ID: 1145935200

View in Genome Browser
Species Human (GRCh38)
Location 17:28711189-28711211
Sequence CAGCGCCCACCCGGACGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145935200_1145935216 30 Left 1145935200 17:28711189-28711211 CCCCGGCGTCCGGGTGGGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1145935216 17:28711242-28711264 CAAGGGCAGCGGCCTGCGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 209
1145935200_1145935209 2 Left 1145935200 17:28711189-28711211 CCCCGGCGTCCGGGTGGGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1145935209 17:28711214-28711236 CCACGGGCTCCAGCCAAGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 272
1145935200_1145935214 19 Left 1145935200 17:28711189-28711211 CCCCGGCGTCCGGGTGGGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1145935214 17:28711231-28711253 GGCCGGCGCTTCAAGGGCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 113
1145935200_1145935212 13 Left 1145935200 17:28711189-28711211 CCCCGGCGTCCGGGTGGGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1145935212 17:28711225-28711247 AGCCAAGGCCGGCGCTTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 81
1145935200_1145935207 -2 Left 1145935200 17:28711189-28711211 CCCCGGCGTCCGGGTGGGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1145935207 17:28711210-28711232 TGGTCCACGGGCTCCAGCCAAGG 0: 1
1: 0
2: 1
3: 15
4: 178
1145935200_1145935211 12 Left 1145935200 17:28711189-28711211 CCCCGGCGTCCGGGTGGGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1145935211 17:28711224-28711246 CAGCCAAGGCCGGCGCTTCAAGG 0: 1
1: 0
2: 1
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145935200 Original CRISPR CAGCGCCCACCCGGACGCCG GGG (reversed) Intronic
900109350 1:999078-999100 CAGGGCCCACCCGGGCCCTGCGG + Exonic
900181471 1:1312892-1312914 CAGCGCACACGCGGACGCCAAGG - Exonic
900565726 1:3331056-3331078 CACCGCCCACCCGGGCTCCAGGG + Intronic
902019079 1:13329432-13329454 CACCGCCCTCCCGGACGGGGCGG - Intergenic
903628224 1:24745975-24745997 CACCCCCCGCCCGGGCGCCGGGG + Intronic
903637502 1:24832918-24832940 CACCGCCCTCCCGGACGGGGCGG + Intronic
904253004 1:29237867-29237889 CAGCCCCCGCCCGGCCGCCCGGG - Intronic
907278101 1:53327991-53328013 CAGCGGCAACCCCGGCGCCGCGG - Exonic
908473902 1:64470470-64470492 CGGCGCCCACACGGGCCCCGCGG - Intergenic
908555591 1:65254320-65254342 CCGCGCGCACCCGCACGCCTCGG + Intronic
912492533 1:110070173-110070195 CAGCGCCAACCCGGCTTCCGTGG + Intronic
915586949 1:156849095-156849117 GAGCGCCCACCCTGACCCCGCGG + Intronic
917974192 1:180229184-180229206 CAGTGAGCACACGGACGCCGGGG - Intergenic
921140030 1:212298459-212298481 CACCGCCCTCCCGGACGGGGCGG + Intronic
921376847 1:214483395-214483417 CAGTGCCCACCCGGTCGGCCTGG - Intronic
922278533 1:224101024-224101046 CAGCTCCCTCCCGGACGAGGTGG - Intergenic
1064860070 10:19816735-19816757 CAGCGCCAACCCGGTGCCCGCGG - Exonic
1065637539 10:27745981-27746003 CCGCGCCCGCCCGGCCGCGGGGG + Exonic
1065727131 10:28677423-28677445 CGGCGGCCAATCGGACGCCGTGG + Exonic
1066085807 10:31970969-31970991 CACCGCCCTCCCGGACGGGGCGG - Intergenic
1067338820 10:45384748-45384770 CAGAGCCCACCCAGACTCCGGGG + Intronic
1069982262 10:72260839-72260861 CTGCCCCCACCCAGCCGCCGGGG + Intergenic
1070327113 10:75396416-75396438 CAGCGACCTCCCGGACACTGCGG - Intergenic
1072180591 10:92976024-92976046 CACCTCCCTCCCGGACGCGGCGG - Intronic
1073076518 10:100828200-100828222 CAGGGCACACCCGGAAGGCGAGG - Exonic
1074095044 10:110304568-110304590 CAGCGCCGGCCGGGCCGCCGAGG + Intronic
1077040411 11:518723-518745 CAGCGCGGAACCGGACGCCCAGG + Intergenic
1083865495 11:65451248-65451270 CACCTCCCACCCGGACGGGGCGG - Intergenic
1084310286 11:68312722-68312744 CAGCGCCGCCCGGGCCGCCGTGG + Exonic
1084527232 11:69704772-69704794 CAAAGCCCAGGCGGACGCCGAGG - Intergenic
1087039503 11:93784738-93784760 CAGCGCAGACCAGGACGACGAGG + Exonic
1089421030 11:118331724-118331746 CACCTCCCTCCCGGACGGCGCGG + Intergenic
1090186256 11:124740749-124740771 CAGCGCCCACGCGGAAACCTGGG + Intronic
1091378819 12:42657-42679 CACCGCCCTCCCGGACGGGGCGG - Intergenic
1091684520 12:2552128-2552150 CAGCGCCAGCCTGGAAGCCGCGG + Intronic
1100570281 12:95840479-95840501 CACCGCCCTCCCGGACGGGGCGG + Intergenic
1108695358 13:52897987-52898009 CAGCTCCCAGCCGGGCGCGGTGG - Intergenic
1111388617 13:87561822-87561844 CACCTCCCTCCCGGACGCGGCGG - Intergenic
1113082753 13:106535271-106535293 CCGCGCCCACCCGCCAGCCGCGG - Intergenic
1113355194 13:109572539-109572561 CAGTGCCCTCCCTGAAGCCGTGG + Intergenic
1118340777 14:64894783-64894805 CACCGCCCTCCCGGACGGGGCGG + Intergenic
1122779773 14:104138731-104138753 CAGCGCACAGAGGGACGCCGCGG - Exonic
1125868492 15:43076751-43076773 CACCTCCCTCCCGGACGCGGTGG - Intronic
1128489836 15:68134854-68134876 CACCGCCCTCCCGGACGGGGCGG + Intronic
1132314049 15:100878264-100878286 CAGCACCCAGCCGGGGGCCGTGG + Intronic
1132482193 16:172365-172387 ATGCGCGCACCCGGACGCCCTGG - Intergenic
1132483041 16:176169-176191 ATGCGCGCACCCGGACGCCCTGG - Intergenic
1132560234 16:590164-590186 GCGCGCCCACTCGGCCGCCGTGG + Intronic
1132673531 16:1112358-1112380 CACCGCCCACCCGGCCACAGTGG + Intergenic
1134070091 16:11255509-11255531 CAGCGCACCCCCGGACGCTATGG - Exonic
1135464154 16:22670806-22670828 CAGCACCCACCCTCACGCTGGGG - Intergenic
1136927556 16:34388748-34388770 CAGCGCCCAACCTGTCGCTGCGG - Intergenic
1136977018 16:35023058-35023080 CAGCGCCCAACCTGTCGCTGCGG + Exonic
1138385383 16:56632660-56632682 CTAGGCCCACCCGGACGGCGTGG - Exonic
1139467105 16:67159891-67159913 CCGCGCACACCCGGAAGCGGCGG - Exonic
1141551695 16:84810624-84810646 CAGCACACACCCTGAAGCCGGGG + Intergenic
1141785872 16:86200519-86200541 CAGCTCACAGCCGGACGCTGCGG - Intergenic
1142549934 17:732398-732420 CCCCGCCCACCCGCCCGCCGGGG + Exonic
1144519787 17:15945842-15945864 CGGCGCCTCCCCGGGCGCCGGGG - Intronic
1145935200 17:28711189-28711211 CAGCGCCCACCCGGACGCCGGGG - Intronic
1147971362 17:44220260-44220282 CCGAGCCTCCCCGGACGCCGGGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148388628 17:47254187-47254209 GAGCGCCTTCCCGGCCGCCGCGG + Intronic
1148591115 17:48817279-48817301 CACCGCGCACCCGGGCGCCAGGG + Intergenic
1150310998 17:64129693-64129715 CAGCGGCTCCCCGGACCCCGCGG - Intronic
1152363159 17:79841648-79841670 CAGCCCAGACCTGGACGCCGCGG - Intergenic
1152892301 17:82889384-82889406 CAGCACCCACGCGGAGGCCCCGG - Intronic
1154382863 18:13868642-13868664 CAGAGCCCACACGGTCTCCGAGG - Intergenic
1155152778 18:23135810-23135832 CAGCGCCGGCACCGACGCCGCGG + Exonic
1160796356 19:947528-947550 CAGCCCCCACCCAGATGCCCCGG + Intronic
1160875802 19:1295754-1295776 GAGCGGCCCCCCGGGCGCCGCGG - Exonic
1160928539 19:1558782-1558804 CAGGGCCCACCTGGATGCCTCGG - Intronic
1161150449 19:2705246-2705268 AGGCGCCCACCCGGACACAGTGG + Intergenic
1162683771 19:12365364-12365386 CAGCTCCCACCCCGCGGCCGAGG + Intronic
1162727164 19:12696578-12696600 CAGCGCCCACCCGGTCGCAATGG - Exonic
1162911586 19:13850649-13850671 CCGGGCCCCTCCGGACGCCGAGG - Intergenic
1164066836 19:21722067-21722089 CACCGCCCTCCCGGACGGGGCGG - Intergenic
1168126347 19:54285682-54285704 CTGCCCCCACCCGAACACCGTGG + Intergenic
1168175545 19:54625182-54625204 CTGCCCCCACCCGAACACCGTGG - Intronic
1168247293 19:55118851-55118873 CTGCGCCCACCCGGACCTCCTGG + Intergenic
1168254242 19:55157241-55157263 CAGCGCCCACCCTGGCCCTGGGG + Intronic
925407508 2:3615815-3615837 CACCTCCCTCCCGGACGCGGCGG + Intronic
925407528 2:3615861-3615883 CACCTCCCTCCCGGACGCGGCGG + Intronic
928558004 2:32447615-32447637 CACCTCCCTCCCGGACGGCGCGG + Intronic
932771522 2:74503215-74503237 CCACGCCCACCCGGACCCCGGGG - Intronic
932773221 2:74513281-74513303 CAGGGCCCCCCCGGGGGCCGGGG + Intergenic
934753038 2:96806139-96806161 CACCGCCCTCCCGGACGGGGCGG + Intronic
937953841 2:127408288-127408310 CAGCGTCCACCCCGCCGCTGGGG + Intergenic
939153836 2:138501834-138501856 CAGCCCCCACCCCCCCGCCGCGG - Exonic
940299158 2:152160536-152160558 CACCTCCCTCCCGGACGCGGTGG - Intronic
940299196 2:152160629-152160651 CACCGCCCTCCCGGACGGGGCGG - Intronic
944598328 2:201282576-201282598 CACCGCCCTCCCGGACGGGGCGG + Intronic
947741377 2:232486530-232486552 CAGCGCCCAACGGGAAGCCCGGG + Exonic
947840497 2:233204548-233204570 CCCCGCCCACCCCGACGCCGCGG + Exonic
948321884 2:237076373-237076395 CTGAGCCCAGCCGGAAGCCGAGG - Intergenic
1169086182 20:2825096-2825118 CACCGCCCTCCCGGACGGGGCGG - Intergenic
1169093212 20:2873775-2873797 CGGAGCCCACCCGGGCGCAGCGG - Intronic
1172051437 20:32121941-32121963 CAGCTCCCTCCCGGACGGGGCGG + Intronic
1173221823 20:41137683-41137705 CGGCGCGCCCTCGGACGCCGAGG + Exonic
1174204261 20:48827791-48827813 CTGCGCCCACCCGGACCCCCGGG - Exonic
1175968479 20:62671901-62671923 CCGCGCCCACCCGGCCACGGCGG + Exonic
1176194533 20:63831161-63831183 CAGCGCCCTCCCGGCGGCGGCGG - Intronic
1178075742 21:29011968-29011990 CACCTCCCTCCCGGACGGCGCGG - Intronic
1178493762 21:33070522-33070544 CAGCGCCCGGCCGGACGCCAAGG + Exonic
1178916726 21:36709112-36709134 CAGCGCCCAGCCCGATGCCTGGG - Intronic
1180062471 21:45392767-45392789 CAGCCCCCACCTGGACGCAGGGG - Intergenic
1183702341 22:39457567-39457589 CGGCGCCCCCCAGGACGCCGGGG - Intronic
1183871381 22:40744793-40744815 CACCGCCCTCCCGGACGGGGCGG + Intergenic
1184242331 22:43217756-43217778 CAGCGCACACCCGCCCGCTGGGG + Intronic
1185258812 22:49850339-49850361 CAGCCCCCACCTGGACGCTCTGG + Intergenic
950253724 3:11487751-11487773 CAGCTCCCTCCCGGACGGGGTGG + Intronic
952942360 3:38454284-38454306 CCGCGCACACCCGGAGCCCGCGG - Exonic
956270426 3:67444087-67444109 CACCTCCCTCCCGGACGGCGCGG - Intronic
962770836 3:138608973-138608995 CTGCGCCCGCCCGGACGCCTCGG + Intronic
973907380 4:55546086-55546108 CAGCGCCCAATGGGGCGCCGGGG - Intronic
980130397 4:128811694-128811716 CAGCGGCCACCCCCGCGCCGCGG - Intronic
982615917 4:157637142-157637164 CACCTCCCTCCCGGACGGCGCGG + Intergenic
988291821 5:29296921-29296943 CAGAGCAGACCCGGAGGCCGAGG + Intergenic
989211355 5:38861933-38861955 CACCTCCCACCCGGACGGGGTGG + Intronic
990458914 5:56014737-56014759 CACCTCCCTCCCGGACGGCGTGG + Intergenic
990462074 5:56039057-56039079 CACCTCCCTCCCGGACGCGGTGG + Intergenic
994367268 5:98929511-98929533 CAGCCCCCGCCCGGACCCTGAGG - Intergenic
995379047 5:111512214-111512236 CCTCTCCCGCCCGGACGCCGGGG + Intronic
995787134 5:115842008-115842030 CAGTGCCCACCCGGTCGGCCCGG + Exonic
996329421 5:122312292-122312314 CAGGTCCCAAGCGGACGCCGCGG + Intronic
996948126 5:129094579-129094601 CACCACCCACCCTTACGCCGCGG + Intergenic
1000351289 5:160354866-160354888 CAGGGCCCACCCGGCCCCCCAGG - Exonic
1003908000 6:10720219-10720241 CTGCGCCCACCTGGAACCCGGGG + Intergenic
1005063321 6:21796898-21796920 CACCTCCCTCCCGGACGCGGCGG + Intergenic
1005722441 6:28616429-28616451 CGGCGGCCACCCGGTCACCGAGG + Intergenic
1005837600 6:29719615-29719637 CACCGCCCTCCCGGACGGGGCGG - Intergenic
1006141332 6:31931903-31931925 CACCTCCCTCCCGGACGGCGCGG + Intronic
1006634513 6:35452446-35452468 CAGCGCCGTCCCTGACGCGGCGG - Exonic
1008926201 6:56894238-56894260 CACCGCCCTCCCGGACGGGGCGG + Intronic
1012534725 6:100281781-100281803 CTCCGCCCACCCTGACGCAGGGG - Intergenic
1014763816 6:125388327-125388349 CACCGCCCTCCCGGACGGGGCGG + Intergenic
1019177266 6:170166510-170166532 CAGCGGGCACCCGGATGACGTGG - Intergenic
1019443217 7:1057775-1057797 CAGCGCCCACCGGGAGCTCGGGG - Exonic
1019524087 7:1472959-1472981 CAGCCCCCATCGGGACGCCTCGG + Intronic
1025198518 7:56948902-56948924 AAGCGCCGACCCGGACCCCTGGG - Intergenic
1025673433 7:63628031-63628053 AAGCGCCGACCCGGACCCCTGGG + Intergenic
1027373740 7:77533539-77533561 CACCTCCCACCCGGACGGGGCGG + Intergenic
1029525744 7:101092602-101092624 CACCTCCCTCCCGGACGGCGCGG - Intergenic
1029568537 7:101355901-101355923 TAGTGCCCACCCCGACGCCCAGG - Intergenic
1030093348 7:105876746-105876768 CCGCGCCCGCCCGCCCGCCGGGG + Intergenic
1030176517 7:106660473-106660495 CAGCGGCCGCCCGGGCTCCGCGG + Exonic
1030347951 7:108455278-108455300 CAGCGCCCACCCGCGCGGCGTGG + Intronic
1031986718 7:128168286-128168308 CAGCTCCCACCAGGCTGCCGAGG - Intergenic
1033253079 7:139777478-139777500 CAGCCCCCACCCGGGGCCCGAGG - Intronic
1034234153 7:149554722-149554744 CACCTCCCTCCCGGACGGCGCGG - Intergenic
1034440502 7:151083392-151083414 CCGCGCCCACCCCGCCGCCCAGG - Intronic
1034979816 7:155468373-155468395 CAGCGCGCGCCCGGACCGCGCGG - Intergenic
1035224287 7:157425036-157425058 CAGCGCTCACCCAGACACCCCGG + Intergenic
1037902199 8:22694765-22694787 CCGCGCCCACGCGGCCACCGAGG - Intergenic
1047781934 8:128118454-128118476 CACCTCCCACCCGGACGGGGCGG + Intergenic
1048981103 8:139703727-139703749 CAGCGCCCACCCGGGCGCGCGGG + Intergenic
1049610765 8:143553739-143553761 CAGCGCCCAGCTGGAAGCTGAGG + Exonic
1049756168 8:144312155-144312177 CAGGGGCCACACGGACACCGAGG + Exonic
1053425505 9:38007474-38007496 CAACTCCCACCCTGACGCCAAGG + Intronic
1061095797 9:128456282-128456304 CAGCGCCCTCCGGGGCACCGCGG + Intronic
1061823085 9:133239291-133239313 CAGCGCCCGCCCTTACCCCGGGG + Intergenic
1062105004 9:134750539-134750561 CAGGGCCCCCCTGGACGCCCAGG + Exonic
1203770011 EBV:45127-45149 CGGGGCCCACCCGGACGCCAAGG - Intergenic
1185866961 X:3632705-3632727 CAGCACTCCCCCGGACGCCTGGG + Intronic
1197981001 X:132217924-132217946 CCGCACCCGCCCGGCCGCCGGGG + Exonic
1198051467 X:132956702-132956724 TAGCGCGCACCCTGACGCCCGGG - Intronic
1200797035 Y:7350226-7350248 CAGCACTCCCCCGGACGCCTGGG - Intergenic