ID: 1145941291

View in Genome Browser
Species Human (GRCh38)
Location 17:28744490-28744512
Sequence CGGCGCCTTCTCGTGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145941273_1145941291 26 Left 1145941273 17:28744441-28744463 CCGAGGGGTCCGGGCGGGTCCCA 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
1145941283_1145941291 -2 Left 1145941283 17:28744469-28744491 CCGGCCCGGGGCGGAAGACCTCG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
1145941286_1145941291 -7 Left 1145941286 17:28744474-28744496 CCGGGGCGGAAGACCTCGGCGCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
1145941281_1145941291 6 Left 1145941281 17:28744461-28744483 CCAACTGCCCGGCCCGGGGCGGA 0: 1
1: 0
2: 2
3: 12
4: 159
Right 1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
1145941274_1145941291 17 Left 1145941274 17:28744450-28744472 CCGGGCGGGTCCCAACTGCCCGG 0: 1
1: 0
2: 0
3: 18
4: 367
Right 1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
1145941282_1145941291 -1 Left 1145941282 17:28744468-28744490 CCCGGCCCGGGGCGGAAGACCTC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
1145941285_1145941291 -6 Left 1145941285 17:28744473-28744495 CCCGGGGCGGAAGACCTCGGCGC 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
1145941279_1145941291 7 Left 1145941279 17:28744460-28744482 CCCAACTGCCCGGCCCGGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145941291 Original CRISPR CGGCGCCTTCTCGTGGGGTC AGG Intronic
905028328 1:34865897-34865919 GGGCGCCTTCGCGTGGGATCAGG + Exonic
905548014 1:38815642-38815664 AGGCCCCTTCTGGTGGGGGCAGG + Intergenic
1073266176 10:102229925-102229947 CGGCGCCACCTCGTGGTCTCAGG - Intergenic
1085787102 11:79462801-79462823 TGGCGCTTTCTGGTGGGCTCAGG + Intergenic
1088578944 11:111298595-111298617 CGGCTGCTTCTCCTAGGGTCGGG + Intronic
1094588086 12:31796183-31796205 CAGAACCTTCTCTTGGGGTCTGG - Intergenic
1097155080 12:57006471-57006493 CGCCGCCTCCTCGTCGGGCCGGG - Intergenic
1104535013 12:129610547-129610569 TGGCTCATTCTCGTGGGGTTGGG + Intronic
1105711251 13:23011499-23011521 CTGAGGCTTCTCGTGGGATCAGG - Intergenic
1119422569 14:74516305-74516327 CAGCGCCTTCTGGCTGGGTCTGG + Intronic
1122908688 14:104815777-104815799 GGGCGCCTGCTCGTGGCGGCGGG + Intergenic
1125535903 15:40441130-40441152 CAGCGCCTCCTCCTGGGGGCCGG - Intronic
1129109796 15:73330693-73330715 CTGCGCCTTCCCCTGGGGGCTGG - Intronic
1130538399 15:84803088-84803110 CAGCGCCTTCTCAAGGGGTCTGG - Exonic
1137237421 16:46626901-46626923 CGGCGCCTTCTCGGAGCGCCAGG - Intergenic
1139615138 16:68084398-68084420 AGACGCCTCCTCCTGGGGTCTGG - Intergenic
1143141988 17:4745925-4745947 CGGCGCCTTCGGGTGGGGGCAGG - Exonic
1143495578 17:7310667-7310689 CAGCTCCTTCTCCTGGTGTCCGG + Intronic
1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG + Intronic
1151829460 17:76540992-76541014 CCGCGCCTTCTATTGGGGACTGG - Intronic
1153299635 18:3581453-3581475 CAGCGCCTTCTCAAGGGGTCTGG - Intronic
1157761071 18:50266226-50266248 CGGGGCCTTCTCGAGGGGAACGG - Intronic
1158643399 18:59221304-59221326 GGGCGCCTGCGGGTGGGGTCAGG + Intronic
1160442098 18:78900999-78901021 CAGCTCCTACTCGTGGGGTGGGG + Intergenic
1161388337 19:4008381-4008403 CGGCACGTCCTCTTGGGGTCTGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162027769 19:7904131-7904153 CGGGGCCTTGTGGTGGGGGCGGG - Intronic
1165774456 19:38396392-38396414 TGGAGCCTCCTCGTGGGGTGTGG - Intergenic
1167466985 19:49655307-49655329 CGGCTCCTACTCCTGGGCTCTGG + Intronic
1167470258 19:49671830-49671852 CTGCTCCTTCTGGTGGGCTCTGG + Intronic
927477807 2:23427141-23427163 CAGCACCTTCTTGTGGAGTCAGG - Intronic
930171839 2:48259562-48259584 GGGAGCCCTCTCTTGGGGTCTGG - Intergenic
947795894 2:232893854-232893876 CAGCGCCTTCTGGTGGGTTTGGG - Intronic
948046613 2:234951007-234951029 CCGCGCTTTCTCCTGGGCTCCGG + Intergenic
1170890246 20:20369502-20369524 GGGCGCCTTCTCGTCGGGCCCGG - Exonic
1171430819 20:25082242-25082264 CGTCCCCATCTCGCGGGGTCCGG - Exonic
1183629781 22:39026065-39026087 CGGCTCCTTCTCAGGGGCTCAGG - Intronic
961754771 3:129121348-129121370 CGGCGCCTTCTCGGAGCGCCAGG - Exonic
968582988 4:1403517-1403539 GGGCGAGTTCTCGCGGGGTCCGG + Exonic
980336512 4:131481109-131481131 CTGGGCCCTGTCGTGGGGTCGGG + Intergenic
984155885 4:176195620-176195642 CGGCGCGGTCTCGTGGGGCGGGG + Exonic
985657017 5:1137558-1137580 CAGTGCCTGCTCGGGGGGTCTGG - Intergenic
1001014299 5:168126654-168126676 CGGGGCCTGCTCCAGGGGTCTGG + Intronic
1014802361 6:125791034-125791056 GGGCGCCGGCTCCTGGGGTCCGG - Exonic
1026301951 7:69105773-69105795 AGGAGCCCTCTCTTGGGGTCTGG + Intergenic
1029424701 7:100488450-100488472 CGGCGCCCGCTGGAGGGGTCGGG - Exonic
1032578621 7:133082063-133082085 CGGCGCCTTCTCCTTGCTTCTGG - Exonic
1037482144 8:19314384-19314406 GGGCGCCCCCACGTGGGGTCTGG + Intronic
1041720043 8:60967510-60967532 CGTCCCCTTCTGCTGGGGTCTGG - Intergenic
1049531823 8:143159028-143159050 CTGCTCCCTCCCGTGGGGTCGGG - Intronic
1049745721 8:144262485-144262507 CAGAGCCTTCTTGTGGTGTCTGG + Exonic
1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG + Intergenic
1060855883 9:126914890-126914912 CGGCGCCTTCGCTTGGAGGCCGG - Exonic
1061306954 9:129737804-129737826 CGGCGCTTTCTGGCGGGGCCTGG + Intergenic