ID: 1145939650

View in Genome Browser
Species Human (GRCh38)
Location 17:28736077-28736099
Sequence TGTCCTTTGTAGGACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 2, 1: 12, 2: 35, 3: 63, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145939650_1145939653 -2 Left 1145939650 17:28736077-28736099 CCATCCATGTCCTACAAAGGACA 0: 2
1: 12
2: 35
3: 63
4: 241
Right 1145939653 17:28736098-28736120 CATGAACTCATCATTTTTTACGG 0: 11420
1: 11014
2: 6118
3: 3796
4: 5412
1145939650_1145939654 16 Left 1145939650 17:28736077-28736099 CCATCCATGTCCTACAAAGGACA 0: 2
1: 12
2: 35
3: 63
4: 241
Right 1145939654 17:28736116-28736138 TACGGCTGCATAGTTTTCCATGG 0: 2
1: 374
2: 25580
3: 13840
4: 8179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145939650 Original CRISPR TGTCCTTTGTAGGACATGGA TGG (reversed) Intronic
902086951 1:13870280-13870302 TGTCCTTTGCAGGACACAGGAGG - Intergenic
904813219 1:33177505-33177527 TGTGCTTAGTAGGTCAGGGAAGG + Intronic
905495920 1:38386032-38386054 TCTACTTTGTAGGAGATAGAGGG + Intergenic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907642816 1:56208424-56208446 TTTCATTTGTAGGACATCAAGGG + Intergenic
908314297 1:62917750-62917772 TGTCCTTTCTAAAATATGGAAGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
914913121 1:151802375-151802397 TAGGCTTTGTAGGCCATGGAAGG + Exonic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915763990 1:158344428-158344450 TGCCCTTTATAGGACATGGATGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921298846 1:213730075-213730097 TGTTCTTTACTGGACATGGATGG - Intergenic
1062826520 10:572953-572975 TGTCCTTTGTAGGATATTCAGGG - Intronic
1064383207 10:14864626-14864648 TGTCCTTTGTAGGACGAAGCTGG - Intronic
1064491471 10:15861518-15861540 TGTACTTCCTAGCACATGGAAGG + Intergenic
1065294335 10:24260021-24260043 TGTCTCTTGTAGGAAATGGAGGG + Intronic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1065760941 10:28982907-28982929 TGTCCCTTGGAGCACATGAAGGG + Intergenic
1068081118 10:52318443-52318465 TGTGCTTTATTGGACATGGCAGG - Intergenic
1068811140 10:61257190-61257212 TGTCAGTTTTAGAACATGGATGG + Intergenic
1069935792 10:71915228-71915250 TGGCCTTAGCAGGACATGGGTGG - Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070208552 10:74289858-74289880 TCTCCTTTGTAGAAAAAGGAGGG + Intronic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1074026506 10:109641315-109641337 CATCATTTGTAGGAAATGGAAGG + Intergenic
1074306786 10:112286430-112286452 TTTCCTTTCTAGGAGATGGTGGG + Intronic
1074536279 10:114330404-114330426 TTTCCTCTGTAGGGCATGGCTGG - Intronic
1074733270 10:116400196-116400218 TGTCCTCTGAAGGACCTGGCTGG + Intergenic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1076318167 10:129557927-129557949 TGTCTTCTGTAGGAAATGAAGGG + Intronic
1078407175 11:11080536-11080558 TCTCCTTTTTAGCACATGGGCGG + Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078864670 11:15286185-15286207 TGTGCTTTGCAGGACATGAGAGG + Intergenic
1078941470 11:16011250-16011272 GCTCCTATGTAGGACATGTAAGG - Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079295740 11:19232017-19232039 TGTCCTCTGTGGGACACGGATGG + Intronic
1079920324 11:26425845-26425867 TGTACTTTGGAGTAAATGGATGG + Intronic
1081236879 11:40657385-40657407 TGTTCTCTGTAGGGCATGAAAGG + Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083319802 11:61838690-61838712 TGGCCTTTGAAGGACCTGCAGGG - Intronic
1083677794 11:64336705-64336727 TGTCCTTCGTGGGACATGGATGG - Intergenic
1083827893 11:65213534-65213556 TGTCCTCTGGAGGAAAGGGAAGG + Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085861058 11:80236549-80236571 TGTCCCTTGTAAGACACCGATGG + Intergenic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091186627 11:133653370-133653392 TGTCCTCTGTGGTGCATGGATGG - Intergenic
1091348666 11:134874774-134874796 AGTCCTTGGAAGGACATGGAAGG + Intergenic
1093084937 12:14856439-14856461 TGTCTTTTGGATGTCATGGATGG - Intronic
1093566720 12:20615295-20615317 TGTCCTGTTTAGGATATGGTGGG + Intronic
1093726518 12:22518030-22518052 TGTCGACTGTAGGACTTGGAAGG + Intronic
1094300352 12:28957808-28957830 TCTCCTTTGAAAGAAATGGAGGG - Intergenic
1096845972 12:54406839-54406861 TCTCCTTTCTAGGAAAAGGATGG - Intronic
1097419318 12:59354369-59354391 TGTCCTTTCAGAGACATGGATGG - Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1100442427 12:94629219-94629241 TGTTGTTTGTAGGACATTGTTGG - Intronic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105429827 13:20326492-20326514 TCCCCTTTGTAGGGCGTGGATGG - Intergenic
1106486304 13:30175761-30175783 TGTCCTTTTTTGGATATAGATGG - Intergenic
1107820281 13:44279778-44279800 TGTCCTCTGTAAGTCATAGATGG + Intergenic
1110072524 13:71195226-71195248 TGCACTTTATAAGACATGGATGG - Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110894433 13:80731566-80731588 TGTCTTTTCAGGGACATGGATGG - Intergenic
1111481196 13:88829200-88829222 TGACTTTTATAGGACATGAATGG + Intergenic
1111722638 13:91965649-91965671 TTTCCTTTGTAGGATATGACAGG - Intronic
1113307291 13:109092420-109092442 TGTCGTTTGTGGAACATGGATGG + Intronic
1113747124 13:112752914-112752936 TGTCCTTTGGAGTTAATGGAGGG + Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115487313 14:33923991-33924013 TGTTGTTTCTAGGATATGGAAGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1117901727 14:60540920-60540942 TGTCATTGGTAGGACAATGATGG + Intergenic
1118312850 14:64705766-64705788 CATCCTTTGTTGGACAAGGATGG + Intronic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119584819 14:75823403-75823425 TTTTCTTTGTGAGACATGGAAGG + Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1120328240 14:83055500-83055522 TGTCCTTTTTAGAACATGAATGG - Intergenic
1120963201 14:90143953-90143975 TTTGCTATGTAGGACTTGGACGG + Intronic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1123206307 14:106716631-106716653 TGTCCTTTGTAGGAACATGATGG - Intergenic
1123211388 14:106764040-106764062 TGTCCTTTGTAGGAACATGATGG - Intergenic
1123920719 15:25068002-25068024 TTTCCTCTGTATGACATAGACGG + Intergenic
1127585380 15:60373133-60373155 TATCCTTTGTAGGAGCTAGATGG - Intronic
1128849379 15:70937109-70937131 TGTCCTTTGTTTGACATTCACGG + Intronic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1131965222 15:97835020-97835042 TGTCATTAGTAAGACATAGATGG - Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1136068286 16:27773211-27773233 TATCCTTTGTAGGACAGGAGTGG + Intronic
1136528364 16:30848329-30848351 TGTCCTTTGTAGGCCAAGTAAGG + Intronic
1137519229 16:49177988-49178010 TGTTCTTTGTAGGAGTGGGAGGG - Intergenic
1139825729 16:69755764-69755786 TGTCTTCTTTAGGACATGAAGGG + Intergenic
1144239669 17:13297937-13297959 GGTCCTTTGTAGGAAATGAAGGG + Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1147996195 17:44361759-44361781 GTTCATTTGTAAGACATGGAAGG - Intronic
1150871561 17:68917497-68917519 TGTCTTTTCTTGGAAATGGATGG - Intronic
1151362455 17:73596775-73596797 TGTCATCTGGAGGCCATGGAGGG - Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1203172546 17_GL000205v2_random:162477-162499 TGTCCCTTGTTGGGAATGGACGG + Intergenic
1153316634 18:3729003-3729025 TTTGGTTTGTAGGACATGGGTGG + Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1153881778 18:9427492-9427514 TGCCCTTTGAAGGCCAAGGAAGG - Intergenic
1154268518 18:12899398-12899420 TGTCCTTTGTAGGCCAGAGCCGG + Intronic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157381138 18:47218622-47218644 TGTCCTTTGTAAAATAAGGAAGG + Intronic
1158123132 18:54072358-54072380 TGTCATTTGTAGAATATGAATGG - Intergenic
1159421669 18:68228750-68228772 TGTCCCAAGGAGGACATGGAGGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161076402 19:2287970-2287992 TGTCCTCTGGAGGATGTGGAGGG + Intronic
1161605216 19:5211064-5211086 TGGCCCTTGAAGGAGATGGAGGG - Intronic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1168354324 19:55692239-55692261 TGTGCCTTGGAGGACATGGGGGG + Intronic
925049091 2:797150-797172 TGTTATTTGTTGCACATGGATGG - Intergenic
928634146 2:33225884-33225906 TGTCATTTGTGTAACATGGATGG - Intronic
928643217 2:33322363-33322385 AGTCCTTTTTAGATCATGGAAGG + Intronic
928942689 2:36742538-36742560 TGTTCTATGTAGGATGTGGAAGG - Intronic
930180047 2:48346461-48346483 AGTCCATTGTATGACATAGAGGG + Exonic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931531605 2:63221005-63221027 TGTCCTTTGAGGGACAGGGATGG - Intronic
931779762 2:65568808-65568830 TGGCCTTTGCAGCACATGGGTGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932539765 2:72639538-72639560 TGTCCTTGTTTGCACATGGATGG - Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
935374405 2:102380196-102380218 AGTCCCATGTAGGTCATGGAAGG - Intronic
936925553 2:117732952-117732974 TTTCCCTTGTAGGACATGTCTGG - Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
937946085 2:127338635-127338657 TGTCCTTTCAGGAACATGGATGG - Intronic
941221179 2:162783443-162783465 CATCCTTTGTAGGACATGTTTGG + Intronic
942705655 2:178769074-178769096 TGTCCTGTATAGTACATGGAAGG - Intronic
944378885 2:199083106-199083128 TTCCCTTTGTAGGATATTGAAGG - Intergenic
944938214 2:204592124-204592146 TGACCTTTGTAGGAGATGGCTGG + Intronic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
946569944 2:221013571-221013593 TGGAGTTTGTAGGAAATGGAGGG - Intergenic
946947026 2:224831806-224831828 TGTCCTCTGGAGGTCCTGGAGGG + Intronic
947393144 2:229660424-229660446 TGTCCTTGCAGGGACATGGATGG - Intronic
947612720 2:231533706-231533728 TGTCCTTAGTAGGGTTTGGAAGG + Intergenic
948622255 2:239243756-239243778 TGTTAGTTGTAGGGCATGGAGGG - Intronic
948622262 2:239243801-239243823 TGTTAGTTGTAGGGCATGGAGGG - Intronic
1169596039 20:7200028-7200050 TTTCCATTCTAGGAGATGGAGGG + Intergenic
1170282260 20:14663170-14663192 TGTTCTTTGTAGGACAGGGATGG + Intronic
1170331314 20:15213829-15213851 TGTCCTTCCTAGGACATGGCTGG - Intronic
1171035917 20:21712990-21713012 TGTCCTATGGAGGGAATGGAGGG + Intronic
1171057622 20:21922753-21922775 TGTCCTTTGTAGGAACATGATGG - Intergenic
1171207331 20:23291102-23291124 GGCCATTTGTAGGACAAGGACGG - Intergenic
1172821572 20:37739742-37739764 TGTTCCTTTTAGGAGATGGACGG + Intronic
1173229890 20:41185870-41185892 TGTCCTTTGTGGGACAGAGCAGG - Intronic
1173833118 20:46105457-46105479 TTTCCTTTGTAGAACAAGGATGG + Intergenic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1177218562 21:18160637-18160659 TGTCCTTGCAGGGACATGGATGG - Intronic
1182519162 22:30875705-30875727 TGTACTTTGTGGGCCTTGGAAGG + Intronic
1183492367 22:38123388-38123410 TGTCCTATGCAGGACAGCGAGGG + Intronic
1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG + Intergenic
951761602 3:26153225-26153247 AGTCCTTGGTGGGACATGGGAGG + Intergenic
952685296 3:36141063-36141085 TGTCCTTTGTCAGACGTGAAGGG + Intergenic
953483219 3:43270432-43270454 GGTCCTTGGTAGGAGATGGGAGG + Intergenic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
955125694 3:56109324-56109346 TGTCTTTTGTGGAACATGGATGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957260787 3:77898410-77898432 TGACCTTAGTAGGAGTTGGAGGG + Intergenic
957482732 3:80819356-80819378 TGTCCTTTGTGCAACATGGATGG + Intergenic
959398395 3:105869169-105869191 TGTACTGTGGAGGACGTGGACGG - Intronic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
964344398 3:155741487-155741509 TGTCATTCCTAGGACATAGACGG - Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
970836104 4:20409373-20409395 TGTCCTTTTAGGGACATGGATGG - Intronic
971150746 4:24029094-24029116 TTCTCTTTGTAGGACACGGAGGG - Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972310338 4:37876277-37876299 AGTCCTATGTGTGACATGGAAGG - Intergenic
972327947 4:38035813-38035835 TTTCCTTTGTTGCACATAGAGGG + Intronic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
972986729 4:44774220-44774242 TGTCCTTAGGATGACCTGGAGGG - Intergenic
973741699 4:53925045-53925067 TGTCATTTCTAGGACATGAGAGG + Intronic
974337151 4:60563968-60563990 AGTCATTTGTACAACATGGATGG - Intergenic
975398816 4:73910098-73910120 TGTCCTTGTAGGGACATGGATGG + Intergenic
975889090 4:79003447-79003469 TGTCCTTTCAGGGACATGGATGG + Intergenic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
979141186 4:117176726-117176748 TGTCCTCTGATGAACATGGATGG - Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
982304645 4:153917772-153917794 TGTCATTGGTAGGAAAGGGAAGG + Intergenic
982803797 4:159737403-159737425 TGTTCTTTGTGGAACATTGATGG + Intergenic
982971650 4:161995923-161995945 TGGCCTTTTTAGGACACTGATGG - Intronic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983462341 4:168043008-168043030 TGTACTTTGCAGCACTTGGATGG + Intergenic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
984845536 4:184104994-184105016 TGGGCTTTGAAGGACAGGGAGGG + Intronic
986706049 5:10455603-10455625 TATCCTGTGCAGGACAGGGATGG - Intronic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
991931366 5:71756118-71756140 TGTCTTCTGTAGGATCTGGATGG + Intergenic
992994755 5:82321718-82321740 TGTCCTCTGTAGGCTATGGGTGG + Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993731610 5:91429334-91429356 TATCCTTTGTAGAACATGGGTGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
994803897 5:104418115-104418137 TGTCCTTGCAAGAACATGGATGG + Intergenic
994971426 5:106744526-106744548 TGTCTTCTATAGGACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
995997380 5:118318330-118318352 TGTCCTTTTTAGCATATGTATGG - Intergenic
996951925 5:129137364-129137386 TGTCTTTGCAAGGACATGGATGG + Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998415756 5:141945160-141945182 AGTCTTTTGGAGGACAGGGACGG - Exonic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
999240617 5:150125295-150125317 TGTACATAGTAGGAGATGGAGGG + Intronic
999939221 5:156522423-156522445 TGCCCTTTTCAGGACATAGATGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001178895 5:169499782-169499804 TGTCCTTTGTGCAACATGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1003740886 6:8937684-8937706 TGTCCTTGCAGGGACATGGATGG - Intergenic
1003945080 6:11067730-11067752 TCTCCTTTCTAGTACTTGGAGGG + Intergenic
1004247001 6:13988021-13988043 TGCCCTTAGGAGGACAGGGAAGG - Intergenic
1004534827 6:16490519-16490541 TGACCTTTGGAGGAGAAGGAAGG - Intronic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1006016437 6:31085021-31085043 TGCCCTTTGAAGGAACTGGATGG + Intergenic
1008098064 6:47360470-47360492 TGTCTTTTGAAGGAATTGGAAGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1011732082 6:90275053-90275075 TTTCCTTTGTAGGACAATGTGGG - Intronic
1013507280 6:110814016-110814038 TGTCCTTTCTTGGTCCTGGAGGG - Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014295744 6:119614809-119614831 TGCACTTAGTAGGACAAGGAAGG + Intergenic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1016633835 6:146264838-146264860 TGTCTTTTGTGCAACATGGATGG - Intronic
1017757028 6:157538556-157538578 TGTCCTTTGTAGCACCTAGCAGG - Intronic
1018573969 6:165238596-165238618 TGTCCTTTGTGCAGCATGGATGG - Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1019325292 7:435267-435289 TGTCTTCTGTGTGACATGGAGGG - Intergenic
1021199500 7:17712350-17712372 TGCCCTTTGCGGGACATAGATGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1025114705 7:56247767-56247789 TATCATTTGTAAAACATGGAGGG - Intergenic
1025909120 7:65813243-65813265 GCTCTTTTGTAGGACAGGGATGG - Intergenic
1027175091 7:75898279-75898301 TGTCCTTTCTAGGATAAGGGAGG - Intergenic
1027777461 7:82484618-82484640 AGTCCTTTGGAGGACAAGGCAGG - Intergenic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1031388807 7:121187500-121187522 TGTGCTTTGTAGGTGATGGCAGG + Intronic
1031562987 7:123260626-123260648 TGTCCTTCTAAGGACAAGGAAGG - Intergenic
1031974660 7:128086069-128086091 GGGCCTCTGTAGCACATGGAGGG + Intronic
1032081547 7:128861002-128861024 TGGCCTGTGCAGCACATGGATGG - Intergenic
1032087841 7:128893066-128893088 TGTCCTGGGAAGGACAGGGATGG - Intronic
1033243261 7:139698656-139698678 TGACCTTTGTAGCTCATGAAAGG + Intronic
1033737207 7:144234309-144234331 TATCCTTTGATGGACATGGATGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1034937880 7:155211437-155211459 TGGCCTTTGCAGGTCATGGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1036229167 8:6984902-6984924 TGTCCTCTGTTGCCCATGGAGGG + Intergenic
1036231620 8:7004007-7004029 TGTCCTCTGTTGCCCATGGAGGG + Intronic
1036387989 8:8298397-8298419 TGTGCTTTGTAGGAGATGTGAGG - Intergenic
1037268298 8:17094010-17094032 TATCTTTTGAAGGACATTGAGGG - Intronic
1038530925 8:28317474-28317496 TCTCCTTTGTAGCGCTTGGATGG + Intronic
1039300930 8:36207762-36207784 TGGCCTTTGTATGACATTGCTGG + Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1041632139 8:60100002-60100024 TTTCCTTTCTACCACATGGATGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1044927455 8:97221692-97221714 TGTCCTTTTAAGGACAGGGGAGG + Intergenic
1045768000 8:105699194-105699216 TTTCCTTTGTAATAAATGGAGGG + Intronic
1046390781 8:113569543-113569565 TGTCATTTTTAAGACATGGTTGG + Intergenic
1048078295 8:131097389-131097411 TGTCTTTGCAAGGACATGGATGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048283760 8:133125136-133125158 TCTCATTTCTAGGACCTGGAAGG - Intronic
1048325616 8:133436817-133436839 TGTCCTTTGTTGGACTTTGAAGG - Intergenic
1048508764 8:135043713-135043735 TGTCCTCTGTAGGAGAGGGGTGG - Intergenic
1049086035 8:140479313-140479335 TGTCTTTTCAGGGACATGGATGG + Intergenic
1049442385 8:142615280-142615302 TGGGGTTTGGAGGACATGGAGGG + Intergenic
1050419332 9:5446935-5446957 TGTCCTTTCAAGGAAATGGTGGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051612053 9:18970761-18970783 TATGCTTTTTATGACATGGATGG + Intronic
1052572080 9:30239617-30239639 TGTCCTTCGTTGTACATGAATGG - Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053049232 9:34945062-34945084 TGTCATTTGGAAGACATGGGGGG - Intergenic
1055285620 9:74725268-74725290 TAACCTTTGTAAGACATGTACGG + Intronic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056739480 9:89241781-89241803 TGCCCTTTTTAGACCATGGAGGG - Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1057980406 9:99655852-99655874 TGTCATTTGTGCAACATGGATGG + Intergenic
1058234177 9:102468524-102468546 TGTCCTTTGAGGGACGTGGACGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059003349 9:110374292-110374314 TGTTCTTTGTGGAATATGGATGG - Intronic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1060446370 9:123691990-123692012 TGTCCATTGTGAGACATGGCAGG + Intronic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186115694 X:6303181-6303203 TGTCTTTTCAGGGACATGGATGG - Intergenic
1186240226 X:7557468-7557490 CGTTCTTTGTAGGGCATGGTGGG + Intergenic
1186927158 X:14346785-14346807 TGTCATTTGTAAAACATGGATGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1188419141 X:29975183-29975205 TGTCATTTGAACAACATGGATGG - Intergenic
1188909176 X:35824296-35824318 TGTCTTTTGTAGAATATGGATGG - Intergenic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1190373915 X:49769975-49769997 TGTCCTTTGTGGGATATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1191991032 X:67037251-67037273 TGTCCTTTGTGGAACTTGGATGG + Intergenic
1192275757 X:69629278-69629300 TGAGCTTTGAAGGACCTGGAGGG - Intronic
1192326596 X:70137669-70137691 TGTCCTTTGTAAGAAGTTGAGGG + Intronic
1192458924 X:71300799-71300821 TGTCTTCTTTAGGACATGAAGGG - Exonic
1193739531 X:85201768-85201790 TTTCTTTTGTGGAACATGGATGG - Intergenic
1193877172 X:86874399-86874421 TGTCCTGTGCAGGACACAGATGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195213602 X:102674448-102674470 TGTCCTTTCAGGGACATGGATGG - Intergenic
1195890281 X:109685899-109685921 TGCCCTTTGAAGTTCATGGATGG - Intronic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1198272207 X:135065606-135065628 TGTCCTTTTTAGAACATGGTTGG - Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1200821564 Y:7589296-7589318 TTTCCACTGTAGGACATGGGTGG - Intergenic
1201537193 Y:15063406-15063428 TGTAGCTTGCAGGACATGGATGG - Intergenic
1202238740 Y:22743458-22743480 TTTCCACTGTAGGACATGGGTGG + Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic