ID: 1145927682

View in Genome Browser
Species Human (GRCh38)
Location 17:28659777-28659799
Sequence GCTCCTCACATCCCAGACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4752
Summary {0: 1126, 1: 1000, 2: 1572, 3: 687, 4: 367}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927669_1145927682 26 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927676_1145927682 11 Left 1145927676 17:28659743-28659765 CCTCATATCCCAGACGGGGCGGC 0: 4
1: 584
2: 2176
3: 7760
4: 9822
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927679_1145927682 2 Left 1145927679 17:28659752-28659774 CCAGACGGGGCGGCCAGGCAGAG 0: 72
1: 704
2: 3066
3: 4816
4: 1927
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927674_1145927682 14 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927678_1145927682 3 Left 1145927678 17:28659751-28659773 CCCAGACGGGGCGGCCAGGCAGA 0: 75
1: 721
2: 1943
3: 4778
4: 1872
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367
1145927672_1145927682 15 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927682 17:28659777-28659799 GCTCCTCACATCCCAGACGATGG 0: 1126
1: 1000
2: 1572
3: 687
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927682 Original CRISPR GCTCCTCACATCCCAGACGA TGG Intronic