ID: 1145942019

View in Genome Browser
Species Human (GRCh38)
Location 17:28747555-28747577
Sequence GTATCCCTCCACCAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145942014_1145942019 -6 Left 1145942014 17:28747538-28747560 CCTGTGGCTGAGGGCCAGTATCC 0: 1
1: 0
2: 1
3: 9
4: 171
Right 1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1145942007_1145942019 15 Left 1145942007 17:28747517-28747539 CCCTTCCGGTGGCAAGCCAGACC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1145942008_1145942019 14 Left 1145942008 17:28747518-28747540 CCTTCCGGTGGCAAGCCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1145942005_1145942019 19 Left 1145942005 17:28747513-28747535 CCTCCCCTTCCGGTGGCAAGCCA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1145942004_1145942019 20 Left 1145942004 17:28747512-28747534 CCCTCCCCTTCCGGTGGCAAGCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1145942006_1145942019 16 Left 1145942006 17:28747516-28747538 CCCCTTCCGGTGGCAAGCCAGAC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1145942013_1145942019 -1 Left 1145942013 17:28747533-28747555 CCAGACCTGTGGCTGAGGGCCAG 0: 1
1: 0
2: 3
3: 23
4: 265
Right 1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1145942009_1145942019 10 Left 1145942009 17:28747522-28747544 CCGGTGGCAAGCCAGACCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG 0: 1
1: 1
2: 0
3: 17
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145942019 Original CRISPR GTATCCCTCCACCAGGGGAA AGG Intronic
910618805 1:89230377-89230399 GGAACCCACCTCCAGGGGAAGGG - Intergenic
912968941 1:114262205-114262227 GTATGCCTTCACCAAAGGAAAGG - Intergenic
913595880 1:120376142-120376164 GTGGCCCTCCACCATGTGAATGG - Intergenic
921125829 1:212177165-212177187 TCATCCCTCCACCAGGTTAAAGG - Intergenic
921991544 1:221372626-221372648 GTAGCCCTCAGCCAGGTGAAAGG + Intergenic
922463105 1:225827993-225828015 GGTTCCCTCCCCCAGGGGAGAGG - Intronic
1069740463 10:70683872-70683894 GTAGCACTCCAACAGGGGGAAGG + Intronic
1069872685 10:71542818-71542840 CTGTGCCTCCCCCAGGGGAAGGG - Intronic
1073400131 10:103250710-103250732 GGGTCCCTGCAGCAGGGGAAGGG - Intergenic
1077035888 11:494312-494334 GCATCCCTCCACCCTGGGCAGGG + Intergenic
1078930091 11:15906003-15906025 GCATCCCTCCAGCAGAGGACTGG + Intergenic
1081547679 11:44083351-44083373 GTCTCCCTCCAGCAGGTGAGGGG + Intronic
1083036569 11:59643083-59643105 GTTACCCCCCACCAGGGGCATGG + Intronic
1084346765 11:68557082-68557104 GTACCCCTCCACCTGGGGTGAGG + Intronic
1085861632 11:80242775-80242797 GTATGCATGCACCAGGGAAAAGG + Intergenic
1089622613 11:119730166-119730188 GTCTTCCTCCCCCAGGGGGAGGG - Intergenic
1091158190 11:133393665-133393687 GTATCCCTCATCCAGGAGAAGGG + Intronic
1091487707 12:905996-906018 ATATCCTACCACCTGGGGAATGG - Intronic
1092030267 12:5278134-5278156 GCATGGCTCCCCCAGGGGAAGGG + Intergenic
1092412261 12:8262822-8262844 GTCTCCCACCACCAGGAGATGGG - Intergenic
1092522210 12:9286828-9286850 GTGTCACTCTACGAGGGGAAAGG - Intergenic
1092545073 12:9445030-9445052 GTGTCACTCTACGAGGGGAAAGG + Intergenic
1093794224 12:23291846-23291868 GTGTCCCACTGCCAGGGGAAAGG - Intergenic
1094154246 12:27320884-27320906 TTAGGCCTCCACCAGGAGAATGG - Intronic
1095297441 12:40542979-40543001 GTCTCCCTGAAGCAGGGGAAAGG - Intronic
1100667411 12:96769976-96769998 GTATCTCTGCACCAGGTGCAAGG - Intronic
1102714493 12:114958433-114958455 ATATCCATTCACCAGGGGACTGG - Intergenic
1106045260 13:26133994-26134016 ACATACCTCCAACAGGGGAAAGG + Intronic
1107725664 13:43296624-43296646 GAATCCCTCCATCAGGAGGATGG + Intronic
1108051513 13:46445524-46445546 GAATCCATTCACTAGGGGAAGGG + Intergenic
1109544066 13:63819149-63819171 GAATCCATTCACTAGGGGAAGGG + Intergenic
1109673396 13:65639406-65639428 GTATCCCTACTCCAGGCCAAAGG + Intergenic
1113259577 13:108546906-108546928 TTATCCTTCCTCCAGGAGAAAGG + Intergenic
1117985375 14:61381525-61381547 GTATCCCCCCGACATGGGAAGGG - Intronic
1120652257 14:87149055-87149077 TTATCCTTCCACCTAGGGAAGGG - Intergenic
1121412806 14:93759719-93759741 TTCTCACTCCACCAGGAGAATGG - Intronic
1121685714 14:95833538-95833560 CTATCCTTTCACCAGGGAAAAGG + Intergenic
1122425505 14:101603097-101603119 TTCTCCCTCCTCCAGGGCAAAGG - Intergenic
1128742450 15:70093296-70093318 GGCTCCCTCCAGGAGGGGAAAGG + Intronic
1133317845 16:4895111-4895133 GTTGGCCTGCACCAGGGGAAGGG + Intronic
1133339057 16:5025160-5025182 GTCTCCCTCCTCCTGGGGAAGGG - Exonic
1134468118 16:14497020-14497042 GAATCCCTCAGGCAGGGGAAGGG - Intronic
1137434930 16:48447376-48447398 GTATTCCCCCACCTGGGGAAGGG - Intronic
1138623395 16:58230201-58230223 GTCTGCCACCACCAGTGGAATGG + Intergenic
1142807476 17:2379123-2379145 GTAGGCCTCCACCAGGGCGAGGG - Exonic
1142878743 17:2868256-2868278 CTGGCCCTCCACCAGGGGGATGG - Intronic
1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG + Intronic
1148080513 17:44965594-44965616 TTTTCCCTCCAGCAGGGGCAGGG - Intronic
1148735024 17:49860481-49860503 GTGGCCCACCATCAGGGGAAGGG + Intergenic
1150304066 17:64069561-64069583 GTTCCCCTCCTCCAGGGGTAGGG - Intronic
1152117289 17:78396344-78396366 GCATCCCTCTACCTGGGGACAGG + Exonic
1152831201 17:82497804-82497826 GTTTACATCCACCGGGGGAAAGG - Intergenic
1155873650 18:31058086-31058108 ATATCCCTCCACACAGGGAATGG - Intergenic
1156402714 18:36755218-36755240 GTATCGCACAACCAGGGAAAGGG + Exonic
1158494168 18:57938510-57938532 CTGTCCCTCCACCAGGGGTATGG + Intergenic
1158881110 18:61780477-61780499 GTGTTCCTCCTCCAGGGGATGGG - Intergenic
1159953858 18:74505988-74506010 GTCTCGCTCCACCAGGGTGAAGG - Exonic
1160346240 18:78134875-78134897 GTGTCCTTCCCCCAGGGAAATGG + Intergenic
1160346291 18:78135105-78135127 GTGTCCTTCCCCCAGGGAAATGG + Intergenic
1160966000 19:1747241-1747263 GTACCCCTCCCCCAGGGAATGGG + Intergenic
1161868583 19:6853116-6853138 GTTTCCCTCCACAATGGGAAGGG - Intronic
1167055916 19:47111868-47111890 GTGTGCCTCCCCCAGGAGAAAGG + Intronic
1168695616 19:58402365-58402387 GTGTCCCCCCACCAGGGGGATGG + Intronic
925771109 2:7283965-7283987 GTCTCCATCCACCAGGGCACAGG - Intergenic
932912674 2:75821453-75821475 GAATCTCTCCAACATGGGAAAGG + Intergenic
935676599 2:105599718-105599740 TTATCCCTTCATCATGGGAATGG + Intergenic
942613934 2:177770254-177770276 TTTTCCCTCCACCAAGGGAAGGG + Intronic
1172022719 20:31925677-31925699 ATCCCCCTCCACCTGGGGAAAGG + Intronic
1172601051 20:36183230-36183252 GTTCCCCTACAGCAGGGGAAGGG + Intronic
1175121084 20:56716874-56716896 GAATCCCTCCTCCAGGGGTGGGG + Intergenic
1175250948 20:57609957-57609979 GGGTCCCTCCACTAGGGGGACGG + Intronic
1181014555 22:20061717-20061739 GTGTCCCGCCACCAGGGCAGAGG + Intronic
1181572757 22:23776549-23776571 GGGTCCCTCCTTCAGGGGAAGGG + Intronic
1181632412 22:24158082-24158104 GAATCCCTCCACCAGGGGAACGG + Intronic
1184908494 22:47509152-47509174 GCCTCCCTCCAGCAGAGGAAAGG + Intergenic
1185128693 22:49025614-49025636 ACATCCATCCCCCAGGGGAAGGG - Intergenic
949779692 3:7672073-7672095 GTTTCCCTCCCCCCGGGGCAGGG - Intronic
950424824 3:12919451-12919473 GGCACCCGCCACCAGGGGAAGGG + Intronic
950966903 3:17152795-17152817 GTGTCCCTCCCCAGGGGGAAAGG + Intergenic
951195921 3:19823302-19823324 GTATGCCTGCACCTGGGGATGGG - Intergenic
952615287 3:35263603-35263625 GTATCTCTGCAGCAGGGTAATGG + Intergenic
960720700 3:120622388-120622410 CAGTCCCTCCTCCAGGGGAAGGG - Intergenic
961371881 3:126436210-126436232 CTCTCCCTGCACCAGGGGCAGGG + Intronic
961501855 3:127341982-127342004 GTGTCCCTGCACCATGGGAAGGG + Intergenic
961889821 3:130121483-130121505 GTCTCCCACCACCTGGAGAAGGG - Intergenic
962631109 3:137276706-137276728 GTATCACTGCAACAGGGGAGTGG - Intergenic
964284453 3:155102330-155102352 GTATACCCCCACCCAGGGAAAGG - Intronic
966400985 3:179546726-179546748 AAATTCCTCCACCTGGGGAAAGG + Intergenic
968314470 3:197711296-197711318 ATATCCATTCACCAGGGGACTGG + Intronic
969135494 4:5025519-5025541 TTATCCCACCAACAGGGTAAAGG - Intergenic
969171052 4:5364015-5364037 GGATGCCTCCAGCAGGGGGATGG - Intronic
970398335 4:15694137-15694159 GTGTCCCTCCCCCATGGGTAGGG + Intronic
972310322 4:37876123-37876145 GTGTCTCTCCTCCAGGGCAATGG + Intergenic
972561035 4:40229174-40229196 ATATCCCTCCACCAGGAGGCAGG + Intronic
972645542 4:40964606-40964628 CTATCACTCTACCAGGGGAAAGG + Intronic
975643075 4:76519600-76519622 GTTTCCCTCCAGCACTGGAACGG - Intronic
975733590 4:77360475-77360497 GAAAGCCTCCACCATGGGAAAGG - Intronic
978600864 4:110426346-110426368 CTAGCCCTCCACCATGTGAAAGG + Intronic
990115629 5:52387150-52387172 GAATCACTCCATCTGGGGAAAGG - Intergenic
990327182 5:54690076-54690098 CTAGCCTTCCACCTGGGGAAAGG - Intergenic
993407400 5:87528586-87528608 GTATCCCACCACCAAGGGAGGGG + Intergenic
996488470 5:124064771-124064793 GTGTCACTCCACCAGGTAAAGGG - Intergenic
998005349 5:138653273-138653295 GTCTCCCTCCACCTAGGAAAAGG + Intronic
1003568414 6:7239888-7239910 GTGTCCCTCCCACAGGGGAACGG - Intronic
1004644944 6:17551902-17551924 GTTTACCTCCACCAGAGCAAAGG - Intronic
1006985399 6:38172517-38172539 GTACCCCTCCAGCCTGGGAAAGG + Exonic
1008737359 6:54561978-54562000 GTATCCCTTGGCCAGAGGAAGGG + Intergenic
1025192350 7:56905424-56905446 GTATAACTCCACAATGGGAAGGG - Intergenic
1025679599 7:63671507-63671529 GTATAACTCCACAATGGGAAGGG + Intergenic
1027232950 7:76282633-76282655 GTCTCCCTCCTCCAGGGCCAAGG + Exonic
1027851296 7:83455582-83455604 GTGTGCCTACACCAGAGGAAGGG - Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030330531 7:108265286-108265308 GTAGCCCTCCCCCAGGGGCAAGG - Intronic
1031361133 7:120850027-120850049 GCTTCCCTCTACCAGGGGAAGGG + Intronic
1031556365 7:123181474-123181496 GTATCCTGCCCCCAGGGGAAAGG - Intronic
1037295181 8:17391943-17391965 CTAGCTGTCCACCAGGGGAAAGG + Intronic
1037717403 8:21411910-21411932 TTCTCCCTCCACCAGGCAAATGG - Intergenic
1037822224 8:22140539-22140561 CTCTCCCTCCTCCAGGGGCAAGG - Intronic
1038080496 8:24130211-24130233 ATACCCCTCCACCAGGGCAATGG - Intergenic
1038878315 8:31577509-31577531 GTACCCCTCCACCATAGGAGGGG + Intergenic
1046178387 8:110609721-110609743 GTAAACCTCAACCAGGGAAAAGG - Intergenic
1052500183 9:29279399-29279421 GTTTCACTTCTCCAGGGGAATGG + Intergenic
1052986384 9:34491090-34491112 CTCTGGCTCCACCAGGGGAATGG - Intronic
1056267526 9:84914482-84914504 ACAGCACTCCACCAGGGGAAAGG + Intronic
1057243265 9:93431700-93431722 GTATGCTTACACCAGGGGAATGG - Intergenic
1061537743 9:131260023-131260045 GTATCCCTGCACCTGCGGAGAGG - Exonic
1061631022 9:131872220-131872242 GCTTCCCACCACCAGGGGACAGG + Intronic
1191890136 X:65931577-65931599 CTATCCCTCCCCTAGGGGAAGGG - Intergenic
1191920127 X:66246685-66246707 GAACCTCTCCAACAGGGGAAAGG - Intronic
1192911642 X:75610975-75610997 GAATGCCTCATCCAGGGGAAAGG + Intergenic
1196651420 X:118172097-118172119 GTGTCCCTCCACCAGGTAAGTGG + Intergenic