ID: 1145927680

View in Genome Browser
Species Human (GRCh38)
Location 17:28659753-28659775
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10443
Summary {0: 70, 1: 691, 2: 2920, 3: 4801, 4: 1961}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927666_1145927680 19 Left 1145927666 17:28659711-28659733 CCCAGACGGGGTGGCGGCCGGGC 0: 1254
1: 2879
2: 4285
3: 2853
4: 1827
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927669_1145927680 2 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927674_1145927680 -10 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927672_1145927680 -9 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927662_1145927680 27 Left 1145927662 17:28659703-28659725 CCTCACTTCCCAGACGGGGTGGC 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961
1145927667_1145927680 18 Left 1145927667 17:28659712-28659734 CCAGACGGGGTGGCGGCCGGGCA 0: 1163
1: 2416
2: 2885
3: 2217
4: 1432
Right 1145927680 17:28659753-28659775 CAGACGGGGCGGCCAGGCAGAGG 0: 70
1: 691
2: 2920
3: 4801
4: 1961

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type