ID: 1145927679 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:28659752-28659774 |
Sequence | CTCTGCCTGGCCGCCCCGTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 10585 | |||
Summary | {0: 72, 1: 704, 2: 3066, 3: 4816, 4: 1927} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1145927679_1145927682 | 2 | Left | 1145927679 | 17:28659752-28659774 | CCAGACGGGGCGGCCAGGCAGAG | 0: 72 1: 704 2: 3066 3: 4816 4: 1927 |
||
Right | 1145927682 | 17:28659777-28659799 | GCTCCTCACATCCCAGACGATGG | 0: 1126 1: 1000 2: 1572 3: 687 4: 367 |
||||
1145927679_1145927685 | 6 | Left | 1145927679 | 17:28659752-28659774 | CCAGACGGGGCGGCCAGGCAGAG | 0: 72 1: 704 2: 3066 3: 4816 4: 1927 |
||
Right | 1145927685 | 17:28659781-28659803 | CTCACATCCCAGACGATGGGCGG | 0: 1047 1: 868 2: 1428 3: 496 4: 262 |
||||
1145927679_1145927683 | 3 | Left | 1145927679 | 17:28659752-28659774 | CCAGACGGGGCGGCCAGGCAGAG | 0: 72 1: 704 2: 3066 3: 4816 4: 1927 |
||
Right | 1145927683 | 17:28659778-28659800 | CTCCTCACATCCCAGACGATGGG | 0: 1151 1: 999 2: 1597 3: 715 4: 357 |
||||
1145927679_1145927686 | 11 | Left | 1145927679 | 17:28659752-28659774 | CCAGACGGGGCGGCCAGGCAGAG | 0: 72 1: 704 2: 3066 3: 4816 4: 1927 |
||
Right | 1145927686 | 17:28659786-28659808 | ATCCCAGACGATGGGCGGCCAGG | 0: 1013 1: 1801 2: 978 3: 377 4: 250 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1145927679 | Original CRISPR | CTCTGCCTGGCCGCCCCGTC TGG (reversed) | Intronic | ||