ID: 1145927678

View in Genome Browser
Species Human (GRCh38)
Location 17:28659751-28659773
Sequence TCTGCCTGGCCGCCCCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9389
Summary {0: 75, 1: 721, 2: 1943, 3: 4778, 4: 1872}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927678_1145927686 12 Left 1145927678 17:28659751-28659773 CCCAGACGGGGCGGCCAGGCAGA 0: 75
1: 721
2: 1943
3: 4778
4: 1872
Right 1145927686 17:28659786-28659808 ATCCCAGACGATGGGCGGCCAGG 0: 1013
1: 1801
2: 978
3: 377
4: 250
1145927678_1145927682 3 Left 1145927678 17:28659751-28659773 CCCAGACGGGGCGGCCAGGCAGA 0: 75
1: 721
2: 1943
3: 4778
4: 1872
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927678_1145927683 4 Left 1145927678 17:28659751-28659773 CCCAGACGGGGCGGCCAGGCAGA 0: 75
1: 721
2: 1943
3: 4778
4: 1872
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927678_1145927685 7 Left 1145927678 17:28659751-28659773 CCCAGACGGGGCGGCCAGGCAGA 0: 75
1: 721
2: 1943
3: 4778
4: 1872
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927678 Original CRISPR TCTGCCTGGCCGCCCCGTCT GGG (reversed) Intronic
Too many off-targets to display for this crispr