ID: 1145927683

View in Genome Browser
Species Human (GRCh38)
Location 17:28659778-28659800
Sequence CTCCTCACATCCCAGACGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4819
Summary {0: 1151, 1: 999, 2: 1597, 3: 715, 4: 357}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927679_1145927683 3 Left 1145927679 17:28659752-28659774 CCAGACGGGGCGGCCAGGCAGAG 0: 72
1: 704
2: 3066
3: 4816
4: 1927
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927672_1145927683 16 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927674_1145927683 15 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927676_1145927683 12 Left 1145927676 17:28659743-28659765 CCTCATATCCCAGACGGGGCGGC 0: 4
1: 584
2: 2176
3: 7760
4: 9822
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927669_1145927683 27 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927681_1145927683 -10 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357
1145927678_1145927683 4 Left 1145927678 17:28659751-28659773 CCCAGACGGGGCGGCCAGGCAGA 0: 75
1: 721
2: 1943
3: 4778
4: 1872
Right 1145927683 17:28659778-28659800 CTCCTCACATCCCAGACGATGGG 0: 1151
1: 999
2: 1597
3: 715
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927683 Original CRISPR CTCCTCACATCCCAGACGAT GGG Intronic
Too many off-targets to display for this crispr