ID: 1145927681

View in Genome Browser
Species Human (GRCh38)
Location 17:28659765-28659787
Sequence ATGTGAGGAGCGCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27422
Summary {0: 847, 1: 2954, 2: 13133, 3: 7825, 4: 2663}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927681_1145927690 25 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927690 17:28659813-28659835 GACGCTCCTCACTTCCTAGACGG 0: 974
1: 3236
2: 2980
3: 3603
4: 7455
1145927681_1145927685 -7 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927681_1145927683 -10 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927681_1145927692 27 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927692 17:28659815-28659837 CGCTCCTCACTTCCTAGACGGGG 0: 143
1: 1989
2: 4109
3: 6759
4: 8758
1145927681_1145927686 -2 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927686 17:28659786-28659808 ATCCCAGACGATGGGCGGCCAGG 0: 1013
1: 1801
2: 978
3: 377
4: 250
1145927681_1145927691 26 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927691 17:28659814-28659836 ACGCTCCTCACTTCCTAGACGGG 0: 331
1: 2742
2: 4990
3: 3974
4: 4755
1145927681_1145927693 30 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927693 17:28659818-28659840 TCCTCACTTCCTAGACGGGGTGG 0: 194
1: 2861
2: 7085
3: 7922
4: 4068

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927681 Original CRISPR ATGTGAGGAGCGCCTCTGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr