ID: 1145927685

View in Genome Browser
Species Human (GRCh38)
Location 17:28659781-28659803
Sequence CTCACATCCCAGACGATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4101
Summary {0: 1047, 1: 868, 2: 1428, 3: 496, 4: 262}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145927672_1145927685 19 Left 1145927672 17:28659739-28659761 CCCTCCTCATATCCCAGACGGGG 0: 1
1: 1
2: 9
3: 41
4: 183
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927679_1145927685 6 Left 1145927679 17:28659752-28659774 CCAGACGGGGCGGCCAGGCAGAG 0: 72
1: 704
2: 3066
3: 4816
4: 1927
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927669_1145927685 30 Left 1145927669 17:28659728-28659750 CCGGGCAGAGGCCCTCCTCATAT 0: 1
1: 8
2: 1074
3: 3522
4: 14587
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927678_1145927685 7 Left 1145927678 17:28659751-28659773 CCCAGACGGGGCGGCCAGGCAGA 0: 75
1: 721
2: 1943
3: 4778
4: 1872
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927681_1145927685 -7 Left 1145927681 17:28659765-28659787 CCAGGCAGAGGCGCTCCTCACAT 0: 847
1: 2954
2: 13133
3: 7825
4: 2663
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927674_1145927685 18 Left 1145927674 17:28659740-28659762 CCTCCTCATATCCCAGACGGGGC 0: 1
1: 1
2: 9
3: 55
4: 193
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262
1145927676_1145927685 15 Left 1145927676 17:28659743-28659765 CCTCATATCCCAGACGGGGCGGC 0: 4
1: 584
2: 2176
3: 7760
4: 9822
Right 1145927685 17:28659781-28659803 CTCACATCCCAGACGATGGGCGG 0: 1047
1: 868
2: 1428
3: 496
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145927685 Original CRISPR CTCACATCCCAGACGATGGG CGG Intronic