ID: 1145927677

View in Genome Browser
Species Human (GRCh38)
Location 17:28659747-28659769
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9131
Summary {0: 2, 1: 75, 2: 1068, 3: 2815, 4: 5171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927669_1145927677 -4 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927677 17:28659747-28659769 ATATCCCAGACGGGGCGGCCAGG 0: 2
1: 75
2: 1068
3: 2815
4: 5171
1145927666_1145927677 13 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927677 17:28659747-28659769 ATATCCCAGACGGGGCGGCCAGG 0: 2
1: 75
2: 1068
3: 2815
4: 5171
1145927667_1145927677 12 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927677 17:28659747-28659769 ATATCCCAGACGGGGCGGCCAGG 0: 2
1: 75
2: 1068
3: 2815
4: 5171
1145927662_1145927677 21 Left 1145927662 17:28659703-28659725 CCTCACTTCCCAGACGGGGTGGC 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
Right 1145927677 17:28659747-28659769 ATATCCCAGACGGGGCGGCCAGG 0: 2
1: 75
2: 1068
3: 2815
4: 5171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type