ID: 1145927675

View in Genome Browser
Species Human (GRCh38)
Location 17:28659742-28659764
Sequence TCCTCATATCCCAGACGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18606
Summary {0: 7, 1: 750, 2: 3795, 3: 5681, 4: 8373}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927666_1145927675 8 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927675 17:28659742-28659764 TCCTCATATCCCAGACGGGGCGG 0: 7
1: 750
2: 3795
3: 5681
4: 8373
1145927669_1145927675 -9 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927675 17:28659742-28659764 TCCTCATATCCCAGACGGGGCGG 0: 7
1: 750
2: 3795
3: 5681
4: 8373
1145927667_1145927675 7 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927675 17:28659742-28659764 TCCTCATATCCCAGACGGGGCGG 0: 7
1: 750
2: 3795
3: 5681
4: 8373
1145927662_1145927675 16 Left 1145927662 17:28659703-28659725 CCTCACTTCCCAGACGGGGTGGC 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
Right 1145927675 17:28659742-28659764 TCCTCATATCCCAGACGGGGCGG 0: 7
1: 750
2: 3795
3: 5681
4: 8373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927675 Original CRISPR TCCTCATATCCCAGACGGGG CGG Intronic