ID: 1145939509

View in Genome Browser
Species Human (GRCh38)
Location 17:28735225-28735247
Sequence GCTTCTATCCTGCAGGTGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145939498_1145939509 11 Left 1145939498 17:28735191-28735213 CCTGGTCTTCCCTCCCTGCAGGG 0: 1
1: 0
2: 4
3: 54
4: 404
Right 1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1145939495_1145939509 13 Left 1145939495 17:28735189-28735211 CCCCTGGTCTTCCCTCCCTGCAG 0: 1
1: 0
2: 3
3: 61
4: 543
Right 1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1145939500_1145939509 2 Left 1145939500 17:28735200-28735222 CCCTCCCTGCAGGGCTGTGATCC 0: 1
1: 0
2: 3
3: 34
4: 405
Right 1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1145939501_1145939509 1 Left 1145939501 17:28735201-28735223 CCTCCCTGCAGGGCTGTGATCCC 0: 1
1: 0
2: 7
3: 27
4: 346
Right 1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1145939503_1145939509 -3 Left 1145939503 17:28735205-28735227 CCTGCAGGGCTGTGATCCCAGCT 0: 1
1: 0
2: 4
3: 64
4: 426
Right 1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1145939496_1145939509 12 Left 1145939496 17:28735190-28735212 CCCTGGTCTTCCCTCCCTGCAGG 0: 1
1: 0
2: 4
3: 42
4: 499
Right 1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1145939502_1145939509 -2 Left 1145939502 17:28735204-28735226 CCCTGCAGGGCTGTGATCCCAGC 0: 1
1: 0
2: 4
3: 92
4: 481
Right 1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145939509 Original CRISPR GCTTCTATCCTGCAGGTGGT GGG Exonic
900573910 1:3373659-3373681 GCTTCTCTCCTGGGGGTGCTGGG + Intronic
902336034 1:15755534-15755556 ACTTCTATCCTTCATGTGGTAGG + Intergenic
902809666 1:18880912-18880934 GCCTTTATCCTGAAGGTGATGGG - Intronic
902956091 1:19924870-19924892 GCCTCTATCCTCCGGCTGGTTGG - Intergenic
903619673 1:24688835-24688857 CCTTTTATCCTGCAAGTGGGAGG + Intergenic
904121789 1:28203256-28203278 GGTTATATGCTTCAGGTGGTTGG - Intronic
904641327 1:31932734-31932756 GCTTCTTTCATGGAGGTGCTAGG + Intronic
906240351 1:44238804-44238826 GCATCTACCCTGCAGGAGGAGGG + Intronic
907869867 1:58433154-58433176 GCTTCTCTCATGAAGGTGGCAGG + Intronic
918561872 1:185878931-185878953 GCTTCTATCTTACAGGTGTTGGG - Intronic
922504369 1:226118112-226118134 GACTCTATCCTGTAGGAGGTGGG + Intergenic
922900128 1:229130170-229130192 GCTTCTGAGCTGCTGGTGGTGGG + Intergenic
1063123485 10:3121255-3121277 GCTTCTGTTCTCCTGGTGGTGGG + Intronic
1063288326 10:4713776-4713798 TCTTCTTTCCTGAAGGTGGAAGG + Intergenic
1064168963 10:13012576-13012598 GCTTATATACTGCTGGTGGGAGG + Intronic
1067826713 10:49579384-49579406 GTTTCTAGCCTGCCGGGGGTGGG + Intergenic
1073543080 10:104328112-104328134 GCATCCTTCCTGCAAGTGGTGGG - Intronic
1074732048 10:116389504-116389526 GCTTGTATCCTGCAGAAGCTGGG - Intergenic
1076364164 10:129911300-129911322 GCTTCTATCCAGCTGGCTGTGGG - Intronic
1077998756 11:7476104-7476126 GCTTCTTCCCTGCAGGTGAAGGG - Intergenic
1078556483 11:12331047-12331069 GCCTCTTTCCAGAAGGTGGTAGG - Intronic
1081691725 11:45082858-45082880 GCCTCTATTCTGCTGGTGGTGGG - Intergenic
1084877262 11:72142449-72142471 GCTTCTCTCCTGCAACTGCTAGG + Intergenic
1084882424 11:72181252-72181274 GCTTCTCTCCTGCAACTGCTAGG + Intergenic
1087864748 11:103210881-103210903 GATTCTAACTTGCAGGTGATAGG + Intronic
1088457719 11:110050206-110050228 GCATCCATCCTGCAGGTGACGGG - Intergenic
1093884392 12:24442826-24442848 GCTTTTATTCTGAAGGTGGCAGG + Intergenic
1094475130 12:30834904-30834926 GTTTCTCTCCTGCTGGAGGTGGG - Intergenic
1098493247 12:71106542-71106564 GCTTCTATCCTGGTGGTGTTGGG - Intronic
1098585094 12:72144935-72144957 GCTTCTATCCTGCCAGGGGCTGG + Intronic
1100017166 12:90024809-90024831 GCACCTATCCAGCAGGTGCTTGG + Intergenic
1100510419 12:95265947-95265969 GATTTTATCCTGCAGGCGATGGG + Intronic
1102185027 12:110941181-110941203 GATGCTATCCTGCAGGTGCCAGG - Intergenic
1102751996 12:115302920-115302942 GCTTCTCTCCTGGAGGTTTTGGG + Intergenic
1111779312 13:92701554-92701576 GATACACTCCTGCAGGTGGTTGG - Intronic
1111882631 13:93977030-93977052 GCTCCTAGCCTGCAGTTGGTGGG + Intronic
1112029956 13:95447903-95447925 GCTTTGATGCTGCAGGTGGGAGG - Intronic
1118342979 14:64911507-64911529 GATTTTATTCTGCATGTGGTAGG - Intergenic
1121302838 14:92885636-92885658 GATTTTATCCTGTAGGTAGTGGG + Intergenic
1123007716 14:105332452-105332474 GCCTCAGTCCTGGAGGTGGTCGG - Intronic
1124354712 15:28986160-28986182 GCTTCTCTCCTCCAGGAGGCAGG - Intronic
1124558654 15:30750387-30750409 TCTTCTTTCCTGCAGATGGATGG + Intronic
1124672597 15:31655243-31655265 TCTTCTTTCCTGCAGATGGATGG - Exonic
1130027588 15:80283196-80283218 GCTTCTCTCCTGCTGATAGTGGG - Intergenic
1130649917 15:85756646-85756668 GCCTCTCTCCTTCAGGAGGTGGG - Intergenic
1133881391 16:9785900-9785922 GCTTTTAAACTCCAGGTGGTGGG - Intronic
1134392378 16:13831553-13831575 GCTTCAACCCTGGAGGTGGAGGG - Intergenic
1135658101 16:24269132-24269154 CCTTTTAGCCTGCAGGTTGTAGG + Intronic
1136417222 16:30111618-30111640 ACTTGGATCCTGCAGGTAGTAGG - Intronic
1137407374 16:48200267-48200289 GGTGCTAACCTGCAGCTGGTGGG + Exonic
1137520834 16:49194084-49194106 GCTTTTTTCCTGCAGGTGATTGG + Intergenic
1139013824 16:62665520-62665542 GCTTCTATTCTCCATGTGGGCGG + Intergenic
1144686346 17:17228617-17228639 GCTTACCTCCTGCAGGGGGTCGG + Intronic
1145207431 17:20992043-20992065 CCCTCCATCCTGCTGGTGGTAGG - Intergenic
1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG + Exonic
1147214679 17:38892348-38892370 GCTTCTGTGCCGCAGGTGGGTGG - Intronic
1147772835 17:42879517-42879539 GCTTCTTTCTTGAAGGTGGAAGG - Intergenic
1150327522 17:64268818-64268840 GCTTGTATCTCGAAGGTGGTGGG - Intergenic
1150699169 17:67432928-67432950 GCTTATATTCTGGAGGTGGGAGG + Intronic
1151338135 17:73452413-73452435 TGTTCTATCATGTAGGTGGTAGG + Intronic
1152013613 17:77735603-77735625 CCTCCAGTCCTGCAGGTGGTCGG + Intergenic
1153227484 18:2909631-2909653 GCTTCTGTCCTCCAGGGGGAGGG - Intronic
1159278541 18:66252312-66252334 GCTAATATCCTGCAGTTGTTGGG - Intergenic
1160980228 19:1813223-1813245 GGTTCTTTCCAGCAGGTGGCAGG + Intergenic
1161794431 19:6378316-6378338 CCTTCTGTCTTGCCGGTGGTTGG - Intronic
1162771000 19:12949264-12949286 GGTTCTCTCCTGCTGGTAGTAGG - Exonic
1163747480 19:19056928-19056950 CCTGCTGTCCTGCTGGTGGTGGG + Intronic
1164486512 19:28660573-28660595 TCTTATAGGCTGCAGGTGGTTGG - Intergenic
1166517824 19:43460621-43460643 GGGTCTATCCTGCATGTGGGTGG - Intergenic
1167333210 19:48868900-48868922 GCTTGTGTCCTGCAAGGGGTGGG + Intergenic
925188126 2:1863560-1863582 GTTTCTATCCTTCCGGGGGTCGG - Intronic
925317039 2:2934384-2934406 GCTTCTCTCATGCAGATGGCAGG - Intergenic
926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG + Intergenic
928446752 2:31339670-31339692 CCATCCATCCTGCAGGTGGAAGG - Exonic
928716977 2:34072480-34072502 GCTTCTTTCTTGGTGGTGGTGGG + Intergenic
929570564 2:43020346-43020368 GCTTCTAGCCTGCACGAAGTTGG + Intergenic
932428641 2:71659907-71659929 GCATGTGTCCTTCAGGTGGTGGG + Intronic
933496479 2:83056327-83056349 GTTTCTCTCAAGCAGGTGGTAGG - Intergenic
940102134 2:150053485-150053507 GTATCTATCCTGCAGCGGGTGGG + Intergenic
941303819 2:163835706-163835728 CCTTCTTCCCTGAAGGTGGTCGG - Intergenic
942468136 2:176230435-176230457 TCTTCTATTCTGCAGGTAATGGG + Intergenic
942507692 2:176661056-176661078 GTTTCTATCCTGTAGGTGAATGG - Intergenic
943739112 2:191391540-191391562 GCATCTAGTCTGCAGGTGGGTGG + Intronic
943892574 2:193309244-193309266 GTTGCTATCCTGCATGTAGTTGG + Intergenic
947707116 2:232285318-232285340 GCTTGGAGCCTGCAGGTGCTAGG - Intronic
1168831708 20:848617-848639 ACTTCTATCATGAAGGTGGATGG + Intronic
1169010645 20:2247277-2247299 TGTTCTATCCTCCAGGTGGGAGG - Intergenic
1170497730 20:16942850-16942872 GCTTCTATTCTGCAGCATGTGGG + Intergenic
1172615668 20:36282088-36282110 GGCTCTATTCTGCAGGTGGCGGG + Intergenic
1172690356 20:36785553-36785575 GTTTACATCCTGCAGCTGGTCGG - Exonic
1172764084 20:37341821-37341843 GCTTCTGTCCTGGAGGTGGTGGG - Intergenic
1173712308 20:45170224-45170246 TCTTCTATTCTGTAGGTTGTTGG - Intergenic
1175202742 20:57289388-57289410 GCTTCTACTCTGCATGGGGTGGG - Intergenic
1175445719 20:59018178-59018200 CCTTCTGTCCTCCAGGCGGTGGG + Intergenic
1175576902 20:60067203-60067225 CCCACTCTCCTGCAGGTGGTGGG - Intronic
1176310718 21:5147531-5147553 GCCTCCATCCTGCAGGAGGCGGG - Intronic
1176952291 21:15063138-15063160 GCTACTGCCCTGCAGGTTGTAGG - Intronic
1177745687 21:25210640-25210662 ACTTCTATCCTGAAAATGGTGGG + Intergenic
1179840801 21:44071955-44071977 ACTTCCATCCTGAAGGAGGTGGG - Intronic
1179846337 21:44114504-44114526 GCCTCCATCCTGCAGGAGGCGGG + Intronic
1180123245 21:45768068-45768090 GCTTCTGTCTTGCAGGTGGCTGG + Intronic
1184187724 22:42876080-42876102 GCTTCCAACCTGCAGGCTGTGGG - Intronic
949494638 3:4620147-4620169 GCTTCTCTCCAGCAGGTGTCTGG - Intronic
950526979 3:13529959-13529981 GACTCCATCCTGAAGGTGGTGGG + Intergenic
953808092 3:46089080-46089102 TCTCCTATCCTGGAGGTGCTTGG + Intergenic
953960647 3:47263434-47263456 GCTGTTTTCCTGCAGGTGGCTGG - Intronic
954863944 3:53713087-53713109 GCTTCCCTCCTGAGGGTGGTGGG + Intronic
955685344 3:61543714-61543736 GTTTCTATCCTGGACTTGGTAGG - Intergenic
956648939 3:71485178-71485200 GGTTCTATCCTGCCTGTGATTGG + Intronic
959661958 3:108878986-108879008 GCTTTTACCCTGAGGGTGGTTGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961723072 3:128908803-128908825 GCTGCTCTCTGGCAGGTGGTGGG + Intronic
962904345 3:139788703-139788725 GCTTCTATAAGGCAGGGGGTGGG + Intergenic
964060017 3:152510127-152510149 GCCTTCATCCTGAAGGTGGTGGG - Intergenic
966669642 3:182512936-182512958 TCTTCTTTCCTGCACCTGGTAGG - Intergenic
967054748 3:185822823-185822845 GCTGCTATTCTGCTGGGGGTAGG + Intronic
967155537 3:186688338-186688360 GCTTCTTTCTTACAGGTGATCGG + Intergenic
969269298 4:6088183-6088205 GCTTCTATTCTGCTAGTGGGCGG + Intronic
970381041 4:15508103-15508125 GCTTCTGTCCCCCAGGTGGTTGG - Intronic
970526535 4:16938195-16938217 CCTTCTAGCCTGCAGGTAGTAGG - Intergenic
973788857 4:54360143-54360165 TCTTTGAGCCTGCAGGTGGTAGG + Intergenic
978126567 4:105143406-105143428 TTTTCTATTCTGCAGGTGGGAGG + Intergenic
979409029 4:120351515-120351537 GATTTTATCCTGAAGGTGATGGG + Intergenic
980126091 4:128775749-128775771 GGTTCTATTCTGCAGGTGCTGGG - Intergenic
982273999 4:153621334-153621356 GCTTCAGTCCTGCAGAAGGTAGG + Intronic
982506918 4:156230052-156230074 GCTGCTATTTTACAGGTGGTGGG + Intergenic
983961730 4:173762475-173762497 ACTTATATCCTGAAGGTGGGGGG + Intergenic
987411962 5:17623903-17623925 TATTCTATCCTGAAGGTGCTGGG - Intergenic
989190699 5:38667206-38667228 GCTTCTGTCCTCCAGGTGGCAGG - Intergenic
992559617 5:77937734-77937756 GCTTCTATCCTGCTCTGGGTAGG + Intergenic
993315381 5:86397974-86397996 CCTTCTATCCTTCATGTGCTTGG + Intergenic
993487845 5:88508415-88508437 GACTTTATCTTGCAGGTGGTAGG + Intergenic
994052404 5:95377863-95377885 CAATCTATCCTGCAGGTGATGGG - Intergenic
995318678 5:110805379-110805401 ACTTCTATCCAACAGTTGGTTGG + Intergenic
995759784 5:115551100-115551122 GCTTCTCTCTTGCAGGTTTTAGG + Intergenic
995875882 5:116789013-116789035 GCTGGTAACCTGCAGGTAGTTGG + Intergenic
999150985 5:149425928-149425950 GCTTCTCACGTGCAGCTGGTGGG - Intergenic
999830157 5:155311162-155311184 GCCTCTATCCTGTAGGAGGTGGG + Intergenic
1002288953 5:178186716-178186738 GCTTGTATGCTGCAGCTGGATGG - Intergenic
1002779278 6:353993-354015 GCTGCAATTCTGCAGATGGTGGG + Intergenic
1003569693 6:7247759-7247781 GCCTCCACCCTGCAGGTGGTGGG - Intronic
1006230770 6:32584505-32584527 GCTCCTGGGCTGCAGGTGGTGGG - Intronic
1006910204 6:37558643-37558665 GCCTTTATCCTGAGGGTGGTGGG + Intergenic
1007307672 6:40919480-40919502 GCTTCTATCCTTCAGGCGTGAGG + Intergenic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1007582942 6:42969980-42970002 GCCTTTTTCCTGCAGGTGGCGGG - Exonic
1008370685 6:50727076-50727098 ACTTCTAGCCTGAAGATGGTTGG + Intronic
1014473287 6:121842315-121842337 GCTTTTATCCTGAAGGCAGTAGG - Intergenic
1014727823 6:124993945-124993967 GCCTTTATTCTGCAGGTAGTGGG + Intronic
1015244382 6:131061668-131061690 GTTTCTATGCTGCAGGGGCTAGG - Intronic
1028605335 7:92649417-92649439 GCTTCTCTCATACAGGTGGTTGG + Intronic
1028606046 7:92656858-92656880 GCTCCTATCCTCCAGGTGTAGGG - Intronic
1030365155 7:108637393-108637415 ACTTCTCTCCAGCAGGTGGATGG + Intergenic
1031859716 7:126964693-126964715 GCTTTTACCCTGTTGGTGGTAGG + Intronic
1033245279 7:139712514-139712536 GCCTTTGTCCTGCAGGTGGTGGG - Intronic
1035579685 8:731860-731882 CCTTGTATCCTGCAGGTGCCTGG - Intronic
1037208090 8:16349724-16349746 GCTTATAGACTGCAGATGGTGGG - Intronic
1038394370 8:27236365-27236387 GCTTCCACCCTGCAGCAGGTGGG - Exonic
1042444842 8:68871853-68871875 GCTTCTCTCCTGCAGGAGGCAGG + Intergenic
1043525169 8:81088715-81088737 GCTTCTTTTCTGAAGGTGGGTGG - Intronic
1046234171 8:111400653-111400675 GCTTCTATTGTGCAGATGGTAGG + Intergenic
1046512602 8:115218318-115218340 ATTTCTATCCTACATGTGGTAGG - Intergenic
1047382285 8:124374205-124374227 ACTACTATTCTGGAGGTGGTTGG - Intergenic
1049785634 8:144449361-144449383 GCTTCTCACCTGGAGGAGGTGGG - Intergenic
1054805003 9:69389168-69389190 GCTTCATTGCTGCAGGTAGTGGG + Intronic
1054931927 9:70644168-70644190 GCTTACATCCTACTGGTGGTGGG + Intronic
1055733930 9:79308127-79308149 GCTTCTAAGCTGCAGGAGATGGG - Intergenic
1056204285 9:84305338-84305360 GCTTTTATGTTGCAGGTGTTTGG - Exonic
1056860940 9:90181082-90181104 GCTTCTCCTCTGCAGGTGGCAGG - Intergenic
1057320011 9:94004069-94004091 ACTCCTATGCTGCAGGTGCTGGG - Intergenic
1058284399 9:103157724-103157746 GCTTTTATCATGAAGGAGGTTGG + Intergenic
1061588401 9:131583175-131583197 GCTTCTCTCCTGCAGGGGTGGGG + Intronic
1186726083 X:12360259-12360281 GATTCTATCCTGAATCTGGTTGG + Intronic
1187030351 X:15480832-15480854 GATTTTATCCTGAAGGTGATGGG + Intronic
1187554794 X:20341440-20341462 TCTACTATCCTGGAAGTGGTAGG + Intergenic
1189516055 X:41714545-41714567 GCTTCTATTCTACAGATTGTGGG - Intronic
1193425417 X:81336678-81336700 GCTTCGATCCAGCAGGGGGAGGG + Intergenic
1193879828 X:86908376-86908398 GCTTGTATCCTTCATGTGGTAGG + Intergenic
1198432938 X:136586128-136586150 CATTCTATCCTGCTGGTGGCTGG + Intergenic
1200182165 X:154157160-154157182 GCCTGTAACCTGCAGGAGGTGGG - Intronic
1200187819 X:154194274-154194296 GCCTGTAACCTGCAGGAGGTGGG - Intergenic
1200193469 X:154231414-154231436 GCCTGTAACCTGCAGGAGGTGGG - Intronic
1200199224 X:154269218-154269240 GCCTGTAACCTGCAGGAGGTGGG - Intronic