original CRISPR GCCCCGTCTGGGATATGAGG AGG (reversed) Intronic
900677385 1:3896348-3896370 ACCCCGTCCTAGATATGAGGTGG + Intronic
900703458 1:4061933-4061955 GCCCCGTGAGGGGTAAGAGGAGG - Intergenic
904082299 1:27879882-27879904 GCCCCTTCTGGGATAGGGGCAGG - Exonic
904831567 1:33309356-33309378 CCCCCGTCTGGGAGGTGGGGGGG - Intronic
904838767 1:33356880-33356902 GCCCCGTCTGGGAGGTGGGGGGG - Intronic
905040039 1:34948157-34948179 GCCCCGTCCGGGAGGTGGGGGGG + Intergenic
905277803 1:36830197-36830219 TCCCCATCTGGAATATGACGAGG - Intronic
906308866 1:44738782-44738804 GCCCTGTCTGGGAGGTGGGGGGG + Intergenic
909623132 1:77687626-77687648 ACCCCGTCTGCGAAGTGAGGAGG + Intergenic
910412633 1:86963749-86963771 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
912966805 1:114242970-114242992 GCCCCATCTGGGAACTGAGGAGG + Intergenic
913293926 1:117300766-117300788 GCCCCATCTGGGAGGTGGGGGGG - Intergenic
917126679 1:171694029-171694051 ACCCCGTCTGGGAGGGGAGGAGG - Intergenic
917553302 1:176058024-176058046 GCCCCGTCTGAGAAGTGAGGAGG + Intronic
917860038 1:179135858-179135880 GCCCCGTCCAGGAGGTGAGGGGG + Intronic
918818910 1:189226055-189226077 ACCCCGTCTGGGAGGTGGGGGGG + Intergenic
920065536 1:203266795-203266817 GCCCCTTCTGGGAGATGGGGGGG - Intronic
920152480 1:203919943-203919965 ACCCTGTCTGGGAAGTGAGGAGG - Intergenic
923174926 1:231454403-231454425 GCCCCGTCTGGGAGGTCTGGGGG + Intergenic
923901113 1:238327207-238327229 GCCCCGTCTGGGAAGTGAGGGGG - Intergenic
1066266576 10:33781870-33781892 GCGCAGTCAGGGATATGAAGAGG - Intergenic
1067391209 10:45865509-45865531 GCCCCGTCCGGGAGGTGGGGGGG - Intergenic
1067872070 10:49970602-49970624 GCCCCGTCCGGGAGGTGGGGGGG + Intronic
1070138331 10:73715567-73715589 GCCCCGTCTGGGATGTGGGGGGG - Intergenic
1071311336 10:84347366-84347388 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
1071538247 10:86454692-86454714 CCATCGTCTGGGATGTGAGGAGG + Intronic
1071616670 10:87081224-87081246 GCCTCTTCTGGGAGGTGAGGGGG + Intronic
1072480940 10:95809576-95809598 GCCCCGTCTGGGAGGTGGGGGGG - Intronic
1072756163 10:98022593-98022615 GCAATGTCTGGGATATGGGGTGG + Intronic
1074489563 10:113927031-113927053 GCCCCTTCTGCCATGTGAGGAGG + Intergenic
1075243402 10:120798711-120798733 GCCCCGTCCGGGAGGTGGGGGGG + Intergenic
1075243424 10:120798755-120798777 GCCCCGTCTGGGAGGTTGGGGGG + Intergenic
1075567875 10:123517969-123517991 TCCCCATCTGTGAAATGAGGGGG + Intergenic
1076024475 10:127100599-127100621 GTCCCTTGTGGGATATGTGGAGG + Intronic
1077073644 11:689908-689930 GCCCCTCCTAGGAAATGAGGAGG + Intronic
1077668756 11:4137996-4138018 GCCCCTACTGGGAAGTGAGGAGG - Intronic
1079401933 11:20112796-20112818 GGCCCATCTGGTAAATGAGGGGG + Intronic
1080843554 11:36006500-36006522 GCCCAGTCTGGGATTCGGGGAGG - Intronic
1081736530 11:45408379-45408401 GCCCTGTTTGAGATATGAAGAGG - Intergenic
1082678886 11:56144001-56144023 GCCCCTACTGGGAAGTGAGGAGG + Intergenic
1083313891 11:61802375-61802397 GCCCAGTCTGGAAGAAGAGGAGG - Exonic
1083342778 11:61969001-61969023 ACCCAGTCTGGGATAGGAGGAGG + Intergenic
1084049052 11:66588099-66588121 GCCCCATCCGGGAGGTGAGGGGG + Intergenic
1084530063 11:69721936-69721958 GGCCTGTCTGGGTTATGGGGAGG - Intergenic
1084645815 11:70457032-70457054 GCCCCGTCTGGGAAATGGGGGGG - Intergenic
1087955041 11:104275918-104275940 GCCAGGTCTGGGATATGAATGGG + Intergenic
1088677202 11:112206139-112206161 GCCCTGTCTGGGAAGTGAGGAGG - Intronic
1089327262 11:117665881-117665903 TCCTCATCTGGGAAATGAGGAGG - Intronic
1089401248 11:118165996-118166018 GCCAAGGCTGGGAAATGAGGAGG - Exonic
1092189462 12:6507926-6507948 GCCTCCTGTGGGATATGATGAGG - Intronic
1092827540 12:12414019-12414041 GCCCCGTCCAGGAGGTGAGGGGG - Intronic
1095113807 12:38330327-38330349 GCCCCGTCTGGGAGGTGGGGGGG - Intergenic
1096752673 12:53771996-53772018 GTCCCCTCTGGGAGAGGAGGAGG - Intergenic
1097138553 12:56879582-56879604 GCCCCGTCTGGGAGGTTGGGGGG + Intergenic
1101704215 12:107205873-107205895 CCCCCCTGTGGGGTATGAGGTGG + Intergenic
1102186348 12:110951043-110951065 ACCCCGTCTGGGAAGTGAGGAGG - Intergenic
1102294175 12:111723813-111723835 GCCCCGTCTGAGAAGTGAGGAGG - Intronic
1102323442 12:111957680-111957702 GTCCCGTCTGGGAGGTGGGGGGG + Intronic
1103045475 12:117731479-117731501 GCCCCATCTGGGAAGTGAGGAGG + Intronic
1103457064 12:121076187-121076209 ACCCCGTCTGGGAAGTGAGAAGG + Intergenic
1104675727 12:130710710-130710732 ACCCAGTGTGGGAGATGAGGGGG - Intronic
1106560225 13:30839872-30839894 ACCCTGTCTGGGAAGTGAGGAGG - Intergenic
1107425790 13:40291480-40291502 GCCCAGTCTGGGACAGGAAGAGG + Intergenic
1112683521 13:101795437-101795459 AGACCTTCTGGGATATGAGGAGG + Intronic
1113915293 13:113867147-113867169 GCCCCTACTGGGAAGTGAGGAGG + Intergenic
1114336689 14:21697983-21698005 GCCCCGTCTGGGAGTTGCGGGGG + Intergenic
1114507829 14:23232139-23232161 GCCCACTCTGGGAAGTGAGGAGG + Intronic
1114557386 14:23569868-23569890 GCCCTGCCTGGGAGAAGAGGGGG - Intronic
1114594255 14:23898308-23898330 ACCCCGTCTGGGAGGTGGGGGGG - Intergenic
1115493885 14:33984378-33984400 GCCCCGTCTGGGAGGTCGGGGGG - Intronic
1116005192 14:39285340-39285362 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
1118209206 14:63751008-63751030 GCCCCGTCCGGGAGGTGGGGGGG - Intergenic
1118955594 14:70477701-70477723 GCCCCATCTGGGAGGTGGGGGGG + Intergenic
1119051829 14:71377241-71377263 GCCCCGTCTGGGAGGTGGGGGGG - Intronic
1120087191 14:80287024-80287046 GCCCCGTCTGGGAGGTGGGGGGG + Intronic
1122775772 14:104116502-104116524 CCCCCGCGTGGGAAATGAGGAGG + Intergenic
1124995465 15:34719487-34719509 GCCAGGTCTGGGATCTGATGGGG - Intergenic
1125817786 15:42601453-42601475 GCCCCGTCTGGGAGGTTGGGGGG - Intronic
1125817848 15:42601579-42601601 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
1125861704 15:43005496-43005518 GCTCCGTCTGGGAGGTGGGGGGG + Intronic
1128489809 15:68134803-68134825 GCCCCATCCGGGAGGTGAGGGGG - Intronic
1128490049 15:68135327-68135349 GCCCCATCCGGGAGGTGAGGGGG - Intronic
1128725705 15:69987024-69987046 TCCCCATCTGTGAAATGAGGAGG - Intergenic
1133030460 16:3008438-3008460 ACCACGTCTGGGAAAAGAGGTGG - Intergenic
1133614294 16:7461821-7461843 GCGACTTCTGGGATGTGAGGGGG + Intronic
1133730156 16:8571950-8571972 TCCCCTTCTGGGATATCAGTTGG - Intronic
1135694268 16:24574073-24574095 GCCCCGTCCGGGAGGTGGGGGGG - Intergenic
1138037731 16:53625373-53625395 ACCCCGTCTGGGAACTGGGGGGG + Intronic
1138037749 16:53625415-53625437 GCCCCGTCTGGGGGGTGGGGTGG + Intronic
1138037790 16:53625504-53625526 GCCCCGTCTAGGGGGTGAGGGGG + Intronic
1138642407 16:58396624-58396646 GCCCCGTCCGGGAAGGGAGGTGG - Intronic
1139885430 16:70204631-70204653 ACCCCGTCTGAGAAGTGAGGAGG + Intergenic
1139961800 16:70722212-70722234 TCCCCGCCTGGGCTATGAAGTGG + Intronic
1141132208 16:81444529-81444551 GCCCCGCCTGGAATGTGGGGAGG - Intergenic
1143627897 17:8121623-8121645 GCCCCGTCTTGTCTGTGAGGCGG + Exonic
1143667655 17:8373708-8373730 ATCCCGTCTGGGAAGTGAGGAGG + Intronic
1144866355 17:18338224-18338246 ACCCCGTCTGGGAGGTGAGGAGG + Intronic
1145927674 17:28659740-28659762 GCCCCGTCTGGGATATGAGGAGG - Intronic
1146077409 17:29744145-29744167 GCCCCTGCTGGGGTAGGAGGGGG + Intronic
1148159028 17:45439621-45439643 ACCCCGTCTGCGATCTGCGGAGG + Exonic
1148159036 17:45439665-45439687 ACCCCGTCTGCGATCTGCGGAGG + Intronic
1149194909 17:54108030-54108052 GCCCCATCTGTGAAATGAGATGG - Intergenic
1150069099 17:62137467-62137489 AGCCCGTGTGGGAGATGAGGCGG + Intergenic
1150390386 17:64786755-64786777 ACCCCGTCTGCGATCTGCGGAGG + Intergenic
1152355364 17:79804214-79804236 GCGCCGTCTGGGACACGAAGGGG + Intergenic
1152458551 17:80429697-80429719 ACCCCATCTGGGGTGTGAGGGGG + Intronic
1157705284 18:49800204-49800226 GCCCCGTCCGGGAGGTGGGGGGG + Intronic
1159782688 18:72677899-72677921 GTCCTGTCTGGGATACGTGGGGG - Intergenic
1160939934 19:1615509-1615531 TCCTCGTCTGGGCTATGGGGAGG + Exonic
1161347169 19:3774226-3774248 GCCCATTCTGGGCTGTGAGGTGG + Intergenic
1162098449 19:8324824-8324846 GCCCCGTCTGGGGAGTGGGGAGG + Exonic
1162602031 19:11676811-11676833 GCCCCGTCTGGGAGGTGGGGGGG - Intergenic
1162602089 19:11676947-11676969 GCCCCGTCTGGGAAGTGAGGAGG - Intergenic
1163558394 19:18005580-18005602 GCCCCGTCCGGGAGGTGAGGGGG - Intronic
1163849004 19:19653072-19653094 GCCCAGTCTGTGGTATGTGGTGG - Intronic
1163904262 19:20137774-20137796 GCCCAGTCTGGAAAGTGAGGAGG + Intergenic
1163945572 19:20530727-20530749 GCCCAGTCTGGAAAGTGAGGAGG - Intergenic
1164065064 19:21708097-21708119 GCCCCGTCCGGGAGGTGGGGGGG + Intergenic
1164298493 19:23937331-23937353 ACCCCATCTGGGAAGTGAGGAGG - Intronic
1164301133 19:23964093-23964115 GCCCCGTCTGAGAAGTGAGGAGG + Intergenic
1165700506 19:37933611-37933633 GCCCCGTTTGGGGTTTGAGGAGG + Intronic
1166827118 19:45616552-45616574 GCCCCGTCTGGGGGAGGGGGAGG + Exonic
1166995801 19:46719201-46719223 GCCCCGCCTGGGATGTGTGAGGG - Intergenic
1167367802 19:49064121-49064143 GCCCCATCTGGGAGATGAATGGG - Intronic
1168177490 19:54635467-54635489 GCCCCATCTGGGAGCTGAGCAGG + Intronic
1168213470 19:54908576-54908598 GCCCCGTCTGGGAGGTGGGGGGG - Intronic
925139503 2:1540139-1540161 GCCCCGACCTGGAGATGAGGGGG - Intronic
929064964 2:37963905-37963927 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
929066120 2:37977624-37977646 ACCCCGTCTGGGAGGTGAGGAGG - Intronic
929515918 2:42605478-42605500 GCCCCGTCCGGGAGGTGAGGGGG - Intronic
930208858 2:48614816-48614838 GCCCCGTCTGGGATGTGAGGAGG - Intronic
930363614 2:50411679-50411701 GCCCTGTCTGGGAGGTGGGGGGG + Intronic
930396451 2:50828728-50828750 GCCCAGTCTGGAAAGTGAGGAGG - Intronic
935357937 2:102221763-102221785 TCCTCATCTGGGAAATGAGGAGG + Intronic
935630550 2:105210506-105210528 GCCCCATCCGGGAGGTGAGGGGG - Intergenic
941769104 2:169327863-169327885 GCCCCGTCCGGGAAGGGAGGTGG + Intronic
942630098 2:177945472-177945494 GCCCCATCTGGGATGTGAGGAGG + Intronic
942630111 2:177945511-177945533 ACCCCGTCTGGGAGGTGAGGAGG + Intronic
943418475 2:187637262-187637284 GCCCCATCTGGGAAGTGAGGAGG - Intergenic
943418499 2:187637336-187637358 GCCCCATCTGGGAAGTGAGGAGG - Intergenic
943418523 2:187637410-187637432 GCCCCATCTGGGAAGCGAGGAGG - Intergenic
943578161 2:189653922-189653944 GCCCTGTCTGGGAGGTGGGGGGG + Intergenic
944570925 2:201042839-201042861 ACCCCGTCTGGGAGGTGGGGGGG + Intronic
944797864 2:203206839-203206861 ACCCCGTCTGGGAAGTGAGGAGG + Intronic
945864766 2:215163321-215163343 GCCCCGTCCGGGAGGTGGGGGGG - Intergenic
946440396 2:219690394-219690416 GCCCCGACTGGGATCTGCTGTGG + Intergenic
1169108745 20:3019035-3019057 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
1169441742 20:5639256-5639278 GCCCCGTCCGGGAGGTGGGGGGG - Intergenic
1170468257 20:16642868-16642890 GCCCTGTCTGGGCTATCAGCTGG + Intergenic
1171191840 20:23164485-23164507 GCTCCATCTGGGAGAGGAGGAGG - Intergenic
1174046132 20:47735160-47735182 GCCCTGGCTGTGAAATGAGGGGG + Intronic
1176056853 20:63153305-63153327 GTCCCGTCTGGGACGTGAGCAGG + Intergenic
1176140224 20:63541711-63541733 GCCACGTCTTAGAGATGAGGAGG - Intronic
1176869728 21:14075150-14075172 GCCCTTTCTGGGATACGAGAGGG - Intergenic
1177006005 21:15672756-15672778 GCCCCGTCTGGGAGGTGAGGAGG - Intergenic
1177006019 21:15672792-15672814 GCCCCGTCCGGGAGGTGAGGAGG - Intergenic
1182563951 22:31184019-31184041 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
1184599237 22:45532827-45532849 TCCCCGTCTGGAAAATCAGGTGG - Intronic
1184660875 22:45964977-45964999 GACCCTTCTGGGCAATGAGGTGG - Intronic
950742528 3:15062295-15062317 GCCCCGTCCAGGAGGTGAGGGGG + Intronic
951264151 3:20547879-20547901 GCCCCGTCTGGGGGGTGGGGGGG - Intergenic
951290367 3:20866747-20866769 GCCCCATCTGGGAGGTGGGGGGG - Intergenic
952896592 3:38082099-38082121 ACCCCGTCTGGGAGGTGAGGAGG - Intronic
953440126 3:42909653-42909675 GCCCCGTCTGGGAGGTGGGGGGG - Intronic
954399626 3:50312215-50312237 ACCCTGTCTGGGAAGTGAGGAGG - Intronic
956166895 3:66403977-66403999 GCCCCGTATGGGATAAAAAGGGG + Intronic
958406883 3:93763456-93763478 GCCCCGTCTGGGAGCTGAGGGGG - Intergenic
958407105 3:93764245-93764267 GCCCTGCCTGGGAAGTGAGGAGG - Intergenic
962688825 3:137872844-137872866 GCCCCGTCCGGGAGGTGGGGGGG + Intergenic
966206744 3:177413155-177413177 GCCCAGTCTGGGAAGTGAGGAGG - Intergenic
967151529 3:186654780-186654802 GCCCAAGGTGGGATATGAGGGGG - Intergenic
968156578 3:196385776-196385798 GCCCCGTCTGGGAAGTGGGGGGG + Intronic
968666966 4:1827879-1827901 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
968852687 4:3094504-3094526 GCCCCGTCTGGGAGGTTGGGGGG - Intronic
969294888 4:6263964-6263986 GCCCAGGGTGGGATATGAGCAGG + Intergenic
970376020 4:15457862-15457884 TCCTCTTCTGGAATATGAGGTGG - Intergenic
974597935 4:64037523-64037545 GCCCCGTCTGGGGGGTGGGGGGG + Intergenic
974870571 4:67637161-67637183 GCCCCGTCCGGGAGGTGGGGGGG + Intronic
975522733 4:75317865-75317887 GCCCTGTCTGGGAGGTGTGGGGG + Intergenic
979273755 4:118792297-118792319 GCCCCGTCCGGGAGGTGGGGGGG + Intronic
980125279 4:128768393-128768415 GCCCAGCCTGGGATATAAGTGGG - Intergenic
981288205 4:143044849-143044871 GCCCCTTCTGTGAAAGGAGGGGG - Intergenic
981524140 4:145694147-145694169 ACATCGTCTGGGATGTGAGGAGG - Intronic
981994942 4:150964229-150964251 ACCCTGTCTGGGAGATGGGGGGG + Intronic
983905964 4:173183700-173183722 GCCCCGTCTGGGAGGTGGGGGGG - Intronic
989655779 5:43745874-43745896 GCCCCGTCTGGGAGGTGGGGGGG - Intergenic
995373657 5:111449739-111449761 GCCCACTCTGGGCGATGAGGCGG - Intronic
999299631 5:150483280-150483302 TCCCCCTCTGTGATATGAGTAGG + Intergenic
999448286 5:151659004-151659026 TCCCCATCTGGGAAATGAGAGGG + Intergenic
1001394098 5:171403966-171403988 ACCCCGTCCGGGAGATGGGGGGG - Intronic
1003498659 6:6686561-6686583 TCCCAGTCTGAGGTATGAGGAGG + Intergenic
1005044674 6:21630234-21630256 GTCCTGTCTGGGATATCTGGAGG - Intergenic
1005611535 6:27529999-27530021 GCCCCGTCCGGGAGGTGGGGGGG - Intergenic
1005710967 6:28502522-28502544 GCCCCGTCTGGGAGGTGGGGGGG + Intergenic
1006149069 6:31976387-31976409 ACCCCGTCTGGGAGGTGAGGAGG - Intronic
1006359339 6:33578818-33578840 CCTCCCTCTGGGATAGGAGGAGG - Intronic
1006672093 6:35735857-35735879 GCCTCCCCAGGGATATGAGGCGG - Intergenic
1008909882 6:56721066-56721088 GCCCCGTCTGGGAGGTGGGGGGG - Intronic
1008909901 6:56721107-56721129 GCCCTGTCTGGGAGGTGGGGGGG - Intronic
1008909920 6:56721150-56721172 GCCCCATCTGGGAGGTGGGGGGG - Intronic
1013657878 6:112264299-112264321 GCAGAATCTGGGATATGAGGGGG + Intergenic
1015052879 6:128863294-128863316 GCACTGTCTGGGATTGGAGGAGG + Intergenic
1018528215 6:164736539-164736561 CCATCGTCTGGGATGTGAGGAGG - Intergenic
1019107654 6:169682081-169682103 GGCCCGTCTGGGATCTGCTGTGG - Intronic
1019669290 7:2268793-2268815 GCCCCTACTGGGAAGTGAGGAGG + Intronic
1022318143 7:29263955-29263977 GCCCCGTCTGGGAGGTGGGGGGG + Intronic
1023743305 7:43300420-43300442 GCCCCATCTGGAATATGAACTGG + Intronic
1025775211 7:64554437-64554459 GCCCCGTCTGGGAGGTGGGGGGG + Intronic
1025795857 7:64738505-64738527 GCCCCGTCCGGGAGGTGAGGGGG - Intergenic
1025821574 7:64968151-64968173 GCCCCGTCCAGGAGGTGAGGTGG - Intergenic
1026186034 7:68082891-68082913 GACCCGTCTGGGAACTGAGGAGG + Intergenic
1029813134 7:103069117-103069139 GCCCCCTCTGGGAAGTGAGGAGG + Intronic
1032028669 7:128463629-128463651 GCCCCGTCTGGCAGGTGGGGGGG + Intergenic
1034233955 7:149554233-149554255 GCCCCGTCTGAGAAGTGAGGAGG + Intergenic
1036506982 8:9365139-9365161 ACCCCGTCTGGGAAGTGAGGTGG - Intergenic
1037348094 8:17921598-17921620 GCCCCATCTATGAAATGAGGGGG - Intergenic
1039153148 8:34528795-34528817 GCCCCGTCCGGGAGGTGAGGGGG - Intergenic
1039153201 8:34528922-34528944 GCCCCGTCTGGGAGGTGAGGGGG - Intergenic
1039153254 8:34529050-34529072 GCCCCGTCCGGGAGGTGAGGGGG - Intergenic
1041851232 8:62395296-62395318 CCACCGTCTGGGAAGTGAGGGGG - Intronic
1042475612 8:69245513-69245535 GCCCAGTCTGGAAAGTGAGGAGG + Intergenic
1043698971 8:83259528-83259550 GCCAAATCTGGGATATGATGAGG - Intergenic
1043961512 8:86423815-86423837 GCCCCGTCCGGGAGGTGGGGGGG - Intronic
1044436551 8:92171010-92171032 GCCCCATCTGGGAAATGATTCGG - Intergenic
1045021859 8:98051698-98051720 GCCCAGTCTGGGAGGTGGGGGGG - Intergenic
1046115502 8:109778953-109778975 GCCCCATGTGGAAGATGAGGAGG - Intergenic
1049403693 8:142442382-142442404 GCCCTCTCTGGGAGAGGAGGAGG - Intergenic
1050417554 9:5433032-5433054 CCATCGTCTGGGATGTGAGGAGG + Intronic
1051281060 9:15442437-15442459 GCCCCGTCTGAGAAGTGAGGAGG - Intronic
1052021500 9:23530888-23530910 GCCACGTCTGGGATATATGAGGG - Intergenic
1052236104 9:26214812-26214834 GCCCCATCTGGGAGGTGGGGGGG - Intergenic
1052236185 9:26215088-26215110 ACCCCGTCTGGGAGGTGAGGAGG - Intergenic
1052413590 9:28149748-28149770 CCACCGTCTGGGAATTGAGGAGG + Intronic
1053477680 9:38393745-38393767 TCCCCCTGTGGGATATGATGAGG + Intronic
1054760288 9:68998773-68998795 TCCCCTTCTGGGCTCTGAGGGGG + Intronic
1055133819 9:72806182-72806204 GCCCCGTCCGGGAGGGGAGGTGG - Intronic
1055580413 9:77702656-77702678 GCACCGACTGGGAAGTGAGGAGG - Intergenic
1056097887 9:83273035-83273057 GCCCCGTCCGGGAGGTGGGGGGG + Intronic
1056166820 9:83948322-83948344 GCCCCGTCTGGGAAGTGAGGAGG + Intronic
1057674844 9:97130560-97130582 GCCCCGTCTGGGAGGTGGGGGGG - Intergenic
1057716124 9:97497995-97498017 GCCCTGTCTGGGAGGTGGGGGGG - Intergenic
1057902216 9:98958208-98958230 TCCCCATCTGGGAAATGAAGGGG + Intronic
1060080168 9:120636799-120636821 GCCCCGTCTGGGAGGTGGGGGGG + Intronic
1060080190 9:120636840-120636862 GCCCCGTCTGGGGGGTGGGGGGG + Intronic
1062540393 9:137039404-137039426 GCCCCAAATGGGAGATGAGGCGG + Intergenic
1189837578 X:45040357-45040379 GCCCTGTCCGGGAGGTGAGGGGG - Intronic
1190174662 X:48138989-48139011 ACCCCGTCTAGGAAGTGAGGAGG + Intergenic
1191734571 X:64375659-64375681 GCCCCTTCTGCCATGTGAGGAGG + Intronic
1192500054 X:71644959-71644981 GCCCCGTCTGGGAGGTGGGGGGG - Intergenic
1192500165 X:71645211-71645233 GCCCCCTCTGAGAAGTGAGGAGG - Intergenic
1194714554 X:97275231-97275253 GCCCCGTCTGGGAGGTGGGGGGG - Intronic
1194714650 X:97275424-97275446 GCCCCGTCTGGGAGGTGAAGGGG - Intronic
1195168531 X:102244394-102244416 GCCCTGTCTGGGATATTGGGTGG - Intergenic
1195190326 X:102442693-102442715 GCCCTGTCTGGGATATTGGGTGG + Intronic
1195979019 X:110558645-110558667 GCCCCATCTGGAATGTGAGGAGG - Intergenic
1197455713 X:126674108-126674130 GCCCCGTCCGGGAGGTGGGGGGG + Intergenic
1198934701 X:141894626-141894648 GCCCCGTGTCTGAAATGAGGTGG - Intronic
1199836833 X:151599801-151599823 CCATCGTCTGGGATGTGAGGAGG - Intronic
1200324546 X:155223786-155223808 GCCCCGTCCGGGAGGTGGGGGGG - Intronic