ID: 1145935139

View in Genome Browser
Species Human (GRCh38)
Location 17:28710963-28710985
Sequence CCTTCCCACCCTACTCCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 244}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145935139_1145935156 29 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935156 17:28711015-28711037 AAGAAACTAGGAGAGGAAGGAGG 0: 1
1: 0
2: 5
3: 96
4: 1020
1145935139_1145935151 5 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935151 17:28710991-28711013 AAGGAGTAGGGCGGGAAGGGAGG 0: 1
1: 1
2: 5
3: 81
4: 1065
1145935139_1145935146 -7 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935146 17:28710979-28711001 GGGAAGGGAGGGAAGGAGTAGGG 0: 1
1: 11
2: 181
3: 2065
4: 12420
1145935139_1145935149 1 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935149 17:28710987-28711009 AGGGAAGGAGTAGGGCGGGAAGG 0: 1
1: 1
2: 16
3: 253
4: 2193
1145935139_1145935147 -4 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935147 17:28710982-28711004 AAGGGAGGGAAGGAGTAGGGCGG 0: 1
1: 3
2: 64
3: 667
4: 4041
1145935139_1145935154 22 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935154 17:28711008-28711030 GGGAGGGAAGAAACTAGGAGAGG 0: 1
1: 0
2: 17
3: 120
4: 1043
1145935139_1145935155 26 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935155 17:28711012-28711034 GGGAAGAAACTAGGAGAGGAAGG 0: 1
1: 0
2: 3
3: 92
4: 1376
1145935139_1145935148 -3 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935148 17:28710983-28711005 AGGGAGGGAAGGAGTAGGGCGGG 0: 1
1: 3
2: 40
3: 662
4: 6108
1145935139_1145935152 6 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935152 17:28710992-28711014 AGGAGTAGGGCGGGAAGGGAGGG 0: 1
1: 2
2: 8
3: 140
4: 1689
1145935139_1145935150 2 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935150 17:28710988-28711010 GGGAAGGAGTAGGGCGGGAAGGG 0: 1
1: 0
2: 7
3: 110
4: 1259
1145935139_1145935153 17 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935153 17:28711003-28711025 GGGAAGGGAGGGAAGAAACTAGG 0: 1
1: 1
2: 10
3: 194
4: 1674
1145935139_1145935145 -8 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935145 17:28710978-28711000 TGGGAAGGGAGGGAAGGAGTAGG 0: 1
1: 2
2: 34
3: 391
4: 3259
1145935139_1145935157 30 Left 1145935139 17:28710963-28710985 CCGAAAGGAGTAGGGTGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1145935157 17:28711016-28711038 AGAAACTAGGAGAGGAAGGAGGG 0: 1
1: 2
2: 21
3: 337
4: 3416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145935139 Original CRISPR CCTTCCCACCCTACTCCTTT CGG (reversed) Intronic
900290704 1:1922464-1922486 CCTGCCCACCTGACTCCCTTGGG + Intronic
900753752 1:4418651-4418673 CCCTCCCACTCTCCTTCTTTTGG + Intergenic
901256579 1:7833822-7833844 TCCTCCTACCCTCCTCCTTTCGG + Intronic
901460078 1:9386146-9386168 CCTTCCCTCCCTTCCCCATTCGG + Intergenic
902620561 1:17648410-17648432 ACTCCCCACCCTACTCCTGCCGG - Intronic
903635014 1:24807251-24807273 CCTACCCGACCTACCCCTTTGGG + Intronic
903742186 1:25564775-25564797 CTTCCCCACCCTCTTCCTTTTGG + Intronic
908203747 1:61823841-61823863 CCTTCCCATTATACTCCTTTAGG - Intronic
908245732 1:62226488-62226510 CCTTCCCTCCCTTCTCCTCCAGG + Intergenic
909087108 1:71181213-71181235 CACTCCCACCCTATTCCTCTGGG - Intergenic
910601331 1:89035495-89035517 ACTTCCCCCCTTACTACTTTAGG + Intergenic
910858217 1:91717662-91717684 TCTTCCCATCCTACTCCCTTTGG - Intronic
911427002 1:97729448-97729470 GGTTCCCACTCTACCCCTTTAGG + Intronic
912246199 1:107964536-107964558 GCTTCCCAGCCTTCTGCTTTGGG - Intronic
914675319 1:149903776-149903798 CCATCCCACCCTACTCTGTGTGG - Exonic
915561970 1:156692876-156692898 GCTTCCCACCTCTCTCCTTTGGG - Intergenic
915726907 1:158024633-158024655 CCTTCCCACCCTCATCCTCTGGG - Intronic
915755762 1:158257707-158257729 CCTCGTCACCCTTCTCCTTTTGG + Exonic
916005350 1:160654499-160654521 CCATGCCACTCTACTCCTCTAGG + Intergenic
916575135 1:166060216-166060238 CCTTCCCTCCCTATGCTTTTGGG - Intronic
918063055 1:181078705-181078727 CCTTCCCACCCATTTCCTTCAGG - Intergenic
920220542 1:204396594-204396616 CCTTCCCAACCTCCAGCTTTTGG - Intergenic
920298416 1:204974007-204974029 CCTTCCCCACCTAATCCTTAGGG + Intronic
920336376 1:205247946-205247968 CCGTCACACCCTGCTCCCTTTGG - Intronic
920531772 1:206707303-206707325 CCTTCCCACCATTCTCCATGGGG - Intronic
920810132 1:209277661-209277683 CTTTCCCACCCTATTCTTGTTGG + Intergenic
921192108 1:212719613-212719635 CCTCCCTCCCCTACTCCTTTTGG + Intergenic
921875181 1:220187627-220187649 TCTTCCAACCCTTGTCCTTTTGG - Intronic
922456153 1:225775220-225775242 TCTTCCCACCCTCCCCCTTTTGG - Intergenic
923356174 1:233157964-233157986 CCCTCCCAGCCTACTTCTATGGG + Intronic
1062779664 10:190477-190499 CCTTCCCAGACTCCTCCTTCAGG + Intronic
1064269131 10:13849370-13849392 CCTGCCCACACTACTCAGTTGGG + Intronic
1066106491 10:32161604-32161626 CCTTCCCACCCAACTCACTCTGG + Intergenic
1066507067 10:36056570-36056592 CTTTCTTACCCTCCTCCTTTTGG - Intergenic
1069571606 10:69497735-69497757 CCTCCCCTCCCTGCTCCTGTAGG - Intronic
1070301337 10:75205917-75205939 CCTTCCCAGCCTCCACCTGTTGG + Intergenic
1071489565 10:86127119-86127141 CCTTCCCACCCTGCTTCGCTAGG + Intronic
1071940489 10:90586334-90586356 CATTCCCACTCCTCTCCTTTAGG + Intergenic
1072661121 10:97364089-97364111 CCTTCCCACCCTAGGCCCTAGGG + Intronic
1073500767 10:103934804-103934826 TCTTCCCACCCTCCACCCTTCGG + Intergenic
1075144896 10:119874111-119874133 CCTTCCCACTCTGCTGTTTTTGG - Intronic
1075834629 10:125443178-125443200 CCTTTCCAACCTCCTCCTTTTGG + Intergenic
1075834846 10:125444533-125444555 CCTTTCCAACCTCCTCCCTTCGG - Intergenic
1075957287 10:126534937-126534959 ACTTCCCACCTCACTCCTTCAGG + Intronic
1083848663 11:65352476-65352498 GCCTCCCTTCCTACTCCTTTTGG + Exonic
1084472658 11:69372242-69372264 CCTGCCCAGCCTCCTCCTTGGGG + Intergenic
1085805494 11:79632173-79632195 TTTTCCCACCCTACTGTTTTAGG - Intergenic
1085810964 11:79680691-79680713 CCTTCCCAAACTGCTCCTTCAGG + Intergenic
1087260937 11:96011563-96011585 CTCTCCCACCCTCCCCCTTTTGG - Intronic
1088998232 11:115023060-115023082 AGTTCCCGCCCTACCCCTTTTGG - Intergenic
1089215101 11:116830367-116830389 CCATCCCACCCACCTCCCTTTGG + Intronic
1089784003 11:120895054-120895076 CCTTCCCACCTCCCTCCTCTGGG - Intronic
1090056076 11:123426185-123426207 CCAGCCCACCCTACTACTGTGGG - Intergenic
1095211270 12:39497968-39497990 CCCTCCCTCCCTCCTCCTTTTGG - Intergenic
1095394725 12:41748809-41748831 CCATCCCACACTCCTCTTTTTGG + Intergenic
1099137827 12:78930646-78930668 ACTTCCCAACCTCCTCCATTGGG + Intronic
1099468905 12:83022285-83022307 CCTGCCCTGCCTACTCCCTTAGG + Intronic
1100913591 12:99392450-99392472 CTTTTCCACTTTACTCCTTTTGG + Intronic
1100971511 12:100075949-100075971 CCTTCCTCCCATCCTCCTTTTGG - Intronic
1102366881 12:112345098-112345120 CCATCACACCCTACTATTTTTGG - Intronic
1103197862 12:119060958-119060980 CCTTCCCCACCTCCTCCTGTAGG + Intronic
1103747528 12:123135841-123135863 CCGTGCCACCCTACCCATTTTGG + Intronic
1106152514 13:27119394-27119416 TCTTTCCACCTTACTCCTCTTGG - Intronic
1106794370 13:33189414-33189436 CTTTCCCTCCTTCCTCCTTTCGG + Intronic
1106841337 13:33687856-33687878 CCTGTCCACCCTCCTCCTATGGG + Intergenic
1108228747 13:48317276-48317298 CCTGCCCAGCCTACCCCTTGTGG - Intronic
1108396460 13:49996334-49996356 CCGTCCCACCCTCCCCCTTGTGG + Intronic
1108734597 13:53269464-53269486 CCTACCCACCCTATTCTTTGTGG + Intergenic
1108937532 13:55902204-55902226 CCCTCCCATCCTCCTCCTTCTGG - Intergenic
1109198512 13:59405891-59405913 CCTTCCAACACTGCTGCTTTGGG - Intergenic
1110324944 13:74202876-74202898 CTTTCCTACCGTGCTCCTTTAGG - Intergenic
1110539735 13:76694731-76694753 GATTCTCACCCTTCTCCTTTTGG - Intergenic
1110700266 13:78539150-78539172 CCCTCCCACCTCTCTCCTTTTGG - Intergenic
1111663433 13:91238970-91238992 CCTTCCCACTCTTCTTCCTTCGG - Intergenic
1113632266 13:111896449-111896471 CCTTCCCAGCCTCCTGCTCTCGG - Intergenic
1113748590 13:112763318-112763340 TCATCCCACCCTCCTCCCTTTGG + Intronic
1114443595 14:22770779-22770801 CTTTTCCACCCCACTTCTTTTGG + Intronic
1114668056 14:24392508-24392530 CCTTACCGCCCCCCTCCTTTAGG + Intergenic
1114673502 14:24427247-24427269 CCTTCCCACCCTTCTGCCTGTGG + Exonic
1115911868 14:38266050-38266072 CCTTTCCCACCTACTCCTGTGGG + Intergenic
1117581487 14:57155934-57155956 CCTTCCCTCCTTCCTTCTTTAGG - Intergenic
1117835980 14:59806610-59806632 TCCTCCCACCCTCCACCTTTGGG + Intronic
1117968842 14:61232676-61232698 CCTCCCCAACCCAGTCCTTTTGG + Intronic
1117997279 14:61489617-61489639 CCTTCCCAGCCTACTCTTCTTGG - Intronic
1119924979 14:78484963-78484985 CCTTGCCAGCACACTCCTTTGGG + Intronic
1120521996 14:85534486-85534508 CCTTCCCTCCCTTCACCTTCTGG + Intronic
1121830771 14:97050216-97050238 CCCACCCAGCCTACACCTTTTGG + Intergenic
1123852424 15:24373108-24373130 GCCTCCAACCCTCCTCCTTTCGG + Intergenic
1124113121 15:26811497-26811519 CCCTCCCACCCTCCACCTTCAGG - Intronic
1125530184 15:40408049-40408071 CCTTCCCTTCCTGCTTCTTTTGG - Intronic
1126101047 15:45118375-45118397 CCTTCCCACCCCACTCAGCTGGG - Exonic
1126224247 15:46251565-46251587 GCTTCCCCCCCTCCTCCCTTAGG - Intergenic
1127466731 15:59250992-59251014 CATTCCCATCCCACTCGTTTTGG + Intronic
1127962262 15:63898665-63898687 CCTTCCCACCCTCCTTCCTTAGG - Intergenic
1128087075 15:64893970-64893992 CCTCCCCACCCTTCCCCTTCAGG - Intronic
1128417408 15:67459344-67459366 TCTTGCCACCCTTCTCCTATGGG - Intronic
1129655479 15:77521860-77521882 CATTCCCACCCTACCTCTGTAGG - Intergenic
1129712572 15:77827998-77828020 CCTTCCAACTCTTCTCCTTCAGG + Intergenic
1129746413 15:78024547-78024569 CCTTCACTCCATTCTCCTTTTGG - Intronic
1130219626 15:82008367-82008389 CCTTCCCTCCCCATACCTTTGGG + Intergenic
1131336534 15:91554431-91554453 CTGTCCCACCCTATTCCTTTAGG - Intergenic
1132792410 16:1699073-1699095 TCTTCCCACCCCGCTCATTTGGG - Exonic
1135668599 16:24356105-24356127 TCTTCCTACCCCACTCCTCTTGG + Intronic
1138966694 16:62093289-62093311 CATTCCCAACCTCCCCCTTTTGG + Intergenic
1139377503 16:66509297-66509319 TCTTCCCACCTTTCTCTTTTGGG - Exonic
1141067522 16:80926249-80926271 CCTTCTCCCCCTCCTCCTTTTGG - Intergenic
1141834964 16:86532409-86532431 CCTTCCCAGCCTGCTGCTCTCGG + Exonic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1142442886 16:90112184-90112206 CCCCCCCACCCTAATCCATTGGG - Intergenic
1144623444 17:16832575-16832597 CCTTCTCTCGCTTCTCCTTTGGG - Intergenic
1144882988 17:18440141-18440163 CCTTCTCTCGCTTCTCCTTTGGG + Intergenic
1145149244 17:20504245-20504267 CCTTCTCTCGCTTCTCCTTTGGG - Intergenic
1145760018 17:27420547-27420569 CCCTCCCACCCTACCTCTCTTGG - Intergenic
1145935139 17:28710963-28710985 CCTTCCCACCCTACTCCTTTCGG - Intronic
1147609781 17:41794632-41794654 CCTTCCCAGCCTCCTCCTCCAGG + Intergenic
1148546385 17:48522324-48522346 CCTCCCCAGCCTCCTCCTGTTGG - Intergenic
1149051280 17:52308428-52308450 TCCTCCCACCCTCCACCTTTTGG - Intergenic
1149698726 17:58637555-58637577 GCTTCCCAACCCAGTCCTTTTGG - Intronic
1150004310 17:61460379-61460401 CCTTCCTACCTTAGCCCTTTGGG + Intronic
1150912929 17:69408048-69408070 CCTTCCTAACCTACTCCTTTGGG - Intergenic
1151388595 17:73770628-73770650 CCTTCCCTCGCCACTCCCTTGGG - Intergenic
1152234838 17:79133150-79133172 GCTCCCCACCCTGCTCCTGTGGG - Intronic
1153261143 18:3225605-3225627 TCTTCCTAGACTACTCCTTTTGG + Intergenic
1157320638 18:46631374-46631396 CCTTCTCAACCTACTCCCTGTGG - Intronic
1158654604 18:59319470-59319492 CCTTCCCACCCCACCCTCTTTGG - Intergenic
1159254025 18:65922069-65922091 CCTTCCCTCCCTCCTCCTTCTGG + Intergenic
1159599867 18:70418881-70418903 CCTTCACAGTCTCCTCCTTTGGG - Intergenic
1161253715 19:3294963-3294985 CCTCCCCACCCTACTCCACCCGG - Intronic
1161394248 19:4037048-4037070 CCTCCCCACCCTGCCCCTCTGGG - Intronic
1162256922 19:9498336-9498358 ACTTCCCACCCGGCTCCTCTAGG + Intronic
1162612852 19:11769529-11769551 CCTTCCTAACTTAGTCCTTTGGG + Intronic
1163189526 19:15666391-15666413 CTCCCCCAGCCTACTCCTTTGGG - Intergenic
1163221488 19:15924699-15924721 CTTTTCCAGCCTACTCCCTTGGG + Intronic
1163686352 19:18714034-18714056 CCCTCCCACCCTGCTGCTTCCGG - Intronic
1163714539 19:18866203-18866225 CCCTCCCATCCTTCTCCTTGAGG - Intronic
1165207799 19:34205742-34205764 TCTTCCCCCTCTACTACTTTTGG - Intronic
1165896152 19:39142506-39142528 CCCTCCCACCCTACTTCTGCTGG - Intronic
1165912735 19:39239045-39239067 TGTTCCCTCCCTCCTCCTTTAGG - Intergenic
1166195914 19:41205904-41205926 CCTTCCCACCCCAGTCCATTTGG - Intronic
1166398666 19:42461715-42461737 CCTCCCCACCCTAATATTTTAGG + Intergenic
1166676970 19:44746741-44746763 CCTTCCCACCCTACCTCTGAGGG + Intergenic
1167266357 19:48484848-48484870 CCTTCCCACCCAACCCCAGTGGG + Intergenic
1168639753 19:58023200-58023222 CCTTCACCCCTTACTCCTTCAGG - Intergenic
927082765 2:19647023-19647045 CCTTTCTCCCCTAGTCCTTTTGG - Intergenic
928812338 2:35244336-35244358 CCCTCCCACCCTCCACCCTTTGG + Intergenic
930224619 2:48779569-48779591 CCAACCCTCCCTACTCCATTCGG + Intergenic
930246603 2:48990016-48990038 CCTTCCCCATCTCCTCCTTTTGG + Intronic
930854465 2:55997776-55997798 TCTTGCCTCCCCACTCCTTTTGG - Intergenic
931703673 2:64928686-64928708 CCTGATCACCCTACTCCTTTTGG + Intergenic
932911930 2:75815637-75815659 CTTTCTCCCCCTGCTCCTTTGGG + Intergenic
933097743 2:78209117-78209139 CCTTCCAACTCTTCTCCCTTTGG - Intergenic
933197246 2:79406056-79406078 CTTAACCACCCTTCTCCTTTGGG - Intronic
933780432 2:85796982-85797004 CCTTCCCACTCTCCTCCCTGAGG + Intergenic
935867814 2:107410185-107410207 CTTCCCCACCTTAATCCTTTTGG + Intergenic
939105617 2:137945252-137945274 CCCTCCCACCCTGCCCCCTTGGG - Intergenic
939437319 2:142195181-142195203 CCTTCCTCCCTTCCTCCTTTGGG - Intergenic
947918349 2:233849089-233849111 CCTCCTCTCCCGACTCCTTTCGG - Intronic
1169330728 20:4714129-4714151 CCTCCCCACCCCACTCTCTTTGG + Intergenic
1170336380 20:15274936-15274958 CCTCGCCACCCCACTCCTATAGG - Intronic
1172053967 20:32141294-32141316 ACCTGCCACCCTCCTCCTTTGGG - Intronic
1172191363 20:33063731-33063753 CCTTCGTACCCTACCCCATTGGG - Intronic
1174578410 20:51553812-51553834 CCTACCCACCCTGCCCCTTGAGG - Intronic
1175980488 20:62736217-62736239 CCTTCCCGCCCTGCTCCATGGGG - Intronic
1176430279 21:6571182-6571204 CCTTCCCACCCCAGTCCTCTAGG - Intergenic
1176747273 21:10662916-10662938 CCCTTCCATTCTACTCCTTTTGG + Intergenic
1177039707 21:16093517-16093539 CCTTCTAACTCTTCTCCTTTTGG + Intergenic
1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG + Intergenic
1178263806 21:31124272-31124294 CTTTGCCTCCCTTCTCCTTTTGG - Intronic
1178390603 21:32194886-32194908 CCTTCCCACCCTCCCACCTTTGG - Intergenic
1179705673 21:43178644-43178666 CCTTCCCACCCCAGTCCTCTAGG - Intergenic
1179986890 21:44927192-44927214 CCTTCAAACCCTGCTCCTATGGG - Intronic
1181870249 22:25892517-25892539 CCTTCTCACCCAACTCCATTAGG - Intronic
1182497236 22:30718185-30718207 TCTTCCCACCCTACTGATATTGG - Intronic
1182613324 22:31567654-31567676 CCTTCTCTCCCTCCTCCTATAGG - Intronic
1183218709 22:36497958-36497980 CGTCCCCACCCTACTCCCCTCGG - Intronic
1183236711 22:36624265-36624287 CCTTCCCAGCCTGCTCCTGGTGG + Intronic
1183796880 22:40126393-40126415 CCTTCCCTCCCTCTCCCTTTTGG + Intronic
1184589244 22:45470570-45470592 CCGGCCCACACTCCTCCTTTAGG + Intergenic
1184643236 22:45883127-45883149 CCTGCCCACGCTCCTCCTGTGGG - Intergenic
1185191846 22:49443029-49443051 CCTTCCCACTCCATTCTTTTAGG - Intronic
949688327 3:6604145-6604167 TCATGCCACCCTACTCCTTCAGG + Intergenic
949941629 3:9159196-9159218 CCATCCCACCAGACTCCTGTTGG + Intronic
950887516 3:16374431-16374453 CCTTCCCTCCCAACTCCCTTGGG - Intronic
952898110 3:38092711-38092733 GCCTCCCACCCTCCTCCTCTCGG - Intronic
953773680 3:45797807-45797829 CCTACTCACCCTTCTCCTCTGGG - Intergenic
953896622 3:46808211-46808233 CCTTCCCACCCTCCTCCCTGTGG + Intronic
955132275 3:56182439-56182461 CCTTCACAGCAGACTCCTTTTGG - Intronic
956086925 3:65621490-65621512 CCTTCCCAGGGTTCTCCTTTTGG - Intronic
956678978 3:71760219-71760241 CCTTCCCTCTTTACTCCTTTTGG + Intergenic
958699860 3:97574859-97574881 CCTTCCCACCCTCCAGTTTTTGG - Intronic
959523400 3:107346306-107346328 CCCTGCCACTCTGCTCCTTTGGG - Intergenic
960348492 3:116564796-116564818 CCTTCCCATCCTGCCCCTTCAGG + Intronic
960562377 3:119098969-119098991 CATTCCTAACCTACTCCCTTTGG + Intronic
960881924 3:122354096-122354118 CCTTATCACCCTGCTCCTTCAGG + Intergenic
961092508 3:124126497-124126519 CCTGGCCACTCTTCTCCTTTGGG + Intronic
961261727 3:125607239-125607261 CCTTCTCAGCCTATTCCTCTTGG - Intergenic
961343369 3:126245311-126245333 CCCTCCAACCCTGCTCCTCTGGG - Intergenic
962312519 3:134336696-134336718 CCCTCCCTCCCTTCTCCTATGGG + Intergenic
965822533 3:172699209-172699231 CCCTCCCACCCTTTTACTTTGGG - Intronic
966609197 3:181851419-181851441 CCCCCACTCCCTACTCCTTTAGG + Intergenic
966922004 3:184618528-184618550 CCTTCTCCCCCTACTCCAGTGGG - Intronic
968363158 3:198163144-198163166 CCCCCCCACCCTAATCCATTGGG - Intergenic
971012583 4:22454936-22454958 CTTTTCCACCCTTCTCCTTAGGG - Exonic
971192737 4:24443296-24443318 CCTTCCTTCCCTACTCTTTACGG - Intergenic
971322124 4:25614143-25614165 TCTTCCCAACCTGCACCTTTGGG - Intergenic
971343002 4:25787784-25787806 TCTTCCCACCCCTCTCCTGTTGG + Intronic
972289517 4:37678477-37678499 CCATCAGACCCTACTCCTTCGGG + Intronic
975404747 4:73976594-73976616 CCTTCAAACCCTAGTCCTTATGG + Intergenic
976980920 4:91227666-91227688 CCCTCCCTCCCTTCCCCTTTTGG + Intronic
979278276 4:118836683-118836705 ACTTCCCACACTTTTCCTTTGGG - Intronic
979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG + Intronic
983268452 4:165532802-165532824 CCCTCCCACCCTCCTCCGTGTGG + Intergenic
987331762 5:16863319-16863341 CCTTCCCACCCCAGCCCCTTTGG - Intronic
987533301 5:19149684-19149706 CCTTCCTTCCTTCCTCCTTTTGG - Intergenic
988615133 5:32768068-32768090 TCTTCCCGCCCTTCTCCTGTTGG + Intronic
989945812 5:50227793-50227815 CTTTCCCACCATAGTCCTTAAGG + Intergenic
992178214 5:74171887-74171909 CCTCCACACCCTTCTCCTCTAGG + Intergenic
999384357 5:151143879-151143901 CCTCCCTACTCTACTCCTTGGGG - Intronic
1001221517 5:169904509-169904531 CCTTCCCACCTCACTCCCTCAGG - Intronic
1001561965 5:172675621-172675643 CCTTCCCTCCCTTCTCCCTGTGG + Intronic
1001954166 5:175837033-175837055 CCTTTCCCCCTGACTCCTTTGGG - Intronic
1005987410 6:30883693-30883715 CCCTCCCACTCCACTCCGTTGGG + Intronic
1009053409 6:58306211-58306233 CCTCCCCACTCTTCTCCTTAGGG - Intergenic
1009237704 6:61144330-61144352 CCTCCCCACTCTTCTCCTTAGGG + Intergenic
1012610737 6:101216313-101216335 TCTTCCCACCGTACTTCTTTTGG - Intergenic
1013498805 6:110726537-110726559 CCTCCCCACCCTATTCACTTAGG - Intronic
1016649428 6:146447256-146447278 CATTCCCACCCTGCCCCCTTTGG - Intergenic
1019252523 7:25568-25590 CCCCCCCACCCTAATCCATTGGG + Intergenic
1022880878 7:34586212-34586234 CCTTCCCACCATACTTGTGTGGG + Intergenic
1023393620 7:39732950-39732972 CTTTCCCACCCTCCCCCGTTAGG + Intergenic
1024093731 7:45968198-45968220 ACTTCCCACCCTTCTCCTGAGGG + Intergenic
1024375230 7:48629839-48629861 CCTTCCTACCCTTTTACTTTGGG - Intronic
1027705768 7:81531680-81531702 CCTACCCACCCATCTCCTATTGG - Intergenic
1029443660 7:100601457-100601479 GCTTCCCACCCATCTCCCTTCGG + Intergenic
1029746098 7:102516611-102516633 CCCTCCCACCCTCCTCCTCCAGG + Intronic
1029764036 7:102615590-102615612 CCCTCCCACCCTCCTCCTCCAGG + Intronic
1031117816 7:117687304-117687326 CCTTCCCTCTCTGCTTCTTTTGG - Intronic
1033233371 7:139619166-139619188 CCTTCCCACCCTTTTCCCCTAGG - Intronic
1034085444 7:148318073-148318095 CATTCAGACCCTTCTCCTTTTGG + Intronic
1034345935 7:150385105-150385127 CCTCGCCACCCTCCTCCCTTGGG - Intronic
1035247163 7:157570547-157570569 ACTTCATACCCAACTCCTTTTGG - Intronic
1035286885 7:157812360-157812382 CCTTTCCACTCCACTCCCTTTGG + Intronic
1036026402 8:4913796-4913818 CCTTCCCACCAGACTCTTTGGGG + Intronic
1037236179 8:16721671-16721693 CCCAGCCACCTTACTCCTTTTGG + Intergenic
1038084942 8:24185679-24185701 CTTTCCCAGCCTACTTCTTTTGG + Intergenic
1039384376 8:37119519-37119541 CCTTCCCACCAGACTTCCTTTGG + Intergenic
1042859415 8:73297467-73297489 CCTTCCCAACCTTCTCATTAAGG - Intronic
1046498240 8:115042138-115042160 CCTTCACTCCCTTGTCCTTTTGG - Intergenic
1050131117 9:2413841-2413863 CCTACCCACCCACTTCCTTTTGG - Intergenic
1052154775 9:25171989-25172011 TATTCCCACCTGACTCCTTTAGG + Intergenic
1055499321 9:76887551-76887573 ACTTCCCACCCCACTGCTATTGG + Intronic
1055961252 9:81822330-81822352 CCTTCTCCCCCTCCACCTTTGGG + Intergenic
1058021816 9:100098412-100098434 CCTTCCCACCCTCTCCATTTGGG - Intronic
1058585043 9:106498701-106498723 CATTCCAACTGTACTCCTTTTGG + Intergenic
1059099207 9:111453517-111453539 CCTGCCCACCCTCCCCCTTGAGG + Intronic
1060291758 9:122309363-122309385 CCTCTCCACCCTTCTCTTTTGGG + Intronic
1062747845 9:138226804-138226826 CCCCCCCACCCTAATCCATTGGG - Intergenic
1185871004 X:3664807-3664829 CCTTCCCAGCCTTCCCCTTTTGG - Intronic
1186459349 X:9735765-9735787 CCTTCAGACCCTACTGCTTCGGG - Intronic
1186676818 X:11826418-11826440 CCCTCCTATCCTCCTCCTTTAGG - Intergenic
1187061293 X:15789727-15789749 CATTCCCACCCTTCTCCTTCTGG + Intergenic
1187667045 X:21625429-21625451 CCTCACCACCCTGCTACTTTGGG - Intronic
1188602822 X:31989956-31989978 CCTCCCTCCCCTCCTCCTTTCGG + Intronic
1189633005 X:42975060-42975082 TCTTCCCTCCCAACTCCTCTGGG + Intergenic
1192430855 X:71110688-71110710 CCTTCCAACCTTTCTCCTCTAGG - Exonic
1192796915 X:74431466-74431488 CCTTCCCACCCTTCCCCATCTGG - Intronic
1195728617 X:107942393-107942415 TCTTCCTACCCTTCTCCTTCAGG - Intergenic
1198226877 X:134653327-134653349 ACTACCCACCCTTCTCCATTTGG + Intronic
1198475155 X:136989204-136989226 CCTTCCCTACCTACCGCTTTGGG - Intergenic
1200793084 Y:7316705-7316727 CCTTCCCAGCCTTCCCCTTTTGG + Intergenic
1201198170 Y:11514592-11514614 CCTTTCCAATCTATTCCTTTTGG - Intergenic