ID: 1145940702

View in Genome Browser
Species Human (GRCh38)
Location 17:28742010-28742032
Sequence GAGGAGAAGCAATATCAGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145940702_1145940707 8 Left 1145940702 17:28742010-28742032 CCACCCTGATATTGCTTCTCCTC 0: 1
1: 0
2: 2
3: 25
4: 265
Right 1145940707 17:28742041-28742063 CTGAAAAGTGCAGGTGCCCAAGG 0: 1
1: 0
2: 1
3: 13
4: 239
1145940702_1145940706 -1 Left 1145940702 17:28742010-28742032 CCACCCTGATATTGCTTCTCCTC 0: 1
1: 0
2: 2
3: 25
4: 265
Right 1145940706 17:28742032-28742054 CTGAATGCTCTGAAAAGTGCAGG 0: 1
1: 0
2: 0
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145940702 Original CRISPR GAGGAGAAGCAATATCAGGG TGG (reversed) Exonic
900361103 1:2289522-2289544 CAGGAGAACCAAGATCGGGGTGG + Intronic
900700232 1:4043735-4043757 GAGGAGAAGCAGCATCAGCATGG - Intergenic
900771552 1:4548723-4548745 GAGAAGAAGCATTATCAAAGAGG + Intergenic
900876271 1:5344938-5344960 GAGGAGAAGAAATGTCAGATTGG - Intergenic
900979910 1:6040491-6040513 GAAGAAAAGCAAAATAAGGGAGG - Intronic
901755981 1:11441860-11441882 GAGGAGGAGGAAGATGAGGGAGG + Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
903536811 1:24072229-24072251 GAGAGGACGCAATCTCAGGGTGG - Intronic
904004719 1:27357706-27357728 GAGCAGAAGCAAGAGCAGGTGGG - Exonic
904314444 1:29651190-29651212 GAGGAGACGCGATCTCATGGTGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
907705533 1:56829177-56829199 GAGGAGGAGGAAGAGCAGGGAGG - Intergenic
907711827 1:56890289-56890311 GGGGTGGAGCAATATCAGAGCGG - Intronic
908332853 1:63087808-63087830 GAGAAGAAGCAACATTAGAGGGG - Intergenic
908809016 1:67960091-67960113 GAGGAGCAGCAGGATCAGGAGGG - Intergenic
909470989 1:76027878-76027900 AAGGAGAAGCCAAATCAGAGTGG + Intergenic
909681038 1:78292546-78292568 GAGGAGAAGGGACATCTGGGTGG + Intergenic
909764206 1:79334371-79334393 GAGGAGCAGCAACTTTAGGGCGG + Intergenic
910881277 1:91924333-91924355 GAAGAGAAACAATAAAAGGGTGG - Intergenic
911362398 1:96895011-96895033 GAGCTGAAGCAGGATCAGGGTGG + Intergenic
911452380 1:98080007-98080029 GAGCAGAAGGAGTATCAGAGAGG - Intergenic
911988092 1:104657342-104657364 GAGGAGAAGAAAAAGTAGGGAGG - Intergenic
912315783 1:108666674-108666696 GAGGGGGAGCAAAAGCAGGGAGG - Intergenic
914244620 1:145876445-145876467 GAGGAGAAGGAAGAGAAGGGTGG + Intronic
916415381 1:164587858-164587880 GATGAGAAGGAGGATCAGGGAGG - Intronic
916455255 1:164964582-164964604 GAGCAGAAGCATTATCATGGTGG - Intergenic
916679393 1:167090281-167090303 GAGAAGAAGCAAGACCATGGTGG - Exonic
917722096 1:177795650-177795672 GAAGAGAAGCCAGATCATGGAGG - Intergenic
918929298 1:190833581-190833603 GAGGAGAATCTATCTCAGGGAGG - Intergenic
920526664 1:206672116-206672138 GAGGAGAAGCGGTGGCAGGGAGG - Intronic
920977654 1:210801089-210801111 CAGCAGCAGCAATTTCAGGGAGG + Intronic
922685277 1:227633983-227634005 GAGGAGAAGGAAGAGCGGGGAGG + Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
1063241236 10:4171332-4171354 GAGGAAAAGTAAAACCAGGGTGG + Intergenic
1065193088 10:23233199-23233221 GAAGAAAAGCACTATCAGAGAGG + Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067709511 10:48636929-48636951 GGGCAGAAGACATATCAGGGAGG + Intronic
1068999152 10:63244161-63244183 AAGGAGATGCCATATCAGAGTGG + Intronic
1070961473 10:80502922-80502944 GAGGAGGAGGAAGAGCAGGGAGG + Intronic
1073629232 10:105131769-105131791 GAGGAGAAGCAAGAGAAGAGAGG + Intronic
1074985257 10:118652574-118652596 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1077655723 11:4017044-4017066 GAGGACAAGCCAAAGCAGGGTGG - Intronic
1079061332 11:17251531-17251553 GAGGAGAAGACAGGTCAGGGAGG + Intronic
1079262616 11:18897830-18897852 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1080275620 11:30500284-30500306 GAGGAGAGGAAATATCAGAGAGG - Intronic
1080740347 11:35058051-35058073 GATGAGAAACACTATGAGGGAGG + Intergenic
1081251110 11:40835142-40835164 GAGGGAAAGAAATATCAGGATGG - Intronic
1081767103 11:45619009-45619031 CAGGAGAAGCAAGCTCAGGTAGG + Intergenic
1082738944 11:56889117-56889139 CAGGAGAAATAATTTCAGGGTGG - Intergenic
1083254944 11:61490135-61490157 GAGGAGGAGCCATCTGAGGGAGG - Intronic
1084848046 11:71916263-71916285 AAAGAGAAACAAAATCAGGGGGG + Intronic
1086303272 11:85452906-85452928 AAAGAGAAGCAACTTCAGGGAGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1087135774 11:94717325-94717347 CAGGAAAAGCAATATGAGAGAGG + Intronic
1087212906 11:95461521-95461543 GTAGAGTAGCAATATGAGGGTGG + Intergenic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1092084689 12:5746312-5746334 GAGGAGAATCCATACCATGGTGG - Intronic
1092970258 12:13686988-13687010 GAGAAGAAGCAAGGTCGGGGAGG - Intronic
1093317382 12:17667671-17667693 GAAGAGAAGCAATGACAGTGTGG + Intergenic
1094515690 12:31123894-31123916 AATGAGAAACAATATCAGTGGGG + Intergenic
1095227467 12:39694858-39694880 GAGGAGAAGGAATAGTGGGGAGG + Intronic
1098443917 12:70546790-70546812 GAGGAGAAGCAGTCCCAGGGAGG + Intronic
1101509664 12:105381267-105381289 GAGGTAAAGCAAAATCAGTGTGG - Intronic
1101645526 12:106627809-106627831 GAGAAGAAGGAAGTTCAGGGTGG + Intronic
1106862796 13:33928818-33928840 GAAGAGAACCAATGTCTGGGGGG + Intronic
1107026796 13:35810017-35810039 AAGCAGAAGGAATAACAGGGTGG - Intronic
1111235837 13:85406336-85406358 GAAGAGAAGCAGTAGCTGGGTGG - Intergenic
1114988013 14:28253386-28253408 GAAGAGAGGGAATAGCAGGGAGG - Intergenic
1115003136 14:28444957-28444979 GAGGAAAATAAATATTAGGGCGG + Intergenic
1115546018 14:34465374-34465396 GAGGATAAGCAAAATAAGGAAGG + Intergenic
1116514009 14:45784459-45784481 AAGGAGATGCCATATCAGAGTGG - Intergenic
1116745595 14:48814566-48814588 GAGGAGAAGCCAAATAAGAGTGG + Intergenic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118214031 14:63791287-63791309 GAGGAGGATCAATTTCAAGGAGG - Intergenic
1118582705 14:67319272-67319294 CAGGAGAAGTAATATGAGTGAGG + Intronic
1119009727 14:70972234-70972256 GAGGAGGAGCAGATTCAGGGTGG + Intronic
1119640176 14:76308871-76308893 GAGGAGAAAGAAAATCATGGAGG + Intergenic
1119707515 14:76793444-76793466 GAGGAGAAGGAAGAAGAGGGAGG + Intronic
1122846553 14:104503217-104503239 GAGAAGAAGCAAGATGGGGGAGG - Intronic
1125521168 15:40348524-40348546 GAGGAGACGGGAGATCAGGGAGG - Intergenic
1127113777 15:55703244-55703266 GAAGAGTAGAAATATCAGTGTGG - Intronic
1127732327 15:61812349-61812371 GCAGAGAAGCAATATCAAGCAGG + Intergenic
1128609981 15:69065595-69065617 GAGAGGAAGCAAGGTCAGGGTGG + Intergenic
1129480825 15:75824305-75824327 CAGGAGAAGGGATATCTGGGAGG - Intergenic
1129892418 15:79080214-79080236 GAGGAAAGCCAATATCAGGTGGG - Intronic
1130287842 15:82570591-82570613 AAGCAGAAGCAATTTAAGGGGGG + Intronic
1130404540 15:83586243-83586265 GAGGAAAAGCAATCTAAGGAAGG - Intronic
1131105688 15:89732763-89732785 GGGGAGAAGCAAGAGCATGGAGG - Intronic
1131317512 15:91352934-91352956 GAGAAGAGGCAAGAGCAGGGAGG - Intergenic
1131341500 15:91606466-91606488 GAGTAGAAGAAATAACAGAGAGG + Intergenic
1131348119 15:91670402-91670424 GAGCAGAAGAAATAACAGGAAGG - Intergenic
1131514050 15:93065831-93065853 GAGGGGCAGCAACAGCAGGGAGG - Intronic
1133991304 16:10709659-10709681 TATGAGAAACAATATCACGGGGG + Intergenic
1138022533 16:53497552-53497574 GAGGAGAAGGCCTAGCAGGGAGG - Intronic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138914742 16:61450085-61450107 GAGAAAAAGCAATAGAAGGGAGG - Intergenic
1139363047 16:66414922-66414944 AAGGAGAAGCTATATCATGTAGG - Intergenic
1140646679 16:77038744-77038766 GAGGAGAAACAATAGTGGGGAGG - Intergenic
1140757319 16:78079498-78079520 GAGGACTAGCTAAATCAGGGAGG + Intergenic
1142315208 16:89339794-89339816 GAGGAGCAGCCACAGCAGGGTGG - Intronic
1142832316 17:2558363-2558385 GAAGAGAAGAAAGACCAGGGTGG + Intergenic
1145940702 17:28742010-28742032 GAGGAGAAGCAATATCAGGGTGG - Exonic
1146320963 17:31846092-31846114 GAGGAGAAGGAAGACCAGGTGGG - Intergenic
1146644198 17:34565907-34565929 GAGGAGAAACAAGATAAGGAAGG + Intergenic
1147403010 17:40192174-40192196 AAGGAGAAGGGATATCAGAGTGG - Intronic
1151728572 17:75898115-75898137 GAGGAGAAGCCACATTAGGTAGG - Intergenic
1152166280 17:78709457-78709479 GAGGAGATGCAGTGTCAGAGAGG - Intronic
1152491075 17:80635140-80635162 GAGGAGCAGCAATGGCAGAGAGG - Intronic
1156368508 18:36451601-36451623 GAGGAGAAGGAAGAGGAGGGAGG - Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158399116 18:57104800-57104822 GAGGGCAAGCAAAAGCAGGGTGG - Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1161111657 19:2474397-2474419 GAAGATAAGGAAGATCAGGGAGG - Intergenic
1162707833 19:12568772-12568794 GAGGAGGAGCCACATCAGGATGG + Intronic
1163641234 19:18463269-18463291 GAGGAGGAGCAACCTGAGGGGGG + Intronic
1164503009 19:28835073-28835095 GAGGAAAAGCATTTTCAGGGTGG + Intergenic
1165566130 19:36729904-36729926 GAGGAGATGCAAAATCAGTGTGG + Intronic
1165694324 19:37889055-37889077 GAGGAGAAACTACATCAGGCTGG - Exonic
1166059991 19:40320220-40320242 GAGGAGAAGGAATGGCTGGGAGG - Exonic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166814063 19:45531509-45531531 GAGGAGGAGCAGTATGAAGGAGG - Intronic
925678225 2:6388780-6388802 GAGCAGGAGCAAGGTCAGGGTGG + Intergenic
926361610 2:12093171-12093193 AAGGAGAAACAATTCCAGGGGGG - Intergenic
927174069 2:20393016-20393038 GAGGAGAGACAATATTAGTGCGG + Intergenic
927266420 2:21157574-21157596 GAGCAGAAGCATTGTTAGGGTGG - Intergenic
927597553 2:24409944-24409966 GAGGAGGAGCTATATCATGTAGG + Intergenic
929015007 2:37485221-37485243 GAGGAGAAGGAATATGGAGGAGG - Intergenic
931241558 2:60457902-60457924 GATGAGAAGCCATATAATGGCGG - Exonic
932949235 2:76273194-76273216 TGGGGGAAGAAATATCAGGGAGG - Intergenic
933304255 2:80577592-80577614 GAGCAGAAGCAAGATCAGTTAGG + Intronic
933942669 2:87257831-87257853 GAGCAGAAGCATTGTCAGGGTGG - Intergenic
935165762 2:100567463-100567485 GAGGAGAAGCAGGCTCAGAGAGG + Intronic
935613097 2:105046603-105046625 GAGGAGGAGCAAGATCAGGGAGG - Intronic
936337553 2:111603731-111603753 GAGCAGAAGCATTGTCAGGGTGG + Intergenic
936919801 2:117676263-117676285 GAGCAGAAGCAAGAGCAGTGGGG + Intergenic
937016101 2:118607477-118607499 GAGGAGCAGCAATAGCATGATGG - Intergenic
938671351 2:133589387-133589409 CAGGAGAAGCAGTTTCACGGGGG + Intergenic
939276156 2:139999043-139999065 GAGGAGAAGAAATATTATGAAGG - Intergenic
939759711 2:146159412-146159434 CAGGAGAAGAAATTTCAGGATGG - Intergenic
940369302 2:152882344-152882366 GAGCAGAAGCATTGTCATGGTGG + Intergenic
942371776 2:175293417-175293439 GAGTAGAGGCAATAGCAAGGTGG - Intergenic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943513952 2:188862139-188862161 GAGAAGAAGGAATACCAGTGTGG + Intergenic
944382171 2:199123801-199123823 GAGCAGAAGCATTGTCATGGTGG + Intergenic
945144254 2:206720196-206720218 GAGCAGAAGCAGTGTCATGGAGG - Intergenic
945571784 2:211477093-211477115 GAGGCCCACCAATATCAGGGAGG - Intronic
947159503 2:227197963-227197985 CAGGAGAAGCAATATATTGGAGG - Intronic
947859037 2:233345737-233345759 AAGGAGAAGCGACATCAGAGGGG + Intronic
948052660 2:234990410-234990432 GAGGTGAAGCAATGTTAGGCTGG - Intronic
1171826345 20:29912777-29912799 GAGCAGAAGCATTATCAGAAAGG + Intergenic
1172474206 20:35225682-35225704 GAGGAGAGGGCATTTCAGGGAGG - Intergenic
1172885201 20:38226356-38226378 GAGTAGCAGGAATATCAGGTGGG - Intronic
1173317629 20:41959338-41959360 GAGGAGAAGCTAAGTCAGGGAGG + Intergenic
1174606433 20:51765253-51765275 CAGGAGTAGCAACATCAAGGTGG - Intronic
1175313057 20:58025118-58025140 GAGGAGAGGCAGTTTCGGGGTGG + Intergenic
1179939326 21:44628006-44628028 GAGGAGAAGCTGTAGCAGGCCGG - Exonic
1180878670 22:19187976-19187998 GAGGAGGAGGACTATCAGGTGGG - Exonic
1181622504 22:24100672-24100694 GAGGAGAAGCAGTCACGGGGAGG + Intronic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1183689300 22:39379289-39379311 GAGGGGAAGCACTTTCTGGGAGG - Intronic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
951441504 3:22728682-22728704 GAAGGAAAGCAATAACAGGGAGG - Intergenic
952701043 3:36328043-36328065 GGTCAGAAGCAATATCATGGGGG + Intergenic
954971420 3:54654600-54654622 GGGGAGAAGCTCTATCAGGCTGG + Intronic
955330709 3:58044768-58044790 GAGCAGAGGCAAGTTCAGGGGGG - Intronic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957006899 3:74959211-74959233 GAGAGGAAGGAATAGCAGGGGGG + Intergenic
959144596 3:102529677-102529699 GAGGAAAAACAACATCAGGTCGG - Intergenic
959725081 3:109533626-109533648 GAGGAGAAGGAAAAGCAGGGAGG - Intergenic
959927930 3:111945717-111945739 AAGGAGAAGCAAAATAAGAGAGG - Intronic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
962070589 3:132029565-132029587 GGGGAGGAGCAAAATCAGGCTGG - Intronic
963618460 3:147573178-147573200 GAGGAGGAGCCATTTCAGGATGG + Intergenic
965135984 3:164768810-164768832 GAGGAGCAGCAATGTCATAGAGG + Intergenic
965209647 3:165768422-165768444 GAGGAGAGGCAAGAATAGGGAGG - Intergenic
966985688 3:185178336-185178358 GAGGAGAGGCAATAATAGGTTGG + Intergenic
968138311 3:196235388-196235410 GAAGAGAAAAAATATGAGGGAGG - Exonic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
969533185 4:7740686-7740708 GTGAAGAAGCAAAGTCAGGGAGG - Exonic
969875954 4:10135689-10135711 TAGGAGAAGCATTCTCAAGGTGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970827894 4:20298878-20298900 GAGCTGAGGCAATATCAGAGAGG + Intronic
972287519 4:37663098-37663120 GAGGAAAAGCAATACCCGTGGGG + Intronic
976300284 4:83509727-83509749 GAGGAGAAAGGCTATCAGGGCGG + Intronic
977120158 4:93090110-93090132 GAGGAGTGGCAATCTCACGGGGG - Intronic
978028791 4:103912423-103912445 AAGGAGATGGAGTATCAGGGAGG - Intergenic
979060724 4:116057927-116057949 GAGTAGAAAAAATATCAGAGAGG - Intergenic
979704231 4:123702025-123702047 GAGGAGGAGCAGGGTCAGGGTGG + Intergenic
980073718 4:128270698-128270720 TAGGAGAAGGAATTTCAGGTGGG - Exonic
980709358 4:136544097-136544119 GAGGGTAACCAATATCAGGAAGG - Intergenic
980826559 4:138080684-138080706 GAGGAAAGGCAAGATCAGGGTGG - Intergenic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981945366 4:150336565-150336587 GGGGAGAAGGAAAATTAGGGAGG + Intronic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
983782848 4:171694379-171694401 AAGAAAAAGAAATATCAGGGAGG - Intergenic
987799014 5:22668837-22668859 GAGGAGAAGAGATAAAAGGGTGG - Intronic
989586036 5:43074479-43074501 GAGGAGAAAGACAATCAGGGTGG + Intronic
989995113 5:50819852-50819874 GAGTAGAAGGAATGTGAGGGTGG + Intronic
990023360 5:51155833-51155855 GACAAGAAAAAATATCAGGGAGG + Intergenic
992009070 5:72509246-72509268 GAGGAGAAGCAATAGGGAGGGGG + Intergenic
992012324 5:72541269-72541291 GAGGAGAAGCAATAGGGAGGGGG + Intergenic
993752131 5:91683218-91683240 AAGGAGAAGGAAAATCAAGGAGG - Intergenic
994297039 5:98102904-98102926 GATGAGAAACAAAATCAGTGTGG - Intergenic
994401749 5:99289004-99289026 GAAGAGAAGCAATAACAGAGAGG - Intergenic
995214732 5:109582348-109582370 GAGGAGAAGGAAGAGGAGGGGGG + Intergenic
995683195 5:114743695-114743717 GAGGAGAAGCTAGAGCAGAGCGG - Intergenic
995998475 5:118328910-118328932 GAGGATTAATAATATCAGGGCGG + Intergenic
996425388 5:123308097-123308119 GAGGAGAGGTAATATGAGGAAGG - Intergenic
997909033 5:137850527-137850549 CAAGAGAAGAAATATCAAGGAGG + Intergenic
998501705 5:142638336-142638358 GAGAAGAAGGAATATCCTGGGGG - Intronic
998811844 5:145974362-145974384 AAGGAGAAGGAATTTCATGGGGG + Intronic
999254791 5:150204302-150204324 GAGGAAAAACAATCTCAGGGAGG - Intronic
999406633 5:151312638-151312660 GAGGAGAAGGAATAGTGGGGAGG - Intergenic
1000046809 5:157528566-157528588 GATGGGAAGCAATAACAGAGTGG - Intronic
1001319982 5:170672508-170672530 GGGGAGAATTAATTTCAGGGTGG + Intronic
1001874179 5:175185127-175185149 GAGGGGAAGCAATTTCAAAGAGG - Intergenic
1007075499 6:39063660-39063682 GAGGAGAAGAAAGAGCAGGGAGG + Intronic
1007412721 6:41674284-41674306 GAGGAGAGGAAATCTGAGGGTGG - Intergenic
1010015614 6:71102669-71102691 GAGGAGCTGCAACATCAGGAGGG - Intergenic
1010040329 6:71374557-71374579 GAGCAGAAGCATTGTCATGGTGG - Intergenic
1010650541 6:78449563-78449585 GAGGAGAAGAAATGTCAGAAGGG - Intergenic
1012189456 6:96261690-96261712 GAGGAGAGGGAAGAACAGGGAGG + Intergenic
1012271168 6:97213509-97213531 AAGGAGAAGCAATAGCAGCTGGG + Intronic
1012393035 6:98764680-98764702 GAGGAGAAACAATACCAGCCAGG - Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014961987 6:127697389-127697411 CAGAAGAAGCAATATCAGTGAGG - Intergenic
1015086622 6:129301642-129301664 GAGGAGGAGCAAGTTCAGGAAGG + Intronic
1016677836 6:146792713-146792735 GAGGAGAAATAAGAACAGGGAGG + Intronic
1016805401 6:148207143-148207165 GAGGACATGGAAAATCAGGGTGG - Intergenic
1018631950 6:165829215-165829237 GGGGAGCAGCGATATCAGGGAGG - Intronic
1019818593 7:3220709-3220731 GAGCAGAAGCAATGTCGTGGTGG - Intergenic
1020659547 7:10966065-10966087 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1020995276 7:15255954-15255976 GAGAAGAACAGATATCAGGGAGG + Intronic
1021749429 7:23780132-23780154 GAGGGCAAGCAAAAGCAGGGTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG + Intergenic
1030684920 7:112476182-112476204 GAAGAGAAGCACTTTCAGTGTGG - Exonic
1031392315 7:121230865-121230887 AAGGAAAAGCAAGATCAGAGTGG + Intronic
1032354766 7:131200214-131200236 TAAGAGAAGGAATCTCAGGGTGG - Intronic
1033465613 7:141586733-141586755 GAGCAGAAGCAGCATCAAGGGGG + Intronic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1036152536 8:6312180-6312202 GAGAAGGTGAAATATCAGGGAGG - Intergenic
1036611677 8:10355782-10355804 GAAGATATGCCATATCAGGGAGG + Intronic
1037212008 8:16400201-16400223 GAGGAGGAGCAATACCAGGGAGG - Intronic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1038318035 8:26503924-26503946 AAGGAGAAGCAATTTCAAGAAGG + Intronic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1040453582 8:47573595-47573617 GAGGAGAAGCAAAGTCTGGGAGG + Intronic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041879920 8:62737277-62737299 GAGCAGAAGCATTGTCATGGTGG + Intronic
1042767283 8:72337337-72337359 GAGGAGAAGGAAAATCAGTGAGG - Intergenic
1043925436 8:86031174-86031196 GAGCAGAAGCAAAACCAGAGAGG + Intronic
1045906319 8:107349404-107349426 TAGCAGAAGAAATTTCAGGGAGG + Intronic
1045920537 8:107523639-107523661 CAGGAGAAGCCATATCAGAGAGG + Intergenic
1046048058 8:108986856-108986878 GAGGGCAAGCAGAATCAGGGTGG - Intergenic
1046755709 8:117970939-117970961 GAGGATGAGAAATCTCAGGGGGG + Intronic
1049043354 8:140129438-140129460 GAGAAGAAGCGATCCCAGGGAGG + Intronic
1049730820 8:144177430-144177452 GAGGAGAAACAATAGTAGGAAGG - Intronic
1051143454 9:14002859-14002881 GAGGAGAGGAAATATGAGTGAGG + Intergenic
1052037200 9:23696121-23696143 GAGGAGAAGAAAGATTAGAGTGG - Intronic
1052246271 9:26339324-26339346 GAGTAGAAGAAATAACCGGGAGG + Intergenic
1053230361 9:36402532-36402554 GAGGAAAAGCTACTTCAGGGTGG - Intronic
1053272418 9:36759455-36759477 GAGGAGAAGCAGTAGCTGAGAGG + Intergenic
1055377538 9:75666154-75666176 GAGGAGACTGAATTTCAGGGAGG - Intergenic
1056839154 9:89984219-89984241 GAAGGGAAACAAAATCAGGGTGG - Intergenic
1057480234 9:95439557-95439579 GAGGAGAAGCAAGACAAGGCAGG - Intergenic
1058070430 9:100596052-100596074 GAGGAGAAAAAGTATCAGGTGGG + Intergenic
1058201139 9:102042211-102042233 GAGCAGAAGCAATAACATGTGGG + Intergenic
1058561810 9:106237783-106237805 GAGAAGAAGTAATATCAGATAGG - Intergenic
1058660597 9:107264214-107264236 GAAGATAAGAAGTATCAGGGTGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186482125 X:9904033-9904055 GAGGAGAAGCGGGAGCAGGGAGG + Intronic
1188291531 X:28394975-28394997 AAGGAGAAGCAAAGTCAGTGAGG + Intergenic
1188665704 X:32818337-32818359 AAGTAGAAGCAATAACAGCGAGG - Intronic
1189292496 X:39896087-39896109 GAGGAGAACAGATATAAGGGGGG + Intergenic
1190908744 X:54753056-54753078 GAGCAGAAGCATTGTCATGGTGG - Intronic
1190959850 X:55235116-55235138 GAGGGCAAGCAGAATCAGGGTGG - Intronic
1191151450 X:57224127-57224149 GAGGAGAGGTAATATCTGAGTGG - Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1193525366 X:82581628-82581650 GAGGGTGAGCAAAATCAGGGTGG - Intergenic
1193647807 X:84089742-84089764 GAGGAGAAAGAATAGCAGGGTGG - Intronic
1195706223 X:107739696-107739718 GAGGGGAAGCCCTATCTGGGAGG + Intronic
1196086343 X:111686565-111686587 GAGAAGAGGGAATGTCAGGGTGG + Intronic
1196810991 X:119628955-119628977 GAGGTGCAGCAATATAAGAGAGG - Intronic
1196848797 X:119918032-119918054 GAGGAGAAGCAAGATCAGAATGG - Intronic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1198533496 X:137566478-137566500 GAGGGGAAGAAAGAGCAGGGAGG - Exonic
1198651622 X:138869395-138869417 GAGTAGTAGCAAAAGCAGGGAGG + Intronic
1200556663 Y:4643455-4643477 AAGGCGAAGCAATAGCGGGGTGG + Intergenic
1201306035 Y:12551439-12551461 GAGGAGAAGCTAGAGCAGGGAGG + Intergenic