ID: 1145932720

View in Genome Browser
Species Human (GRCh38)
Location 17:28697600-28697622
Sequence TTCCTGTGGGAAGAAGGTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145932720_1145932723 -10 Left 1145932720 17:28697600-28697622 CCTTTACCTTCTTCCCACAGGAA 0: 1
1: 0
2: 0
3: 34
4: 399
Right 1145932723 17:28697613-28697635 CCCACAGGAATTCGAAGATTTGG 0: 1
1: 0
2: 0
3: 10
4: 90
1145932720_1145932725 23 Left 1145932720 17:28697600-28697622 CCTTTACCTTCTTCCCACAGGAA 0: 1
1: 0
2: 0
3: 34
4: 399
Right 1145932725 17:28697646-28697668 TGCTCGCTATGTCCAGCCCATGG 0: 1
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145932720 Original CRISPR TTCCTGTGGGAAGAAGGTAA AGG (reversed) Exonic
900140896 1:1139161-1139183 TTCCTGGGGTCAGAAGGTAGGGG + Intergenic
900141102 1:1139771-1139793 TTCCTGGGGTCAGAAGGTAGGGG + Intergenic
900141265 1:1140259-1140281 TTCCTGGGGTCAGAAGGTAGGGG + Intergenic
900430317 1:2598298-2598320 GTCCTGGGGGCAGAAGGTAGAGG + Exonic
901493706 1:9609467-9609489 CTTCTGTGGGAAGAAGGGCATGG + Intronic
902327900 1:15714514-15714536 TGCCTCTGGGAGGAAGGGAAGGG + Intronic
906432512 1:45766565-45766587 TTCCTTTAGGAAGACAGTAAAGG + Intergenic
906529555 1:46515715-46515737 TTCTTGTGGGCAGAGGGTACAGG + Intergenic
907317678 1:53582877-53582899 CTCCTGTGGGAAGGAGGGAGGGG + Intronic
907558055 1:55362335-55362357 TTCCTCTGGGATGCAGGGAAGGG + Intergenic
909275479 1:73679787-73679809 TTCATGTGAAAAGTAGGTAATGG - Intergenic
910387158 1:86697367-86697389 TACCTTTGGGGAGAAGGTATGGG - Intergenic
911358232 1:96846904-96846926 TTCCTGTGGCTAGAAGGTAGAGG - Intergenic
912060482 1:105662373-105662395 TTTTGGTGGGAAGAAAGTAAGGG + Intergenic
912475141 1:109930072-109930094 TTCCTGTCGGCAGCAGGGAAAGG - Exonic
912897527 1:113608703-113608725 TTCCTTGGGGAAGAAAGTGAAGG + Intronic
913703771 1:121397837-121397859 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
913942430 1:125120347-125120369 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
913980122 1:143499546-143499568 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
914074470 1:144325031-144325053 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
914104706 1:144641415-144641437 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
915101693 1:153505707-153505729 TTCCTGGGGGAAGGATGTGAGGG - Intergenic
915349076 1:155213376-155213398 TTCCCCTGGGATGGAGGTAAGGG + Exonic
915352263 1:155234003-155234025 TTCCCCTGGGATGGAGGTAAGGG + Intergenic
915565483 1:156710510-156710532 TTTCTGGAGGAAGAAGGAAAAGG + Intergenic
915987594 1:160481970-160481992 TCTCTGTGGGAAGAAAGGAAGGG - Intergenic
916560433 1:165930151-165930173 TTACTGTGGGGAGGAGGGAAGGG + Intergenic
917239322 1:172930400-172930422 TCCCTGTGGGCAAAAGGAAAAGG + Intergenic
919143962 1:193609552-193609574 TTCCAGCAGGAAGAAGGGAAAGG - Intergenic
921218445 1:212956185-212956207 GACCTGTGGGAAGAACGCAAGGG - Intronic
921968403 1:221118044-221118066 TTCCTCTGGGTTGAAGGCAAAGG - Intergenic
922129539 1:222763423-222763445 TTCTTGTGGGAAGTAGGGGAGGG + Intergenic
922291312 1:224211058-224211080 TTCCAGTGGGAAGAGGGTACAGG - Intergenic
922347324 1:224707258-224707280 TTCCTGTGGTCAGAAAGGAAAGG - Intronic
923265260 1:232307545-232307567 TTCCTCTTGGAAGAGGGGAAGGG - Intergenic
1062879914 10:969763-969785 CTGCTCTGGGAAGAAGGGAATGG + Intergenic
1063742910 10:8844378-8844400 TACCTGAGTGAAGAAGGAAAGGG + Intergenic
1064004187 10:11687374-11687396 GACCTGTGGGAAGAAGGAAAGGG - Intergenic
1064543136 10:16425343-16425365 TTCCTCTTGGAAGGAGGCAAAGG - Intergenic
1066470413 10:35692381-35692403 TTCCTTTCCAAAGAAGGTAAAGG - Intergenic
1066780889 10:38943349-38943371 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1067344454 10:45427652-45427674 TTCCTGAGTGATGAAGGAAAGGG - Intronic
1067794364 10:49310048-49310070 TTCCTGTGGAAAGATGGGCAGGG + Intronic
1069000468 10:63257689-63257711 TCCCTGTGGAAAAAAGGTAAGGG + Intronic
1069650631 10:70044785-70044807 TTCCAGAGGGAAGAAGGCATGGG + Intergenic
1069810080 10:71152552-71152574 TTCATATGTGAAGAAGGAAAAGG + Intergenic
1070469680 10:76766477-76766499 ATCCTGTGTGAAGAAAGGAAGGG + Intergenic
1070840861 10:79487034-79487056 TTCCTGTGGGAGGGAGGGGATGG + Intergenic
1072905762 10:99451765-99451787 GTGCTGTGGGCAGAAGGAAAGGG - Intergenic
1073178599 10:101570734-101570756 CTCCCGTGGGCACAAGGTAAGGG + Intronic
1073500096 10:103929075-103929097 TTCTTGTGGGCAGATTGTAAGGG + Intergenic
1073690542 10:105803679-105803701 TGCCTCTGGGAAGCAGATAATGG - Intergenic
1074234609 10:111572811-111572833 TTCCTGTACAAAGTAGGTAATGG + Intergenic
1075267756 10:121019121-121019143 TTCCTGTAGGTAGAGGGTCAGGG + Intergenic
1077264160 11:1640810-1640832 CTCCTGTGGGAAGATGGAAGTGG - Intergenic
1078026311 11:7698895-7698917 TATCTGTGGAAAGAAGGGAAGGG + Intronic
1078620344 11:12901457-12901479 TTCCTGCTGGAAGAAGGAAGTGG + Intronic
1079281812 11:19094195-19094217 TTACTGCGGGAAGAGGGTATGGG - Intergenic
1079410253 11:20180799-20180821 TTGCAGTGGGAAGAAAGTGATGG + Intergenic
1080805992 11:35654412-35654434 TTTCTGTGGGAAGAAGTTGAGGG + Intergenic
1081613677 11:44578306-44578328 TTCCTGTGGGAAGAGAGCCAGGG + Intronic
1082843085 11:57705140-57705162 ATTCTGTGGGAAGAAGGTGAAGG - Exonic
1084347793 11:68567500-68567522 TCCCAGTGGCAAGAAGATAAAGG - Intronic
1084617592 11:70246710-70246732 GATCTTTGGGAAGAAGGTAAGGG + Intergenic
1084988150 11:72896248-72896270 TTGCTGTTCAAAGAAGGTAAAGG + Intronic
1085505391 11:77056000-77056022 TTCTTGTGGGAAGAAAGGAGTGG + Intergenic
1086088194 11:82977922-82977944 TACCAGTGTGAAGAATGTAAAGG + Exonic
1086905477 11:92413537-92413559 TTTCTGTGGGAAGGGGATAAAGG + Intronic
1087339236 11:96881559-96881581 TCCCAGAGGGAAGAAGGAAAGGG - Intergenic
1087525387 11:99304176-99304198 GTCCTGTGTGAAGAACGTTAGGG - Intronic
1087938247 11:104061002-104061024 GGCCTGTGGGAAGGAGGAAATGG - Intronic
1089553902 11:119304105-119304127 TTGCTCTGGGAGGGAGGTAAAGG - Exonic
1089701510 11:120246996-120247018 TTGCTTTGGAAAGAAGGGAAAGG + Intronic
1091412606 12:254024-254046 GTGATGTGGGAAGAAGGTAGCGG - Intronic
1092180802 12:6445404-6445426 TTCCTGGGAGGAGAGGGTAAGGG - Exonic
1093176866 12:15922642-15922664 ATCCTGTGGAAAGAATGTCAGGG + Intronic
1093351330 12:18106222-18106244 TTCATTTTGGAAGAAGATAATGG + Intronic
1094145091 12:27220381-27220403 TGCATGTGGGAAGAAAGTAAAGG - Intergenic
1094771253 12:33662768-33662790 ATCCAGAGGGAAGCAGGTAAAGG + Intergenic
1096113497 12:49042065-49042087 TACCTGTGGGATGAGGGCAAGGG - Intronic
1098037515 12:66320262-66320284 GTCCTGGGGGAAGAAGAGAAAGG - Intronic
1098962201 12:76750622-76750644 ATCCTGTGGGAATAAGACAATGG + Intergenic
1099070514 12:78040634-78040656 TTCCTGGGGGAAGGGGGAAAGGG + Intronic
1099485696 12:83226789-83226811 TTCCTGTGAGAAACAGGAAAAGG - Intergenic
1099873161 12:88372542-88372564 TTGCTGTGAGAAGAATGAAAAGG - Intergenic
1099990020 12:89710380-89710402 TTCCTGAGGGGAAAAGGAAACGG + Intergenic
1100455872 12:94751220-94751242 TTCACGTGAGAAGAAGGAAAAGG - Intergenic
1102688777 12:114744167-114744189 ATCCTGTGGGAAAAGGGGAAAGG + Intergenic
1102756335 12:115343976-115343998 TTTCTGAGGAAAGAAGGTAGAGG + Intergenic
1103647667 12:122407785-122407807 TTCCTTTGTGAAGAATGGAAAGG - Intronic
1104900673 12:132188155-132188177 TTCCGGTTGGAAGATGGGAAGGG + Intergenic
1105540348 13:21310994-21311016 TTCCTGTGGTACCCAGGTAATGG - Intergenic
1105986036 13:25568038-25568060 TTCCCTTGGGAGGAAAGTAAGGG - Intronic
1107051861 13:36059307-36059329 TTACTATGTGAAGGAGGTAATGG - Intronic
1107329057 13:39277873-39277895 TACCTTTGGGGAGAAGGAAAGGG - Intergenic
1107356891 13:39576957-39576979 TTCTGTTGGTAAGAAGGTAAGGG - Intronic
1107459420 13:40587196-40587218 TGCCTTTGGGAAGAAGGTGGTGG - Intronic
1108067369 13:46592104-46592126 TTCCAGTGGAAAGATGGTAGGGG - Intronic
1108145360 13:47471174-47471196 CTCCTCTGGGAAGAAAGTATTGG - Intergenic
1108415339 13:50192668-50192690 GTCCACTGGGAAGAAGGGAATGG + Intronic
1109695604 13:65952760-65952782 ATCTTATGGGAAGAAGCTAAAGG + Intergenic
1110243055 13:73289925-73289947 TTCTTCTCAGAAGAAGGTAACGG - Intergenic
1110864774 13:80381635-80381657 CTCTTTTGGGAAGAAGGCAAAGG - Intergenic
1111598133 13:90436407-90436429 TTCCTGTGGGCAAAATGTGAGGG + Intergenic
1111721044 13:91945618-91945640 TTCCTCTAGGACGAAGGAAAGGG + Intronic
1114943683 14:27650314-27650336 TTCATGTGGGAAGATGGAAATGG - Intergenic
1115702534 14:35968717-35968739 TTCCTGTTGGATGATGGTGATGG + Intergenic
1115715185 14:36095547-36095569 TTCCTGGGAGAAGAGGGTGAGGG - Intergenic
1116590698 14:46768219-46768241 TTACTGTGAGAGGAAGGTCAGGG - Intergenic
1116801733 14:49450935-49450957 TTCCTCTGGGGACAAGGTAGGGG + Intergenic
1117094143 14:52280759-52280781 TTCATGTGAGAAGAGGGTAGGGG - Intergenic
1117522656 14:56566248-56566270 CTGCTGGGGGAAGAAGGAAAGGG - Intronic
1118292784 14:64541184-64541206 CTCCTCTGGGAAGAAGGTCTTGG - Exonic
1118907385 14:70032644-70032666 TTCCAGTGAGAGGAAGGGAATGG - Intergenic
1119037188 14:71240408-71240430 TTCCTGTGCAAACAAGGAAATGG + Intergenic
1119920304 14:78440335-78440357 TTCCTCAGGGAAGAAGGTGATGG - Intronic
1121347124 14:93144399-93144421 TGCCTGTAGAAAGAAGGTAATGG - Intergenic
1121742613 14:96264691-96264713 TTCCTATGGGATGAAGATATTGG - Exonic
1121963088 14:98279105-98279127 TTCCCCTGGCAAGAAGGTTAGGG + Intergenic
1202939691 14_KI270725v1_random:135805-135827 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1123393444 15:19900087-19900109 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1125282004 15:38052123-38052145 GTCCTGTGGCAGGAAGGTACTGG - Intergenic
1125295637 15:38200135-38200157 TTCCAGTTGGTAGAATGTAAGGG - Intergenic
1125466467 15:39957936-39957958 TTCTAGTGGAAAGAACGTAAAGG + Intronic
1126279492 15:46927697-46927719 TTCCTTTGAGAAGATAGTAATGG + Intergenic
1126879542 15:53079650-53079672 TTCCTGAGGAAAAAAGCTAATGG + Intergenic
1126913014 15:53435040-53435062 TGTCTTTGGGAAGAAGGTTAAGG + Intergenic
1127002903 15:54531015-54531037 TTCAAGTGGGAGGATGGTAAAGG + Intronic
1129677589 15:77640744-77640766 TTCCTGGGGGAGGAGGGTGAAGG + Intronic
1130564694 15:84982754-84982776 TTCCTGTGGTAGAAAGGGAAGGG + Intronic
1130844220 15:87729397-87729419 TTCCTGTGAAATGAAGGAAATGG - Intergenic
1130997490 15:88912072-88912094 GTCCAGTGGGAAAAAGGGAAAGG + Intronic
1131137132 15:89945880-89945902 TTCCTCTGGGGAGAAGGAGATGG + Intergenic
1131149264 15:90036728-90036750 TTCCTGTGTGAAGAGGATGAGGG - Intronic
1132176153 15:99716805-99716827 TTCCTGTGAGAAGCAGTTACTGG - Intronic
1132268597 15:100502830-100502852 TTGCTGTGGGAACAAGATGATGG + Intronic
1135413355 16:22251131-22251153 TTCCTGTGGGAAGAGGCAACAGG - Exonic
1136696122 16:32083736-32083758 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1136699442 16:32117461-32117483 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1136768208 16:32810473-32810495 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1136771463 16:32845413-32845435 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1136796616 16:33026988-33027010 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1136799934 16:33060632-33060654 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1136957833 16:34804642-34804664 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1137084069 16:36100614-36100636 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1137645316 16:50068101-50068123 ATGCTGTGGGAGGAAGGGAAGGG - Intronic
1203070600 16_KI270728v1_random:1072489-1072511 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1203073887 16_KI270728v1_random:1107524-1107546 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1142666786 17:1467908-1467930 TTCCTGAGGGGAGAGGGCAAAGG + Exonic
1143498459 17:7325471-7325493 CTCCTGTGGCAGGAAGGTACGGG + Exonic
1143618123 17:8065453-8065475 TCTGTGTGGGAAGAAGGTCAGGG + Intergenic
1144213746 17:13036480-13036502 TACCTGTGGAAGGAAGGGAAGGG + Intergenic
1144779086 17:17798947-17798969 TGCCTCTGGGATGAAGCTAAGGG + Intronic
1145690359 17:26732492-26732514 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1145710134 17:26963646-26963668 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1145766860 17:27464162-27464184 TTCCTGCAGGAAGAAGCAAATGG + Intronic
1145932720 17:28697600-28697622 TTCCTGTGGGAAGAAGGTAAAGG - Exonic
1147338934 17:39742546-39742568 TTCCTGTGGCAAGAAGAAAAAGG - Exonic
1147718375 17:42522813-42522835 TACCTGTGGGAAGAGGGGACTGG + Intergenic
1147995203 17:44356350-44356372 TGCCTGAGGGAAGAGGGTACAGG + Exonic
1149453822 17:56771110-56771132 TTCTTGTGGAAAAATGGTAAAGG - Intergenic
1149984691 17:61338554-61338576 TTCTTTTGGGAAGTAGGTTAGGG + Intronic
1150034151 17:61775467-61775489 TTCCTGTGGAAAAAAGAGAAGGG + Intronic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1151351719 17:73535863-73535885 TTCATGTGGGGAGAAGGCAGGGG + Intronic
1203201659 17_KI270729v1_random:280552-280574 TTCCTGTTGGAAGAAAGGAATGG + Intergenic
1203211258 17_KI270730v1_random:81268-81290 TTCCTGTTGGAAGAAAGGAATGG + Intergenic
1155088757 18:22485310-22485332 TTCATGTGGGGAGAAGGAAATGG + Intergenic
1156381129 18:36562385-36562407 GTCCTCTGAGAAGAAAGTAAGGG + Intronic
1156620153 18:38842057-38842079 TTGCTTTCTGAAGAAGGTAAAGG + Intergenic
1157599991 18:48887925-48887947 TTCCTGTGGGAATAGGGCCAGGG + Intergenic
1159020200 18:63136973-63136995 ATCCTGGGGAGAGAAGGTAAAGG - Intronic
1162274266 19:9640453-9640475 TTCGTCTGGGAAGGGGGTAAAGG + Intronic
1162431555 19:10631848-10631870 TTCCTGGGGGAAGGAGGACAAGG - Exonic
1163105161 19:15119126-15119148 TTCCTGGGGGAAGGAGGGAAAGG + Intronic
1164858032 19:31540190-31540212 TCCCTGAGGGAAGGAGGTCAGGG - Intergenic
1165963832 19:39557830-39557852 AGGCTGTGGGGAGAAGGTAACGG + Intergenic
1166148513 19:40853397-40853419 TTCCTTTGGGAAGGAGGAAAGGG + Intronic
1166152652 19:40885182-40885204 TTCCTTTGGGAAGGAGGAAAGGG + Intronic
1166177524 19:41085453-41085475 TTCCTTTGGGAAGGAGGAAAAGG - Intergenic
1166555642 19:43697964-43697986 TGTGTGTGTGAAGAAGGTAATGG + Intergenic
1167510443 19:49892965-49892987 TTCCTGTGTGGGGAAGGGAAAGG + Intronic
1167682160 19:50930475-50930497 ATCCTGTAGGAAAAAGGGAAGGG - Intergenic
1168051641 19:53833855-53833877 TTCCTGGGGGAAGAAGGTTCTGG - Intergenic
1168540529 19:57206090-57206112 TTCCTGTGGGTGGAATGTGAGGG - Intronic
1202670010 1_KI270709v1_random:41150-41172 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1202680023 1_KI270712v1_random:1924-1946 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
925843571 2:8015534-8015556 TTCTTCTGGGTAGAAAGTAATGG + Intergenic
927863835 2:26576476-26576498 CTCCAGGGGGCAGAAGGTAAGGG - Intronic
927954653 2:27200137-27200159 ATCCTCTGGGAAAAAGATAATGG - Exonic
930088728 2:47516756-47516778 TTCCTTAGGGAAGAAGGGGAAGG + Exonic
931857600 2:66319578-66319600 TCCCTGGGGGAAGAATGTACTGG - Intergenic
932167744 2:69523780-69523802 TTCCTGTGGGTTGGAGGTTAGGG - Intronic
933104680 2:78309475-78309497 TGCCTTTGAGAAGAAGGGAAGGG - Intergenic
933642704 2:84781158-84781180 TACCTGTGGGAAGAAGGAAGGGG + Intronic
934251405 2:90359257-90359279 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
934258155 2:91444141-91444163 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
934781548 2:96972432-96972454 TTGCTGTGGGAAGGATGCAAGGG + Intronic
936103945 2:109608440-109608462 TTCTTAAGGGAGGAAGGTAAAGG + Intronic
937078732 2:119125475-119125497 ATCCTGTGCAAAGAAGGAAAGGG - Intergenic
937209263 2:120257789-120257811 TTCCTGTGGGAGGAAGGAGGGGG - Intronic
938934458 2:136116686-136116708 TTCCTGGGTGGAGAAGGTAACGG + Intronic
939184778 2:138847453-138847475 TTCTTTTGGGAAGAAAGAAAGGG + Intergenic
941133491 2:161684038-161684060 GGCCTGAGGGAAGAAGGGAATGG - Intronic
942786692 2:179709117-179709139 TTCCTGGGGCAAGATGATAAAGG - Intronic
942821774 2:180123227-180123249 CTCCAGTGGGAAGAGGTTAATGG + Intergenic
943077432 2:183212374-183212396 TTGCAATGGGAAGAAGTTAAAGG + Intergenic
943643792 2:190386765-190386787 TTCCTCAGGGAAGAATATAAAGG - Intergenic
943865001 2:192917983-192918005 TTTCTGTGGTGAGAAGGAAATGG + Intergenic
943968734 2:194374774-194374796 TTCCTGTGGGAAAGAGGCCATGG + Intergenic
944054439 2:195508791-195508813 TTACTGTGGCAAGAAGGGAAAGG - Intergenic
946071953 2:217041673-217041695 CTCCTGTGGGTAGAATGAAATGG + Intergenic
947330293 2:229022045-229022067 TTCCTTTTGGAATTAGGTAAGGG + Intronic
948352746 2:237354346-237354368 TCCCTGTGGGCAGAATGTGAGGG - Intronic
948785633 2:240351059-240351081 TTACTCTGGTAAGAAGGTAGGGG + Intergenic
1168959507 20:1859250-1859272 TCCATGTAGGAAGAAGGGAAAGG - Intergenic
1168959649 20:1860144-1860166 TCCATGTAGGAAGAAGGGAAAGG + Intergenic
1169341281 20:4798258-4798280 ATCCTGGGGGAAGATGGTTATGG - Intronic
1170954776 20:20969559-20969581 TTACTTTGTGAAGATGGTAATGG - Intergenic
1171455543 20:25269950-25269972 ACCCTGTGGGCAGAAGGCAAAGG - Intronic
1173950055 20:46985159-46985181 ATCTTGTTGGAAGAAGGTGATGG + Intronic
1173960954 20:47072165-47072187 TGCCTGTGGGAAGGAGGAACAGG - Exonic
1174899977 20:54489002-54489024 TTCCTGTCAGAAGAATGGAATGG + Intronic
1176094874 20:63336049-63336071 TTCCTGAGGCAAGAGGGGAAAGG + Intergenic
1176271388 20:64236718-64236740 TGCTGGTGGGAAGAAGGTTAGGG + Intronic
1176583499 21:8551280-8551302 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1177764990 21:25448027-25448049 TTCCTGTGGTAAGACAGAAAGGG + Intergenic
1178440294 21:32593068-32593090 ATCCTCTGGGAAGAAGGACAGGG - Intronic
1180027637 21:45176967-45176989 TTGCTGTGGGATGAGGGTCATGG - Intronic
1180266309 22:10528211-10528233 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1182535135 22:30995512-30995534 CTCATGTGGGTAGAAGATAAGGG - Intergenic
1183059421 22:35327029-35327051 TTCCGGTGTGGAGATGGTAACGG + Intronic
1184097345 22:42323693-42323715 TGCCTCTGGGAAGAAGGTGTGGG - Intronic
1203289061 22_KI270735v1_random:16958-16980 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1203314202 22_KI270736v1_random:171783-171805 TTCCTGTCGAAAGAAAGGAATGG + Intergenic
1203314326 22_KI270736v1_random:172694-172716 ATCCTATGGAAAGAAAGTAATGG + Intergenic
1203314862 22_KI270736v1_random:179701-179723 ATCCTGTGGAAAGAAAGGAATGG + Intergenic
1203324827 22_KI270738v1_random:4140-4162 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
949141532 3:639394-639416 TCCCTGAGGGAATAAGGAAAAGG - Intergenic
950193821 3:10995144-10995166 TTCCTGTTGGAAGGAAGGAATGG + Intronic
950377656 3:12584870-12584892 TGACTGTGTGAAGAAAGTAAAGG - Exonic
952305409 3:32141741-32141763 TCCCTCTGGGAAGAGGGAAATGG - Intronic
952614550 3:35254232-35254254 TTCCTCTGGGTAGATAGTAAAGG - Intergenic
953508944 3:43515863-43515885 TTCCTGAGGGAAGATAGTCAGGG - Intronic
953773700 3:45797978-45798000 TTCCTTTGGGGAGGAGGCAATGG - Intergenic
954975020 3:54685158-54685180 TTCCTGAGGCCAGAAGGTCATGG + Intronic
958865549 3:99497578-99497600 TTTCAGGGGGAAGAAGGTAGAGG + Intergenic
958930992 3:100208008-100208030 TTCTTGTGGGAAGAAAATAAGGG - Intergenic
959144653 3:102530264-102530286 TTCTTGTGGGAAGAACAAAATGG - Intergenic
962207898 3:133450136-133450158 TTACGCTGGGAAGAAGGTCAGGG + Intronic
962711265 3:138088343-138088365 TTCCTCTGGGAAGAAAGGCATGG + Intronic
962720195 3:138166674-138166696 TTCCTGTGGGACTAAGGCATAGG - Intronic
962896778 3:139722694-139722716 TCCCTATGACAAGAAGGTAAAGG + Intergenic
963650759 3:147977122-147977144 TTCCTGTGGGCAAAATGTGAGGG - Intergenic
963851936 3:150217928-150217950 CTCCTGTGGGAAGAGACTAAGGG + Intergenic
963989919 3:151640998-151641020 TTCCTATGGGAAAAAGGAAGTGG - Intergenic
964171971 3:153781691-153781713 TTCCTCTGGGAAGAAGACACTGG - Intergenic
966705164 3:182905788-182905810 TTCCAGATGGAAGAAGATAAGGG + Intronic
967222164 3:187256566-187256588 ATCCTGGGAGAAGAAGGTGAAGG + Intronic
967825395 3:193873358-193873380 TTCCAGTGAGAAGGAGGTACTGG - Intergenic
967955233 3:194872626-194872648 GTCCTGTGGGAAGAGGGAAGGGG + Intergenic
971798701 4:31260428-31260450 TCTCTGTGGGCAGAAGGTAATGG + Intergenic
971843029 4:31879045-31879067 TACTTGCTGGAAGAAGGTAAAGG - Intergenic
972130530 4:35827652-35827674 TTTATGTGGGAAGAAGGAAGAGG - Intergenic
972586447 4:40441451-40441473 TTCCATTTGGAAGAAGGGAAAGG - Intronic
974615169 4:64271173-64271195 TTACTTTAAGAAGAAGGTAAGGG - Intergenic
976104888 4:81606017-81606039 TTGTTATGGGAAGAAGATAAGGG - Intronic
976695903 4:87919418-87919440 TTCCTGTGGGCAAATTGTAAGGG - Intergenic
978300783 4:107267829-107267851 TACCTATGGGAAGAAGATACTGG - Intronic
980795788 4:137681002-137681024 TTTCTGTGGGAAGAAAGAAGGGG - Intergenic
982245751 4:153348626-153348648 TTCCTGTGGGAATGAGTTAGTGG + Intronic
982944189 4:161597815-161597837 TTCTAGTGTGGAGAAGGTAAAGG + Intronic
983164784 4:164461654-164461676 TGCCTTTGGGGAGAAGGTAAGGG + Intergenic
983231206 4:165130656-165130678 TTCCTGTGGAAATTAGGGAAGGG - Intronic
984386611 4:179067784-179067806 TTCATATGGAATGAAGGTAAAGG + Intergenic
984679749 4:182593740-182593762 TTCATGTGGGAGGAAGTAAAAGG - Intronic
984698852 4:182805841-182805863 TTCGTGTGGGAGGAAGGTGTGGG - Intergenic
985120634 4:186637749-186637771 TTCAGTTGGGAAGAAGGTAGGGG - Intronic
985688106 5:1292877-1292899 TTCCTGGGGGTGGGAGGTAAGGG - Intronic
986133992 5:4957643-4957665 TTCCATTGGGAAGAAAGCAATGG + Intergenic
986454998 5:7909270-7909292 TTTCTGTGGGCAAAAGGGAAAGG + Intergenic
987114556 5:14715607-14715629 TGCCTGTGGGAAGCAGGACAAGG - Intronic
987212040 5:15693321-15693343 TGCCTGTGGGAATAAGAGAAGGG - Intronic
987574556 5:19708391-19708413 TTCCTGTGAGAAGTAGCTCATGG + Intronic
988200581 5:28063742-28063764 TACCTGTGGCAAGAAGGAAATGG - Intergenic
988735879 5:34020816-34020838 TACCTGTGGGAAGGAGAGAAGGG - Intronic
989218869 5:38933015-38933037 TTTCTGTTGGAAGGAGATAAAGG - Exonic
989358143 5:40567552-40567574 TTACTGTGTGAAGTAGGGAAAGG - Intergenic
989569260 5:42929999-42930021 TTCCTGTGGGAAGAAATCAGTGG - Intergenic
989985328 5:50690281-50690303 TTCTTTTTGGAAGAAGGTAGAGG + Intronic
990048040 5:51458628-51458650 CTCCTGCGTGAAGAAGTTAAGGG - Intergenic
991517930 5:67460195-67460217 CTCCTGTGGAAAGAATGCAAAGG + Intergenic
992881537 5:81115210-81115232 TTCCTGAGTGAAGTAGTTAATGG + Intronic
993119977 5:83763219-83763241 TTCCTTTGGAAAGAAAGGAAAGG + Intergenic
993331778 5:86609266-86609288 TACATGTGGGAAGTGGGTAAAGG - Intergenic
993505671 5:88705985-88706007 TACCTGTGGAAAGAAAGAAAAGG - Intergenic
993515358 5:88826836-88826858 TTCCTGTGGAAAAAAAGTAGTGG - Intronic
993777949 5:92025548-92025570 TTCATGTGGCAAGAAACTAAGGG - Intergenic
994331300 5:98509491-98509513 TGCCTGTGGGAAGCAGAGAATGG + Intergenic
994377678 5:99033672-99033694 TTCCTGAGGGCAGAAAGTACAGG + Intergenic
995479690 5:112581909-112581931 TCCCTGGGGCAAGATGGTAAAGG - Intergenic
996281098 5:121729831-121729853 TACTTATGGGAAGAAGGGAAAGG - Intergenic
996328046 5:122298298-122298320 TTCTTGCCTGAAGAAGGTAAAGG + Intergenic
996577405 5:124990914-124990936 TTCTTGTGGGAAGAGAGCAATGG + Intergenic
996948630 5:129098700-129098722 TTTCTGTGGCCAGAAGATAAGGG + Intronic
997771648 5:136560465-136560487 TAGGTGTGGGAAGAAGGAAAAGG + Intergenic
998203000 5:140140235-140140257 TTCCTGGGGGAATAAGAGAAGGG - Intergenic
998312481 5:141149190-141149212 TTGCTGTGAGAAGACGGTGAAGG + Intronic
998475262 5:142415855-142415877 TGCCTGAGGGAAGAAGAAAATGG + Intergenic
998552803 5:143093791-143093813 TTCCTCTGAGAAGAAAGGAAAGG + Intronic
1000064093 5:157680387-157680409 TTCCAGTGGTAAGGAGGTCAGGG + Intergenic
1000702749 5:164473661-164473683 TACCACAGGGAAGAAGGTAACGG - Intergenic
1000998125 5:167979541-167979563 TTGCTGTGGGAAGAAAGAAGGGG + Intronic
1001215875 5:169855308-169855330 TTCCTGTGGTAGATAGGTAATGG + Intronic
1001536669 5:172502948-172502970 CTCCTGTGAGAAGATGGCAAAGG - Intergenic
1002211698 5:177603253-177603275 TTACTTTGGGGAGAAGGTAGGGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003093521 6:3124043-3124065 GGGGTGTGGGAAGAAGGTAAAGG + Intronic
1003213492 6:4088647-4088669 TACCTGTGGGAATATGGAAAGGG + Intronic
1003334774 6:5160165-5160187 ATCCACTGGGAAGAAGGGAATGG - Intronic
1003412850 6:5880824-5880846 TTCCTGTGGTACCCAGGTAATGG + Intergenic
1003510094 6:6772464-6772486 CTCCAGAGGGAAGAAGGTATAGG - Intergenic
1004363867 6:14995794-14995816 TTCATGAGGGTAGAAGGAAATGG + Intergenic
1005415988 6:25600731-25600753 TGCGTGTGCGCAGAAGGTAAGGG + Exonic
1005713228 6:28522610-28522632 TTCCAGTGGCAATAGGGTAAAGG + Intronic
1007004390 6:38346775-38346797 TTCCTGTGGGTTTAAGGAAATGG - Intronic
1008502052 6:52193081-52193103 TTCCTGGTGGAAGAAGGTCTAGG + Intergenic
1009539694 6:64938113-64938135 TTCAAGGGGGAAGAAGGAAATGG + Intronic
1011349264 6:86404444-86404466 TTCCTGTGAGGAGTAGGAAATGG + Intergenic
1013176375 6:107680811-107680833 TTCTGGTGGGAAGAAGGACAGGG - Intergenic
1013323502 6:109020427-109020449 TTGCTGTGGGTAGAAAATAAAGG + Intronic
1013551258 6:111209913-111209935 TGGCTGTGGAAGGAAGGTAAAGG + Intronic
1014014413 6:116513615-116513637 TTCCTGTGGGAAGATGCATAAGG + Intronic
1014276545 6:119395916-119395938 TTCCTGAGGGAAGAAGCCATTGG + Intergenic
1015154206 6:130073642-130073664 TTCATGTGGAAAAAAAGTAAGGG + Intronic
1015696106 6:135981636-135981658 TTCCTGTGGGAAAAATGTGGAGG - Intronic
1016148622 6:140707516-140707538 TTGCTGTGGAAAGATGGGAAAGG - Intergenic
1017299565 6:152840736-152840758 TTCCTGAGGCAAGAATGGAAGGG - Intergenic
1017301691 6:152868509-152868531 TTCATGTGGTAAGAAGGGATTGG + Intergenic
1017453325 6:154575013-154575035 TTGGTGGGGGAAGAAGGGAAAGG + Intergenic
1019629568 7:2041112-2041134 TTCCTGTCGGAAAAAGCTCAAGG + Intronic
1020033731 7:4951237-4951259 CTCCAGTGGGAAGAAAATAAAGG - Intronic
1020703991 7:11519284-11519306 TGCCTGTAGGAAGAAGAGAAGGG - Intronic
1022748758 7:33201897-33201919 GTCCTGTGTGAAAAAGGAAAGGG + Intronic
1023759069 7:43446837-43446859 CTCCTGTGAGTAGAAGGGAATGG + Intronic
1024394502 7:48850049-48850071 TCTCTGTGGGAGGAAAGTAAAGG + Intergenic
1024400764 7:48922592-48922614 TCTCTGTGGGAGGAAAGTAAAGG - Intergenic
1024481183 7:49864969-49864991 CTCCTGTGGGAAGAATGGGAGGG + Intronic
1025478845 7:60957796-60957818 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1025482051 7:60993444-60993466 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1025553210 7:62274897-62274919 TTCCTGCAGGAAGAAGCAAATGG - Intergenic
1025845201 7:65189914-65189936 ATCCTGTGGGGAAAAGGAAACGG + Intergenic
1025895478 7:65695944-65695966 ATCCTGTGGGGAAAAGGAAACGG + Intergenic
1026834972 7:73632656-73632678 TTCCTGTGGGAAGGAAGACAAGG + Intergenic
1027220351 7:76210078-76210100 TTCATGTGGGCAGGAGGTGATGG + Intronic
1028269209 7:88767315-88767337 TAGCTGTGGGAAGAAGGGCAGGG - Intronic
1028502456 7:91534176-91534198 TAACTGAGGGAAGAAGGGAAGGG - Intergenic
1030066307 7:105661893-105661915 CACCTGTGGGAAGAAGAGAAAGG - Intronic
1032997311 7:137462411-137462433 TTCTTGTGTGAAGACGGGAAAGG - Intronic
1036145033 8:6246996-6247018 ATCATGTGGGAAGAAGGAAAAGG - Intergenic
1036409229 8:8483429-8483451 TACCTCTGGGAAGAAGGGATGGG + Intergenic
1038546759 8:28431577-28431599 TTTCTGGGGGAAGAAGGTGGGGG - Intronic
1039473236 8:37826583-37826605 TTCCTATGGGAAGGAGCTGAGGG + Intronic
1039777158 8:40748286-40748308 TTCCTGTTGCAGGCAGGTAATGG + Intronic
1040488287 8:47895333-47895355 TACCTGTTGGAAGAAGGGCAAGG + Intronic
1040685249 8:49864087-49864109 TTCCTGTGGGAAAATTGTTAGGG - Intergenic
1042163745 8:65924384-65924406 TTCTTGTGAGAAGAAGGAATTGG + Intergenic
1042255464 8:66798558-66798580 TTTCAGTGGGAAGAAGTGAATGG + Exonic
1043385933 8:79747893-79747915 TTCCCGGGGAAAGAAGGAAAGGG + Intergenic
1043738661 8:83778625-83778647 GTACTGTGGGATGAAGGAAATGG - Intergenic
1043753737 8:83974998-83975020 AACCTGGGGGAAGAAGGGAATGG - Intergenic
1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG + Intronic
1045367782 8:101493029-101493051 TTCCTAAGGGAAGAAGGAAAAGG - Intronic
1046580431 8:116086033-116086055 TTCCTGTGGGCAGATGACAAGGG + Intergenic
1047513343 8:125532152-125532174 TTCCTGAGTGATAAAGGTAATGG - Intergenic
1048260991 8:132944901-132944923 TCCCTGTGGGAAGAGGGTGCAGG + Intronic
1049192810 8:141298112-141298134 GGCCTGTGGGATGAAGGGAAGGG - Intronic
1049323881 8:142011807-142011829 TTCCTGTGTCAGGAAGGAAAAGG + Intergenic
1049355338 8:142184968-142184990 TTGCTGTGGGCAGAGGGTGAGGG - Intergenic
1051523404 9:18015707-18015729 GTCTTGTGGGAAGAAGCTTAGGG - Intergenic
1052725156 9:32220498-32220520 CTCCTGTGGAAAGAAGTTTAAGG + Intergenic
1052990109 9:34514152-34514174 TTCCTGCAGGATGAAGGAAAGGG - Intronic
1052993392 9:34535979-34536001 TTCCAGTGGGCAGTAGGAAATGG + Intergenic
1054765121 9:69036622-69036644 TTTCTGTAGGGAGAAGATAAAGG + Intronic
1055256215 9:74374407-74374429 TTCCTGTGGGAAGATATTCAGGG - Intergenic
1056105144 9:83339742-83339764 TTCCTGTGGGAAGATGGATAAGG - Intronic
1056362246 9:85870284-85870306 CTCCTGAGGGAAAAAGGTAGAGG - Intergenic
1057306337 9:93914316-93914338 TTCCTGTGGGAAGATGGGTAGGG - Intergenic
1057573286 9:96219759-96219781 TTCCTGTGGGCAGAAGGCAGCGG + Intergenic
1058328992 9:103735425-103735447 TTCCTGGGAGAAGAGGGTCAAGG - Intergenic
1058335225 9:103819884-103819906 TTCCTTTGGGACCATGGTAAGGG - Intergenic
1059027900 9:110656941-110656963 TTCTTGTGAGAAGAAGGGGAAGG - Intergenic
1060975085 9:127760316-127760338 CTCCTGGGGGTAGAAGGTCAAGG + Intronic
1061480384 9:130895217-130895239 TTCCTATGGGGAGGAGGGAATGG - Intergenic
1062538865 9:137032701-137032723 CTCCTGTGGGAAGACACTAAGGG - Exonic
1203613457 Un_KI270749v1:29051-29073 TTCCTGCAGGAAGAAGCAAATGG + Intergenic
1185716438 X:2346546-2346568 TTGCTGTGAGAAGAAGCTATGGG - Intronic
1186143956 X:6606410-6606432 TCCCCGAGGGAAGAAGATAATGG - Intergenic
1186180240 X:6966966-6966988 TCCCGGTTGGAGGAAGGTAAGGG + Intergenic
1186403074 X:9277540-9277562 TTCATGTTGGAAGAAGTCAAAGG + Intergenic
1187401426 X:18963870-18963892 TTCCTGTGGGACACAGGTAGGGG - Intronic
1189283892 X:39838478-39838500 TTCCTTTGGGAAGAAGGAGGTGG + Intergenic
1189937241 X:46082319-46082341 TTCCAGTGGGCATAAGGCAAAGG - Intergenic
1192148806 X:68699177-68699199 TCCCTGTGGGAAGCAGCCAAGGG + Intronic
1194025829 X:88749248-88749270 TTCTTGGGGGAAGAAGGTGCAGG + Intronic
1198402104 X:136278373-136278395 TTCCTAGGGGAAGGAGGTCAGGG - Intergenic
1201098968 Y:10656947-10656969 ATCCTGTTGAAAGAAGGGAATGG - Intergenic
1201131177 Y:10953069-10953091 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201131571 Y:10955595-10955617 ATCCTGTGGAAAGAAAGCAATGG - Intergenic
1201131790 Y:10958031-10958053 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201132061 Y:10959919-10959941 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201132647 Y:10964866-10964888 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201133774 Y:10974946-10974968 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201133796 Y:10975178-10975200 ATCCTGTCGAAAGAAAGTAATGG - Intergenic
1201134204 Y:10978045-10978067 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201134324 Y:10978983-10979005 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201134518 Y:10980369-10980391 ATCCTGTGGAAGGAAAGTAATGG - Intergenic
1201136761 Y:10995878-10995900 ATCCTGTGGAAAGAAAGGAAAGG - Intergenic
1201138329 Y:11007552-11007574 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201138579 Y:11009379-11009401 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201138782 Y:11010782-11010804 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201138939 Y:11011954-11011976 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201140130 Y:11021199-11021221 TTCCTGTGGAAAGAAAGGAATGG - Intergenic
1201140204 Y:11021671-11021693 TTCCTGCGGAAAGAAAGGAATGG - Intergenic
1201140489 Y:11023339-11023361 ATCCTGTGGAAAGAACATAATGG - Intergenic
1201140758 Y:11026112-11026134 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201140973 Y:11027675-11027697 GTCCTGTGAGAAGAAAGGAATGG - Intergenic
1201141058 Y:11028264-11028286 ATGCTGTGGAAAGAAAGTAATGG - Intergenic
1201141070 Y:11029198-11029220 ATCCTGTGGAAAGAAAGTAATGG - Intergenic
1201142055 Y:11037197-11037219 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201142198 Y:11038214-11038236 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1201319327 Y:12680804-12680826 TACCTGTGGGAGGAGGGTAGAGG + Intergenic
1202623186 Y:56832968-56832990 ATCCTGTGGAAAGAAAGGAATGG - Intergenic
1202623639 Y:56835983-56836005 ATCCTGTGGAAAGAAAGGAATGG - Intergenic