ID: 1145927679

View in Genome Browser
Species Human (GRCh38)
Location 17:28659752-28659774
Sequence CTCTGCCTGGCCGCCCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10585
Summary {0: 72, 1: 704, 2: 3066, 3: 4816, 4: 1927}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927679_1145927682 2 Left 1145927679 17:28659752-28659774 CCAGACGGGGCGGCCAGGCAGAG 0: 72
1: 704
2: 3066
3: 4816
4: 1927
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927679_1145927685 6 Left 1145927679 17:28659752-28659774 CCAGACGGGGCGGCCAGGCAGAG 0: 72
1: 704
2: 3066
3: 4816
4: 1927
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927679_1145927686 11 Left 1145927679 17:28659752-28659774 CCAGACGGGGCGGCCAGGCAGAG 0: 72
1: 704
2: 3066
3: 4816
4: 1927
Right 1145927686 17:28659786-28659808 ATCCCAGACGATGGGCGGCCAGG 0: 1013
1: 1801
2: 978
3: 377
4: 250
1145927679_1145927683 3 Left 1145927679 17:28659752-28659774 CCAGACGGGGCGGCCAGGCAGAG 0: 72
1: 704
2: 3066
3: 4816
4: 1927
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927679 Original CRISPR CTCTGCCTGGCCGCCCCGTC TGG (reversed) Intronic
Too many off-targets to display for this crispr