ID: 1145932212

View in Genome Browser
Species Human (GRCh38)
Location 17:28693944-28693966
Sequence CTGCTGGTGGGAAGTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145932203_1145932212 8 Left 1145932203 17:28693913-28693935 CCCACCAGAAGTTAGGCTCTGTT 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1145932212 17:28693944-28693966 CTGCTGGTGGGAAGTGTTTCAGG 0: 1
1: 0
2: 4
3: 26
4: 195
1145932204_1145932212 7 Left 1145932204 17:28693914-28693936 CCACCAGAAGTTAGGCTCTGTTC 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1145932212 17:28693944-28693966 CTGCTGGTGGGAAGTGTTTCAGG 0: 1
1: 0
2: 4
3: 26
4: 195
1145932205_1145932212 4 Left 1145932205 17:28693917-28693939 CCAGAAGTTAGGCTCTGTTCCCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1145932212 17:28693944-28693966 CTGCTGGTGGGAAGTGTTTCAGG 0: 1
1: 0
2: 4
3: 26
4: 195
1145932202_1145932212 9 Left 1145932202 17:28693912-28693934 CCCCACCAGAAGTTAGGCTCTGT 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1145932212 17:28693944-28693966 CTGCTGGTGGGAAGTGTTTCAGG 0: 1
1: 0
2: 4
3: 26
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145932212 Original CRISPR CTGCTGGTGGGAAGTGTTTC AGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
902574156 1:17366712-17366734 TTGCAGGTGGGAGGTGTCTCTGG + Intergenic
902701514 1:18175574-18175596 CTCCTGGTGGGAAGTGACCCGGG + Intronic
903785467 1:25858504-25858526 ATGCTGGTGCTAAGTGTTTTAGG - Intronic
904751935 1:32746328-32746350 GTGTGGGTAGGAAGTGTTTCTGG + Intronic
906983889 1:50662512-50662534 CTTATGCTGGGTAGTGTTTCAGG - Intronic
907284207 1:53369918-53369940 CAGCTGGTGGGCTGTGTTTTGGG - Intergenic
907839585 1:58143463-58143485 CTTCTGGTGGTAAATATTTCAGG - Intronic
908121591 1:60991049-60991071 GTGCTGGAGGGAAGACTTTCTGG - Intronic
908671138 1:66548935-66548957 CTGTAGGTGGGAATTGTTCCTGG + Intronic
908705318 1:66947645-66947667 CTGCTGGGTGGAAATGTATCAGG - Intronic
908798590 1:67855643-67855665 CTTCCGGTGGAAAGTGTTCCAGG + Intergenic
910130692 1:83902026-83902048 CTTCTGGTGGGGAGGGCTTCTGG - Intronic
910803176 1:91165202-91165224 CAGCTGGTGGGTTGAGTTTCGGG + Intergenic
912073195 1:105839691-105839713 CTGCTGGTGGTCAGTGTCTGTGG - Intergenic
912370984 1:109173847-109173869 CTGAGGGTGGGAAGAGTTTGGGG + Intronic
912774511 1:112497037-112497059 ACGCTTGTGGGAAGTGTGTCTGG - Intronic
916076215 1:161201328-161201350 CTGCTGGTGGGCTGTGTCCCTGG + Intronic
916945836 1:169726516-169726538 CTCAGTGTGGGAAGTGTTTCAGG - Intronic
917460179 1:175222675-175222697 GTGCAGTTAGGAAGTGTTTCAGG - Intergenic
919213382 1:194518055-194518077 TTGCTGGTGGTAAGTGCTTCTGG + Intergenic
921252468 1:213310835-213310857 GGGCTGGTGGCACGTGTTTCTGG + Intergenic
922243317 1:223771217-223771239 CTGTTGGTGGCATGTGTTTGTGG - Intronic
924279342 1:242420338-242420360 CTCCTGCTGGGAATGGTTTCTGG + Intronic
1063738450 10:8789910-8789932 GTGCTAGTGGTAAATGTTTCAGG + Intergenic
1064598968 10:16974044-16974066 CTGCTGATGGTGAGTGTTTTGGG - Intronic
1069592029 10:69648068-69648090 TTGCTGGTGGGGAGTGTGGCAGG + Intergenic
1070132571 10:73665489-73665511 TGGCTGGTGGGAATTGTTTTAGG + Intergenic
1071756851 10:88551732-88551754 CTTCTGGTGGGTAGTTTTGCAGG + Intronic
1072987734 10:100156284-100156306 CTGCTGGTTCGAAGTGCCTCAGG - Intronic
1073584003 10:104691452-104691474 CCTCTTCTGGGAAGTGTTTCCGG + Intronic
1073878981 10:107958120-107958142 CTGCTGGTGGGTGGTTATTCAGG + Intergenic
1073893192 10:108123820-108123842 CTGCTGCTGGGAAGGTTTTCTGG - Intergenic
1074118251 10:110473922-110473944 CTGCTGCTGGGGAGTGTCCCGGG + Intergenic
1074600597 10:114909491-114909513 CCTGTGGTGGGAAGAGTTTCTGG - Intergenic
1077470634 11:2758702-2758724 CTACTGCTGGGTAGTGTTTCAGG - Intronic
1079376446 11:19896321-19896343 CTGCTGGTGGGAGGTGGTGAAGG - Intronic
1081600358 11:44488462-44488484 CTGGAGGTGGGTGGTGTTTCTGG + Intergenic
1086822618 11:91453285-91453307 CTGCTGGTGGCAACTGTCACTGG + Intergenic
1087965132 11:104403433-104403455 CTCCTGGTGGGAGAGGTTTCTGG + Intergenic
1088807535 11:113365988-113366010 CTGCAGGTGGCAGGTGTGTCAGG - Intronic
1090274603 11:125410573-125410595 CCTCTGGTGGGAGGTGCTTCGGG - Intronic
1093460561 12:19403592-19403614 CTGCGGGTGGGAGCTGTTTGGGG - Intergenic
1093786088 12:23193564-23193586 AGGCTGGAGGGAAGTGTTTCAGG - Intergenic
1097447061 12:59684482-59684504 CTGCTGGTGGGCTGTCTCTCAGG + Intronic
1097659825 12:62417153-62417175 GTACTTGTGGGAAGTTTTTCTGG + Intronic
1099280250 12:80635139-80635161 ATGCTTGTTGGAAGTGTTTGTGG + Intronic
1100730491 12:97462220-97462242 CTGGGGGTGGGAGGTGTTTTGGG + Intergenic
1101303351 12:103503717-103503739 CTGCTGGTGGTAAGTGTGGAAGG - Intergenic
1101575299 12:105991663-105991685 GAGCAGCTGGGAAGTGTTTCAGG + Intergenic
1102032584 12:109751343-109751365 CTTCTGATGGGAGGTGTTTTTGG + Intronic
1102548197 12:113671684-113671706 CTGCTGGTGGGATTTGTGCCTGG - Intergenic
1103052185 12:117789916-117789938 TTGCTGGTCAGAAGGGTTTCTGG + Intronic
1105014664 12:132778974-132778996 CTGCTGCTGGGCCGTGGTTCAGG - Intronic
1113784512 13:112995481-112995503 CTGCTGGGTGGCAGTGTCTCAGG + Intronic
1114396185 14:22364191-22364213 ATGCTGATGAGAAGTGTTCCAGG - Intergenic
1114656622 14:24319569-24319591 TTGGTGGTGGGCAGTGTTGCTGG + Intronic
1116873995 14:50093283-50093305 CTATGGTTGGGAAGTGTTTCTGG + Intergenic
1117745052 14:58860785-58860807 CTGCTGGTGGGGAATGTCACTGG + Intergenic
1118031508 14:61822447-61822469 TGGCTGGTGAGCAGTGTTTCTGG - Intergenic
1118909708 14:70050991-70051013 GTGCAGGTGAGAAGTGTCTCAGG - Exonic
1119708884 14:76806895-76806917 GTGCTGGTTGGAAGGGATTCAGG - Intronic
1119846811 14:77836641-77836663 CTGCTGGTGGGAAGCATTCTAGG + Intronic
1121961022 14:98259905-98259927 CTGCTGCTTGGAAGCATTTCTGG + Intergenic
1122350714 14:101088405-101088427 CTGCCAGTAGGAAGTGTTTATGG + Intergenic
1123039385 14:105484192-105484214 GTGCTGGTGGCATTTGTTTCAGG - Intergenic
1128605217 15:69031859-69031881 CTCCTGGTCGGAAGTGTGGCAGG + Intronic
1130545884 15:84857511-84857533 CTGCTGGTGGCCATGGTTTCTGG - Exonic
1132142014 15:99404401-99404423 CTGCTGGTGCCAGCTGTTTCTGG - Intergenic
1135041271 16:19119035-19119057 GTGCTGGAGGAAAATGTTTCTGG + Exonic
1135170908 16:20182536-20182558 CTGCTGGTTGGAAGCTTTTGGGG + Intergenic
1136732238 16:32425826-32425848 CTGCTGGCAGGAATTGTTTTGGG + Intergenic
1138752360 16:59439188-59439210 GGGGTGGAGGGAAGTGTTTCAGG - Intergenic
1141118399 16:81331603-81331625 TTGCTTGTGGGAAGTCCTTCAGG + Intronic
1141736622 16:85858387-85858409 CTCCTGGTGGAAAGTCTATCAGG + Intergenic
1202994157 16_KI270728v1_random:91416-91438 CTGCTGGCAGGAATTGTTTTGGG - Intergenic
1203020844 16_KI270728v1_random:403758-403780 CTGCTGGCAGGAATTGTTTTGGG - Intergenic
1203039179 16_KI270728v1_random:676916-676938 CTGCTGGCAGGAATTGTTTTGGG - Intergenic
1143134489 17:4703984-4704006 CTGCTGCTGGAGAGTGTTTCTGG - Exonic
1144880285 17:18427369-18427391 CTGCTGGTGGGAGGGGTCTCCGG + Intergenic
1145151948 17:20517018-20517040 CTGCTGGTGGGAGGGGTCTCCGG - Intergenic
1145755684 17:27388571-27388593 CTGTTGGTGGGTAGTTCTTCAGG - Intergenic
1145928190 17:28663650-28663672 ATGCTGATGGGAACAGTTTCAGG - Intronic
1145932212 17:28693944-28693966 CTGCTGGTGGGAAGTGTTTCAGG + Intronic
1146017998 17:29249138-29249160 TTGGTGGTTGGAAGGGTTTCTGG - Exonic
1146163319 17:30571289-30571311 CTGCTGGTGGGAGGGGTCTCCGG - Intergenic
1147343321 17:39768823-39768845 CTACTTGTGGAAAGTGATTCTGG - Intronic
1147458646 17:40554439-40554461 CAGCAGGTGGGAACAGTTTCTGG + Exonic
1147580291 17:41624048-41624070 CTGCTGGTGGGAGGGGTCTCCGG - Intronic
1148179862 17:45596527-45596549 CTGCTGGGGAGGAGTGTGTCAGG + Intergenic
1148269037 17:46249374-46249396 CTGCTGGGGAGGAGTGTGTCAGG - Intergenic
1148489314 17:48012903-48012925 CTGGAGGTGGGCAGGGTTTCTGG + Intergenic
1148678954 17:49462033-49462055 CTGCTGTTGTCCAGTGTTTCTGG - Intronic
1148955913 17:51353495-51353517 TTGCTGCTGGGCAGGGTTTCTGG + Intergenic
1149605698 17:57923638-57923660 CTCCTGGTGGGAAGCTTTCCTGG - Intronic
1150767681 17:68015121-68015143 CTGCTGGGGAGGAGTGTGTCAGG + Intergenic
1151316079 17:73323516-73323538 CTCTTGATGGGAAGTGTGTCTGG + Intergenic
1152763499 17:82122242-82122264 CTGGTGGTGGGAAACGGTTCTGG - Intronic
1156046200 18:32880253-32880275 ATGCTCCAGGGAAGTGTTTCTGG + Intergenic
1156730009 18:40181583-40181605 CTGCTGGAGGACAGTTTTTCTGG - Intergenic
1157270883 18:46275144-46275166 CTGATGGGGGGAATGGTTTCAGG + Intergenic
1157657747 18:49408500-49408522 CTACTGGTGGGTAATCTTTCTGG - Intronic
1158490906 18:57908875-57908897 CTGGTGTTGGGAAGTCTTTAAGG + Intergenic
1158570612 18:58594372-58594394 CTGGGGGTGGAAATTGTTTCTGG - Intronic
1160151231 18:76395846-76395868 CTGCAGGAGCCAAGTGTTTCAGG + Intronic
1160286185 18:77546016-77546038 CTGCAGGAAGAAAGTGTTTCAGG + Intergenic
1160794483 19:938553-938575 CTGCTGGTGGGACGGTTTTGGGG + Intronic
1160799928 19:963057-963079 AGGGTGGTGGGAGGTGTTTCTGG + Intronic
1160858065 19:1226287-1226309 CTGCTGGGGGGCAGCATTTCAGG + Intronic
1161027952 19:2045353-2045375 CTGCTGTGTGGAAGTGCTTCCGG + Intronic
1161778574 19:6277285-6277307 CTCCTGGAGGGAAGTGTGTTTGG - Intronic
1162495538 19:11021338-11021360 CTGCTGGTGTGGAGGGTCTCAGG - Intronic
1163187585 19:15649840-15649862 CTGCTGGTGGGAGGTGATCCTGG + Intronic
1163189602 19:15666898-15666920 CTGCTGATGGGAGGTGCTTCTGG + Intergenic
1163191939 19:15683420-15683442 CTGCTGGTGGGAGGTGTTCCTGG + Intronic
1163201289 19:15771305-15771327 CTGCTGGTGGGAGGTGTTCCTGG - Intergenic
1163217212 19:15889744-15889766 CTGCTGGTGGGAGGTGATCCTGG - Intronic
1163221406 19:15924121-15924143 CTGCTGGTGAGAGGTGCTCCTGG - Intronic
1164408723 19:27978542-27978564 CTGCTGATGGAAAATGCTTCTGG + Intergenic
1166838671 19:45682942-45682964 CTGCAGGTGGGAAGTGATGGTGG + Exonic
1166884586 19:45952683-45952705 CTGCTGGTGGGAAGGGATTCGGG + Intronic
1167264226 19:48475425-48475447 CTGCCTGTGGGTGGTGTTTCGGG - Intronic
1167756963 19:51418732-51418754 ATGCTGATGGGAAGAGTTTGAGG + Intergenic
1167777010 19:51565007-51565029 CTGTTGGAGGGAAGGGTTTGAGG - Intergenic
927091186 2:19713998-19714020 CTGCCGGTGGGCAGTGATGCTGG - Intergenic
928697029 2:33859709-33859731 CTGCAGGTGGGCAGTGATTCAGG - Intergenic
930224060 2:48774379-48774401 CTGCTGGTGGGTAGTGCTACTGG + Intronic
933185092 2:79269666-79269688 CTGCTTGAGGGAAGTCTTCCTGG - Intronic
935327885 2:101954331-101954353 CTGATGGCAGGAAGTGTTTGTGG + Intergenic
936286527 2:111185626-111185648 TGGCTGGTGGGCAGTGTCTCTGG + Intergenic
939279451 2:140043145-140043167 CTGGTGGTGGCATCTGTTTCTGG - Intergenic
939683797 2:145172056-145172078 CTGCTGATGAGCTGTGTTTCTGG + Intergenic
939872574 2:147541525-147541547 CTGCTGCTGGCAAGGGCTTCAGG - Intergenic
941532591 2:166688035-166688057 CTGCAGGTGAGATGTGTCTCCGG - Intergenic
946887416 2:224236373-224236395 CTTCTGGTTTGAATTGTTTCTGG + Intergenic
947829692 2:233130237-233130259 CTGCTGGGAGGAAGTGGTTTTGG - Intronic
948135215 2:235631442-235631464 CTGCTGGTAGAGAGGGTTTCTGG + Intronic
1168775200 20:441508-441530 CGGCTTGTGAGGAGTGTTTCAGG + Intronic
1173813403 20:45969993-45970015 GTGATGCTGGGAAGAGTTTCAGG - Intronic
1175532584 20:59684377-59684399 CAGCTGGTGGGTTTTGTTTCAGG + Intronic
1175726324 20:61320955-61320977 CTGCTGTGGGGAAGTGTCCCAGG + Intronic
1176057354 20:63155740-63155762 CTGCTGGTGGGAAGTAGGTGGGG - Intergenic
1176272566 20:64243801-64243823 CAACTGGTAGAAAGTGTTTCGGG - Intergenic
1179843125 21:44090466-44090488 CTGCAGGTGGGGAGTGCTACTGG - Intronic
1180540222 22:16439316-16439338 CTGCTGGCAGGAATTGTTTTGGG - Intergenic
1181187922 22:21119595-21119617 CTGCTGGTGGGAGGTCTTTGGGG - Intergenic
1181211276 22:21290898-21290920 CTGCTGGTGGGAGGTCTTTGGGG + Intergenic
1181500966 22:23315359-23315381 CTGCTGGTGGGAGGTCTTTGGGG - Intronic
1182118454 22:27771874-27771896 CAGCTGGTGGGAAGTGTTGCTGG + Intronic
1183276558 22:36901651-36901673 CTGCTGGTGAGATGTGTGTTGGG + Intergenic
1203215673 22_KI270731v1_random:4533-4555 CTGCTGGTGGGAGGTCTTTGGGG - Intergenic
1203274953 22_KI270734v1_random:80858-80880 CTGCTGGTGGGAGGTCTTTGGGG + Intergenic
949826401 3:8169877-8169899 TTCCTGGAGGGAGGTGTTTCAGG - Intergenic
951149028 3:19265486-19265508 CTTCTGGTGGGAAGAATATCAGG - Intronic
951855660 3:27194044-27194066 CTTCTGGTAGGAAATGTTCCTGG - Intronic
962480641 3:135795252-135795274 CTGCTCCTTGGAAGTGATTCTGG - Intergenic
966060633 3:175749902-175749924 CTGCTGTTGGAAGGTGTTTTAGG + Intronic
967049273 3:185767368-185767390 ATGATGGTGGGAAGTTGTTCTGG - Intronic
967593293 3:191302383-191302405 CTGCTGGTTGGCTGTGTTTATGG - Intronic
968919754 4:3516449-3516471 CTGATGGAGGCAGGTGTTTCTGG - Intronic
970662225 4:18298677-18298699 CTCCTTGTGGGAAGTGTTGGTGG + Intergenic
970750618 4:19354982-19355004 CTTTTGGTGGGAAGTGTTAAAGG - Intergenic
972333214 4:38082249-38082271 CTGCTGGTGGGAAGTCCCTGGGG + Intronic
972675095 4:41252329-41252351 CTGGGGGTGGGAATGGTTTCGGG + Intergenic
975270879 4:72431681-72431703 CTTCTGTTCCGAAGTGTTTCAGG + Intronic
976615848 4:87076010-87076032 CTGCTTGTGGGAAGCCTGTCTGG + Intronic
977945684 4:102911465-102911487 CTGCTGGCAGGAATTGTTTTGGG - Exonic
978181276 4:105799241-105799263 CTGATATTGGGAAGTGTTTGTGG - Intronic
981239775 4:142463276-142463298 TTGCTTGTGGGAAGGGGTTCTGG + Intronic
991011192 5:61884544-61884566 CTGCTGCTGGGCTCTGTTTCTGG + Intergenic
991249252 5:64541506-64541528 CTGCTGGTAGGAAGTGAATGTGG - Intronic
995280991 5:110335595-110335617 CTGCTGGAAGCAACTGTTTCAGG + Intronic
995466863 5:112459518-112459540 CTATTGGTGGTAAGTGTTGCTGG - Intergenic
995747106 5:115415668-115415690 CTGTTGATGGGGAGTCTTTCAGG - Intergenic
996520294 5:124418553-124418575 TTGCTGGAGAGAAGTGTTCCAGG + Intergenic
996775946 5:127132635-127132657 ATGCTGTAGGGCAGTGTTTCTGG - Intergenic
997435274 5:133869624-133869646 CATCTGGTGGGAAGTGTTGGGGG - Intergenic
997577892 5:134996987-134997009 CTCCTGCTGAGAAGTCTTTCTGG + Intronic
998108711 5:139484923-139484945 CTTGGGGTGGGAAGTGTCTCTGG + Intergenic
998682535 5:144486306-144486328 TTGCTGTTGTGAAGTGTTTTTGG + Intergenic
998917381 5:147029814-147029836 GTGCTGGCGGGATGGGTTTCTGG - Intronic
1000658843 5:163915119-163915141 CAGATGGTGGGGAGTGTTTTTGG + Intergenic
1001382923 5:171315701-171315723 CCGCTAGTGGGAATGGTTTCCGG + Intergenic
1002028490 5:176411773-176411795 GGGCTGGTGGGAAGTGAGTCAGG - Intronic
1005435873 6:25811638-25811660 CTGCTGCTGTGAAGAGTTTCCGG + Exonic
1006948240 6:37799943-37799965 CTGCTGGAGGGAAGAGTTCCTGG + Intergenic
1009769345 6:68124201-68124223 CTTCTGATGGTATGTGTTTCAGG + Intergenic
1015063408 6:128996289-128996311 ATGATGGTGGGGAGTGTTTGAGG + Intronic
1016757930 6:147707468-147707490 CTTCCTGTGGGAAGGGTTTCAGG - Intronic
1017678544 6:156840237-156840259 CTCCTGCTGGGAAGTCTTGCAGG + Intronic
1018499879 6:164396001-164396023 CTTCTGGGGGGAAGTCTTTTGGG + Intergenic
1021217155 7:17930954-17930976 CTGTTGGGGGGAATGGTTTCGGG - Intronic
1024644113 7:51356931-51356953 CAGCTGGAGGGCAGTGTCTCAGG + Intergenic
1024748243 7:52431620-52431642 CTGCTTGTGGGAAGTGTGGAGGG - Intergenic
1027829107 7:83155252-83155274 CTGCTGGGCAGAAGTCTTTCCGG + Exonic
1027882401 7:83857280-83857302 TTTCTGGTGGGAAGTGTAACAGG + Intergenic
1028482400 7:91321874-91321896 ATTCTGCTTGGAAGTGTTTCTGG - Intergenic
1030285970 7:107827244-107827266 CTGATGGTGCTAAGTGTTTTGGG + Intergenic
1030441691 7:109595495-109595517 CTCCTGGGGGGAGGTGGTTCTGG + Intergenic
1030490246 7:110223703-110223725 CAGCTGCTGGGAAGTATTTAGGG + Intergenic
1030937802 7:115607288-115607310 GTGATGGTGGGAGGTGTTTCAGG - Intergenic
1032011260 7:128349697-128349719 CTGGTGGTTGGATGTGTTTGTGG + Intergenic
1032657815 7:133951091-133951113 GAGCTGGTGGGAGGAGTTTCTGG - Intronic
1035795417 8:2352032-2352054 CTGTTTGTGGGAATTGATTCAGG - Intergenic
1036580672 8:10072213-10072235 CTGTTGGTGAGATGTGTTTCAGG + Intronic
1036725160 8:11213979-11214001 TTTCTGGTGGGTAATGTTTCTGG - Intergenic
1036808114 8:11848928-11848950 CTGCGAGTCAGAAGTGTTTCGGG - Intronic
1037705952 8:21315252-21315274 GTGCTGATGGGAAGTGTTGCAGG + Intergenic
1037760068 8:21735986-21736008 CAGCAGGTGGGGAGTGTTTCTGG - Intronic
1038563902 8:28603608-28603630 CAGCTGGTGGGAAGTGATGAGGG + Intronic
1040935986 8:52782693-52782715 CTGCTGCTGGGGAATGTTTTGGG - Intergenic
1041313719 8:56540827-56540849 CAGCTGCAGGGAAGTGTTTGTGG - Intergenic
1045299469 8:100898851-100898873 CAGCTGCTGGGGAGTGTTTCTGG - Intergenic
1046680178 8:117160257-117160279 CTGATGGGAGGAAATGTTTCAGG - Intronic
1048284794 8:133133390-133133412 GTGCAAGTGGGAAGTGATTCAGG + Intronic
1048432319 8:134381912-134381934 CTGCTGCTGGAACATGTTTCTGG - Intergenic
1057313849 9:93956937-93956959 CTGCTGGTGGGGAGGCCTTCAGG + Intergenic
1061988294 9:134143152-134143174 GTCCTGGTGGGAAGTGTTGGAGG + Intronic
1062091908 9:134682745-134682767 CTGCTGGTGTGTTGTGGTTCTGG + Intronic
1185764960 X:2717843-2717865 TTGCTGATGTGAAATGTTTCGGG + Intronic
1186189525 X:7055090-7055112 CTGCACGTGGGAAATGATTCGGG + Intronic
1186879882 X:13854206-13854228 CTGCTGCAGGGAAGTGTGCCTGG + Intronic
1189165284 X:38855145-38855167 CTCCTGGTGGCAAGGGTCTCAGG + Intergenic
1199963275 X:152796639-152796661 CTTCTGGTTGGAAATGCTTCAGG + Intergenic
1201181397 Y:11350911-11350933 CTGCTGGCCGGAATTGTTTTGGG - Intergenic
1202041074 Y:20684619-20684641 ATGGTGGTGGGGAGGGTTTCAGG - Intergenic