ID: 1145933506

View in Genome Browser
Species Human (GRCh38)
Location 17:28702004-28702026
Sequence GAGTCTCCCCTAGCTCTCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145933498_1145933506 24 Left 1145933498 17:28701957-28701979 CCCTCACCGGACTCTGGGCTGTG 0: 1
1: 0
2: 3
3: 15
4: 166
Right 1145933506 17:28702004-28702026 GAGTCTCCCCTAGCTCTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 84
1145933504_1145933506 -8 Left 1145933504 17:28701989-28702011 CCAAACTCAGCACATGAGTCTCC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1145933506 17:28702004-28702026 GAGTCTCCCCTAGCTCTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 84
1145933501_1145933506 18 Left 1145933501 17:28701963-28701985 CCGGACTCTGGGCTGTGACTGGG 0: 1
1: 0
2: 14
3: 171
4: 522
Right 1145933506 17:28702004-28702026 GAGTCTCCCCTAGCTCTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 84
1145933499_1145933506 23 Left 1145933499 17:28701958-28701980 CCTCACCGGACTCTGGGCTGTGA 0: 1
1: 0
2: 1
3: 12
4: 169
Right 1145933506 17:28702004-28702026 GAGTCTCCCCTAGCTCTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145933506 Original CRISPR GAGTCTCCCCTAGCTCTCGT GGG Exonic
900608677 1:3535332-3535354 GAGGCTCCCATAGCTCTTGGGGG - Intronic
902081043 1:13820819-13820841 GGGTCTCCCCTGGGTCACGTGGG - Intronic
909946543 1:81670235-81670257 GAGTCTCTCCAAGCTCTGGAAGG - Intronic
916261169 1:162844052-162844074 GAGCCTCCCTTAGCTCAGGTAGG + Intronic
918744441 1:188182285-188182307 CAGTCTCCCGTAGCTCTCCCAGG + Intergenic
924590758 1:245402046-245402068 GAGGCTCCCCTAGGCCTCATGGG + Intronic
1063203688 10:3810106-3810128 GAGCCTGCCCTTGCTCTCCTGGG - Intergenic
1070610604 10:77929696-77929718 GCGTCTCCCCTAGCTTCCGGTGG - Intergenic
1072190097 10:93071620-93071642 GAATCTCGCCAAGCTTTCGTGGG - Intergenic
1075545329 10:123350832-123350854 CAGTCTTCCCGAGCTGTCGTAGG - Intergenic
1078449140 11:11427396-11427418 GTGTCTCCCCAAGCTCTCTTTGG - Intronic
1084705418 11:70813465-70813487 GGGGCTCCCCTAGCTCCCCTGGG - Intronic
1086987286 11:93264075-93264097 GAGTTTCTCCTAGGTCTAGTTGG - Intergenic
1088107891 11:106226477-106226499 GAGTCTCTCCTAGATCTAGCTGG - Intergenic
1090020620 11:123125363-123125385 GAGTCTCCTCTTGATCTTGTAGG - Intronic
1103131341 12:118471279-118471301 TAGTCTCCACCAGCTCTAGTGGG - Intergenic
1106746527 13:32714485-32714507 CAGTCTCCCATAGCGCTCCTAGG - Intronic
1111806015 13:93041308-93041330 GAGTCTCTCCCAGTTCTGGTTGG - Intergenic
1114658337 14:24329424-24329446 TAGGCTCCCCTAGCTCCCGAAGG + Exonic
1116725702 14:48559171-48559193 GAGTTTCTCCTAGGTCTGGTTGG - Intergenic
1123849055 15:24335123-24335145 TAGTCTCCCATAGCGCTCCTAGG - Intergenic
1123868111 15:24542637-24542659 TAGTCTCCCATAGCGCTCCTAGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125604453 15:40932073-40932095 GGGGATCCCCTAGCTCTCCTGGG - Intronic
1130306723 15:82716807-82716829 CAGTCTCCCCTAGCACTCCCAGG + Intergenic
1135885698 16:26305144-26305166 GAGTCTTCCTTAGCTCTCAAGGG - Intergenic
1138616768 16:58174199-58174221 GAACCTCCCATAGCTCTTGTTGG - Intronic
1141642393 16:85348881-85348903 GACTCTCCCCCATCTCTCGGGGG - Intergenic
1142238861 16:88936021-88936043 CAGTCACCCCTGGCCCTCGTGGG + Intronic
1145933506 17:28702004-28702026 GAGTCTCCCCTAGCTCTCGTGGG + Exonic
1146731838 17:35199828-35199850 CAGTCTCCCATAGCGCTCCTAGG + Intergenic
1147996338 17:44362307-44362329 CAGTCTCCCCCAGCTCTCTCGGG - Intronic
1151385707 17:73753954-73753976 GAGTCACCCCTCACTCTCGCAGG + Intergenic
1160718896 19:589177-589199 GGGTCTCCTCTAGGTCTGGTGGG - Intergenic
1161056774 19:2194700-2194722 GAGTCCCCTCTGGTTCTCGTAGG + Intronic
1163372144 19:16907198-16907220 GAGTCACCCAGAGCTCTCCTCGG - Intronic
925475088 2:4204400-4204422 GAGTCTTCCCAAGCCCTCCTGGG - Intergenic
927428473 2:23006877-23006899 GAGTCTCCAGCAGCTCTCGCAGG - Intergenic
929967875 2:46549012-46549034 CAGTCCCCACCAGCTCTCGTTGG + Intronic
930573186 2:53112673-53112695 CAGTCTCCCATAGCGCTCCTAGG + Intergenic
936716586 2:115193875-115193897 GAGTTTCTCCTAGGTCTGGTCGG + Intronic
943474938 2:188342279-188342301 GAGTCTCTCCTAGCCCTTGGTGG + Intronic
944039499 2:195337856-195337878 GAGTTTCTCCTAGGTCTGGTCGG + Intergenic
947280878 2:228453118-228453140 GAGACTCCCTTAGCTGTCATGGG + Intergenic
1175062686 20:56258000-56258022 GAGTCTCCCCAGGCTGTCTTAGG - Intergenic
1181874224 22:25927412-25927434 CAGTCTCCCATAGCTCTCCCAGG + Intronic
1181959680 22:26613995-26614017 CAGTCTCCCATAGCTCTCCCAGG + Intronic
1182474472 22:30569132-30569154 GAGTCTCACCTAGATCCTGTGGG + Intronic
1184385576 22:44172519-44172541 GAGGCTCCCCTAGCTGGTGTGGG - Intronic
949610164 3:5696092-5696114 GAGTTTCTCCTAGGTCTGGTCGG + Intergenic
950489623 3:13295822-13295844 GAGCCTCCCCAACCTCACGTGGG - Intergenic
954205275 3:49054259-49054281 AGGCCTCCCCTAGCTCTCCTGGG - Intronic
957624361 3:82640509-82640531 CAGTCTCCCTGAGCTCTCGAGGG + Intergenic
959938564 3:112056560-112056582 GAGTCACCCCTAGATCTTCTTGG - Intronic
961737020 3:129008758-129008780 GAGTCTTCCCCAGCTCTAGGAGG - Intronic
967623351 3:191660492-191660514 GAGTTCCTCCTAGCTCTGGTTGG - Intergenic
969475498 4:7420422-7420444 GAGTCTCAGCTAGCTCTCCTGGG - Intronic
969606044 4:8202759-8202781 GAGGGTCCCCTAGCTCTGGCCGG - Intronic
970342409 4:15120615-15120637 CAGTCTCCCATAGCACTCCTAGG + Intergenic
978891236 4:113830718-113830740 GAGTCTCCGATAGCTCTAGAAGG - Intergenic
981720924 4:147800433-147800455 GAGGCTCCCCTAGTTATTGTTGG + Intronic
986727897 5:10613134-10613156 GTCTCTCCCCTGGCTGTCGTGGG + Intronic
987886781 5:23823564-23823586 GAGTCTCCCTGAGCTCTTTTCGG - Intergenic
988358234 5:30203520-30203542 GAGTTTCTCCTAGGTCTGGTCGG - Intergenic
995248841 5:109966165-109966187 GAGTCTCTCTTAGCTCTGGGAGG - Intergenic
996877815 5:128259487-128259509 GAGCCTCCCCAAGCTCCCCTAGG + Exonic
1002072507 5:176688505-176688527 GAGTCTCCCTGTGCTCTTGTGGG - Intergenic
1006222048 6:32499448-32499470 GAGTTCCCCCTAGATCTGGTTGG - Intergenic
1009544555 6:65006670-65006692 GAGTTCCTCCTAGCTCTGGTCGG - Intronic
1010186392 6:73148823-73148845 GAGCCTGCCCTTGCTCTCTTAGG + Intronic
1013865230 6:114688752-114688774 TAGTCTCCCATAGCGCTCCTAGG - Intergenic
1018215971 6:161528290-161528312 GAGTCTTCCATAGCTGTAGTGGG + Intronic
1019378313 7:708020-708042 GTGTCTCCCCTGGCTCTGGGTGG - Intronic
1020745200 7:12071246-12071268 GAGTGTCTCCTAGGTCTGGTTGG - Intergenic
1021513769 7:21461284-21461306 GAGTCTCCCCCAACCCCCGTGGG - Intronic
1024854848 7:53766109-53766131 GAGTCTCCCCGAGCCCTTATTGG - Intergenic
1028351589 7:89856814-89856836 GAGAATCCCCCAGCACTCGTGGG + Intergenic
1036135093 8:6152981-6153003 GAGCCTCCCCCAGCTGCCGTGGG + Intergenic
1043851430 8:85220664-85220686 AAGTCTCCCCTTGCTGGCGTGGG + Intronic
1046801146 8:118428687-118428709 GAGACTACCCTTTCTCTCGTTGG + Intronic
1049989386 9:977237-977259 GAGGCTCTCCAAGCTCTCGTTGG - Exonic
1051833793 9:21311451-21311473 CAGTCTCCCGTAGCACTCCTAGG + Intergenic
1057329308 9:94097937-94097959 GAGTCTCCCCTTGCTCCAGGAGG - Exonic
1060301066 9:122374956-122374978 GAGTCTCACCTACCTCTCTTAGG + Intronic
1060807534 9:126587029-126587051 GAATCACCCCTAGCCCTCCTGGG - Intergenic
1193611379 X:83635304-83635326 GAGTCTTCTCTAACTCTCCTGGG + Intergenic
1195668817 X:107452408-107452430 GAATATCCCCTATCTCTCGCTGG + Intergenic
1199351673 X:146809654-146809676 TAGTGTCCCTTAGCTCTCATTGG + Intergenic
1199352234 X:146814839-146814861 TAGTGTCCCTTAGCTCTCATTGG - Intergenic