ID: 1145943694

View in Genome Browser
Species Human (GRCh38)
Location 17:28758112-28758134
Sequence GGGATCTAAGTGGGGACAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145943694_1145943703 19 Left 1145943694 17:28758112-28758134 CCTTCTGTCCCCACTTAGATCCC 0: 1
1: 0
2: 0
3: 14
4: 248
Right 1145943703 17:28758154-28758176 ACATCTAAGAATGATCACACTGG 0: 1
1: 0
2: 4
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145943694 Original CRISPR GGGATCTAAGTGGGGACAGA AGG (reversed) Exonic
901639916 1:10687974-10687996 GGCTTCTTAGTGGGGGCAGAAGG - Intronic
903182466 1:21611868-21611890 TGGGTCCAAGTAGGGACAGAGGG - Intronic
904010077 1:27384180-27384202 GGGTTTCAAGTGGGGACTGATGG - Intergenic
904317948 1:29677919-29677941 GGGACCTAAGTGGCTGCAGAGGG - Intergenic
905369767 1:37476760-37476782 GGGAAAAAAGTGGGGCCAGAGGG - Intronic
909252391 1:73375454-73375476 GGGGGCTAAGTGGTAACAGAAGG - Intergenic
909405114 1:75280580-75280602 GAGATTTTAGTGGGGACACAAGG - Intronic
910980421 1:92955174-92955196 GGGGGCTCAGTGGGGACAGAAGG + Intronic
911082972 1:93951357-93951379 GAGATTTGAGTGGGGACACAAGG + Intergenic
912686928 1:111775245-111775267 GGGATCCAGGTAGAGACAGATGG + Intronic
913460201 1:119077176-119077198 GTGATCTAATTGGAGATAGAGGG + Intronic
915397176 1:155594099-155594121 AAGATTTAAATGGGGACAGAGGG + Intergenic
915411183 1:155701881-155701903 GGGAAATAAGTGGGGTCAGCAGG + Intronic
915908881 1:159900027-159900049 GGGCTCTGAGTGGGGAAAGTGGG - Intronic
916141883 1:161706900-161706922 GTGATGCAACTGGGGACAGAAGG - Intergenic
920437514 1:205956993-205957015 GGGAGGCAAGTGGGGAAAGAAGG - Intergenic
920660692 1:207911840-207911862 GGGAACTAAATGGGGAAATATGG - Intergenic
922080699 1:222293108-222293130 GGGATCTAAGGGAACACAGATGG - Intergenic
1064451398 10:15445199-15445221 GTGATCAAAGTGGAGACACAAGG + Intergenic
1072639647 10:97202287-97202309 TGGCTCTCAGTGGGGCCAGAGGG - Intronic
1072765694 10:98093590-98093612 GGGATCTGAGTAGTGACATACGG + Intergenic
1076152058 10:128170383-128170405 GGGATCATGGAGGGGACAGAGGG + Intergenic
1077536822 11:3128549-3128571 GGGCTCTGAGAGGGGACAGCTGG - Intronic
1079380901 11:19936540-19936562 GGCAACTCAGAGGGGACAGAAGG - Intronic
1080152191 11:29065518-29065540 GGGATCTAATTGGACAAAGATGG - Intergenic
1080392950 11:31865258-31865280 TGGAGCTGAGTGGGGTCAGATGG + Intronic
1084861845 11:72024029-72024051 GAGATCTAGGTGGAGCCAGAAGG - Intronic
1086345067 11:85887589-85887611 AGGATTTGAGTGCGGACAGAGGG - Intronic
1087082668 11:94186961-94186983 GGCATCTAAGTCAGGACAAAGGG - Intergenic
1089243377 11:117099810-117099832 GGGACTTAAGATGGGACAGAGGG + Intergenic
1096238998 12:49949485-49949507 AGGCTCAGAGTGGGGACAGAAGG - Intergenic
1097854421 12:64447225-64447247 GAGATCTGCGTGGGGACACAGGG + Intronic
1102855930 12:116293422-116293444 GGGATCTAAATGAGAACAAAAGG + Intergenic
1102940486 12:116937087-116937109 GGGCTGGATGTGGGGACAGAAGG + Intronic
1104254057 12:127123948-127123970 GGGATAGAGGGGGGGACAGAGGG + Intergenic
1104254178 12:127124245-127124267 GGGATAGAGGGGGGGACAGAGGG + Intergenic
1104254285 12:127124502-127124524 GGGATAGAGGGGGGGACAGAGGG + Intergenic
1104254437 12:127124879-127124901 GGGATAGAGGGGGGGACAGAGGG + Intergenic
1104254568 12:127125204-127125226 GGGATAGAGGGGGGGACAGAGGG + Intergenic
1106357865 13:29001312-29001334 GGGATCTCACTGAGGAAAGATGG + Intronic
1106503634 13:30352881-30352903 GGGATCTAAGAGGGGGAAGGAGG - Intergenic
1106512199 13:30421804-30421826 GGGAGCGGAGTGGGGAAAGAGGG + Intergenic
1107132783 13:36914164-36914186 GGCACCTAAGTGTGGAAAGAGGG - Intronic
1110776343 13:79412316-79412338 GGTATCAAATTGGGGACATAGGG + Intergenic
1111107627 13:83668083-83668105 GAGATTTAGGTGGGGACACAAGG - Intergenic
1111979406 13:95001468-95001490 TGGATCTAAATGGGGAGAGATGG - Intergenic
1113031968 13:106003362-106003384 TGGATCTAACTGGTGAGAGAAGG + Intergenic
1115364125 14:32537343-32537365 GGGATCTAACTTGGGAGGGATGG - Intronic
1116389495 14:44376125-44376147 GAGATTCAGGTGGGGACAGAGGG + Intergenic
1117378472 14:55137098-55137120 GGGCAGTTAGTGGGGACAGAGGG + Intronic
1117841246 14:59862654-59862676 GTGATCCCAGTGGGAACAGATGG - Intronic
1117970821 14:61249210-61249232 GAGACCTAAGTGGGGATAGGTGG - Intronic
1118170702 14:63385886-63385908 GGGATCTAAGAGAGCAGAGAGGG - Intronic
1119326950 14:73765719-73765741 GGGATCAAGGTGGCGAGAGAAGG - Intronic
1120122586 14:80700012-80700034 GGGCTTTAAGTGGGGAAGGATGG + Intronic
1122986712 14:105214940-105214962 GGGGTCTACCTGGGGACAGAAGG - Intronic
1123540186 15:21281999-21282021 GGGAAGTAAGTGGAGAGAGATGG + Intergenic
1124247740 15:28085231-28085253 GGGGTTTAAGTGGGGAGTGAAGG - Intronic
1126424518 15:48512529-48512551 GGGAGCTAAATGGTGACACATGG - Intronic
1126561902 15:50053067-50053089 TGGATCAGGGTGGGGACAGAAGG + Intronic
1127339108 15:58022179-58022201 GGGAACAAAGTGAGGCCAGATGG - Intronic
1127698393 15:61473735-61473757 GGGAGGTAAGGGGGAACAGAAGG + Intergenic
1127850346 15:62906888-62906910 GGGATCTCAGTGGGGCCTGGGGG - Intergenic
1129288327 15:74543641-74543663 AGGATCTAAGAGGGGAAATAGGG - Intronic
1130411024 15:83648872-83648894 GGGATCTAAGTGCAGGCTGAGGG + Intergenic
1131258937 15:90878635-90878657 GGGATCTCACAGGGGACAGGAGG + Intronic
1202948498 15_KI270727v1_random:9157-9179 GGGAAGTAAGTGGAGAGAGATGG + Intergenic
1132478197 16:153049-153071 GGTATGTGAGTGGGGACAGTGGG + Intronic
1132480148 16:163261-163283 GGTATGTGAGTGGGGACAGTGGG + Intronic
1133690996 16:8214921-8214943 GGGATAGAAGTGGGAAGAGAAGG + Intergenic
1134847615 16:17453689-17453711 GAGATCTTATTGGGGACACAGGG + Intronic
1135728561 16:24875876-24875898 GGGAGGTAAGCGTGGACAGAGGG + Intronic
1136739631 16:32505155-32505177 GGGATCTCACTGGGGCCAAAAGG - Intergenic
1138594395 16:58022124-58022146 GGCATCTGGGTGGGGACATAGGG + Intergenic
1138720974 16:59078644-59078666 GGGATCTACTTGAGGGCAGAGGG - Intergenic
1140914670 16:79483095-79483117 GGGAGGGAAGTAGGGACAGAGGG - Intergenic
1142431966 16:90033842-90033864 AGGATCGAAGTGGGGAGAGGTGG + Intronic
1143362903 17:6386129-6386151 GGGATCTAGGAGGGCACAAACGG - Intergenic
1143740591 17:8950447-8950469 GGACTCTCAGTGGGGAGAGAGGG - Intronic
1144837354 17:18163667-18163689 GGGGCCTGAGTGGGGCCAGAAGG + Intronic
1145841889 17:28002019-28002041 GGGTTTTAAGTGGGTGCAGATGG + Intergenic
1145887789 17:28394954-28394976 GTGATCTAAGTGGGGATCTAAGG + Exonic
1145943694 17:28758112-28758134 GGGATCTAAGTGGGGACAGAAGG - Exonic
1146782792 17:35690388-35690410 GGGAGCTAAATTGGGAAAGAGGG + Intronic
1149206049 17:54249826-54249848 GGGATGGAAGTGGGGGTAGAAGG + Intergenic
1149525591 17:57353112-57353134 GGGAGCTATCTGGGGAAAGATGG - Intronic
1149544918 17:57496371-57496393 AGGACCTAAGTGGGGAGAGGGGG - Intronic
1151803381 17:76390832-76390854 GGGTTTGCAGTGGGGACAGAGGG + Exonic
1154251789 18:12750944-12750966 AGGACCCAAGTGGAGACAGAGGG - Intergenic
1157213004 18:45759927-45759949 GGGATCAAAATGGGAAGAGATGG - Intergenic
1157665888 18:49486779-49486801 GTCATCTTAGTGGAGACAGAGGG + Intronic
1160842587 19:1152841-1152863 GGGATTTACCTGGAGACAGAGGG - Intronic
1161171088 19:2812841-2812863 GGGATTTCAGTGGGGGCTGATGG + Intronic
1162310891 19:9906696-9906718 AGGACCAGAGTGGGGACAGATGG + Intronic
1163002284 19:14375858-14375880 GAGATGTCAGTGGGGCCAGATGG + Intergenic
1164200207 19:23011806-23011828 GAGATCTACTTGGGGAAAGATGG + Intergenic
1165473627 19:36017271-36017293 GGTATTTAATTGGGGACACAGGG - Intronic
1166251803 19:41576413-41576435 GGGCTCTGAGAGGAGACAGAGGG + Intronic
1166259274 19:41626774-41626796 GGGCTCTGAGAGGGGACTGAGGG - Intronic
1166266511 19:41688006-41688028 GGGCTCTGAGAGGGGACAAAGGG - Intronic
1166281445 19:41796815-41796837 GGGCTCTGATAGGGGACAGAAGG + Intronic
1166406924 19:42528214-42528236 GAGCTCTAAGAGGGGACAGAGGG - Intronic
1166411978 19:42561596-42561618 GGACTCTGAGGGGGGACAGAGGG - Intergenic
1166423260 19:42654341-42654363 GGGCTCTGAGAGGGGACAGAGGG + Intronic
1166837460 19:45676321-45676343 GGGATCTAGGGGGGAACTGACGG + Intronic
1167105464 19:47427773-47427795 GGGATTTAAGTGGGGGAAGGAGG - Intergenic
1167863842 19:52308007-52308029 GGAATCTAAGTGAGGTTAGAAGG - Intronic
1168005587 19:53483974-53483996 GGAATCTAAGTGAGAAAAGAGGG - Intronic
1168443173 19:56389462-56389484 GGGAGCTAAATGAGGACACATGG + Intronic
925101277 2:1248292-1248314 GGGAGCTGAGTGGAGGCAGACGG - Intronic
925214885 2:2085846-2085868 GGAAACCGAGTGGGGACAGAGGG - Intronic
926797965 2:16634348-16634370 GGCATCAAAGTGGTGACAGTGGG - Intronic
926809253 2:16741752-16741774 GGGAGGTAAGTGGGGAATGAGGG + Intergenic
927210222 2:20634577-20634599 GGGAGCTCTGTGGGGACAGCAGG - Intronic
927699506 2:25259012-25259034 GGGATAGAGGTGGGGAGAGAAGG - Intronic
928105156 2:28465824-28465846 GGGGACTGAGTGGGGAAAGATGG - Intronic
928236045 2:29541611-29541633 GGCTTCAAAGTGGGGACTGAAGG + Intronic
929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG + Intergenic
929450190 2:42031760-42031782 GAGACCTAAGTGGACACAGATGG - Intergenic
930645146 2:53898443-53898465 GGGAAGTAAGTGGGGAAGGAGGG - Intronic
931168483 2:59776913-59776935 GGCATCTAAGTGGAATCAGATGG - Intergenic
931607623 2:64067772-64067794 GGGATCTAAGTAAAGATAGAAGG - Intergenic
932053485 2:68421638-68421660 GGCAGATAAGTGGGGACAAATGG + Intergenic
932571483 2:72940680-72940702 GGGAGCTAATTGGTGGCAGAGGG + Intergenic
933164759 2:79063968-79063990 GAGATTTGGGTGGGGACAGAGGG - Intergenic
933616987 2:84492162-84492184 GAGAGCTAAGTAGGGAAAGAGGG + Intergenic
934046644 2:88178283-88178305 GTGATCTAAATGAGGGCAGAGGG + Intronic
935923701 2:108042936-108042958 GGGATTTGAGTGGGGACACATGG - Intergenic
936043237 2:109165731-109165753 AGGATCTGAGTGGGGAGAGTGGG - Intronic
937469455 2:122162801-122162823 GGGATCTGAGTGGGGGTAGCTGG + Intergenic
938035228 2:128029154-128029176 GAGATCTAAGTGAGGACCGATGG - Intergenic
938737902 2:134203224-134203246 GGGGTCTTAGTGTGCACAGAAGG + Intronic
942249830 2:174038035-174038057 GGGAAATAGGAGGGGACAGAGGG + Intergenic
943615230 2:190084850-190084872 GGGTTTTATCTGGGGACAGATGG + Intronic
943642718 2:190376567-190376589 GTTAAATAAGTGGGGACAGAAGG + Intergenic
948578022 2:238966528-238966550 GGGATGGCAGAGGGGACAGAAGG + Intergenic
1169780460 20:9303988-9304010 GAGATTTAGGTGGGGGCAGAAGG - Intronic
1170756580 20:19211676-19211698 CTGATCGAAGTGGGGACAGCTGG - Intergenic
1170889666 20:20367386-20367408 GGGTTCCAAGTGTGGACAGGGGG - Intergenic
1171963916 20:31515259-31515281 GGGATCTAGGTGAGCACATAAGG - Intronic
1172653347 20:36521286-36521308 GAGTTCTAAAAGGGGACAGAGGG - Intronic
1172914564 20:38434124-38434146 GGACTCTGGGTGGGGACAGATGG - Intergenic
1174261084 20:49295798-49295820 GGGAACATAATGGGGACAGAAGG - Intergenic
1174280655 20:49436672-49436694 GGGATGGAGGTGGGGAGAGATGG + Intronic
1175764517 20:61583203-61583225 GGGCTCTGCGGGGGGACAGACGG + Intronic
1175764529 20:61583243-61583265 GGGCTCTGAGGAGGGACAGAGGG + Intronic
1175764535 20:61583263-61583285 GGGCTCTGCGGGGGGACAGACGG + Intronic
1175764549 20:61583303-61583325 GGGCTCTGTGGGGGGACAGAGGG + Intronic
1179236164 21:39548277-39548299 GGAAGCTAACTGGGTACAGAAGG - Intergenic
1180604569 22:17047439-17047461 GGAAGCTAAGTGAGGGCAGATGG + Intergenic
1181023782 22:20116608-20116630 GGGCCCTGTGTGGGGACAGATGG + Exonic
1183318409 22:37149343-37149365 GTGGAGTAAGTGGGGACAGAAGG - Intronic
1185057450 22:48588373-48588395 GGGAGCAAAGTCGGGAGAGAGGG - Intronic
1203296358 22_KI270736v1_random:46411-46433 AGGAGCAAAGTGGGTACAGATGG + Intergenic
949446108 3:4135576-4135598 GGAATCGGAGTGGTGACAGAGGG - Intronic
951057664 3:18166494-18166516 GGGAATTAAGTGGGCACAGGTGG - Intronic
951126904 3:18995458-18995480 GAGATTTGGGTGGGGACAGAGGG + Intergenic
951531520 3:23702653-23702675 GGGACCCAAGAGGGAACAGAAGG - Intergenic
952882108 3:37991536-37991558 GGGCACCCAGTGGGGACAGAGGG + Intronic
953066881 3:39481581-39481603 GGGTTCTTTGTGGGGGCAGAGGG - Intronic
955462114 3:59194846-59194868 GGACTCTAAGAGGGGAAAGATGG + Intergenic
956700793 3:71956801-71956823 AGGAACTATGAGGGGACAGATGG + Intergenic
958672976 3:97228320-97228342 GGGAACTCAGTGGGGAAGGATGG - Intronic
959783701 3:110267517-110267539 GGGATCTGAGTGTGGGCACAAGG + Intergenic
961351580 3:126307841-126307863 GGGAACTAAGTGAGGAGAGCTGG - Intergenic
963359930 3:144258455-144258477 GGGATAGAAATGGGGAGAGAGGG + Intergenic
963572672 3:147016862-147016884 GAGATTTGAGTGGGGACAGAGGG - Intergenic
964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG + Intronic
964934303 3:162062163-162062185 GGGATGGAAGAAGGGACAGAGGG - Intergenic
965845767 3:172959439-172959461 TGGTTCTCAGTGGGGAGAGAGGG - Intronic
966912156 3:184565644-184565666 GGGAACTGAGAGGGGACAGCGGG + Intronic
967983794 3:195080754-195080776 GGAGTCTAACTGGGGACACAAGG - Intronic
969711614 4:8847587-8847609 AGCATCTCTGTGGGGACAGAAGG - Intronic
974470246 4:62309919-62309941 GAGATCTAAGAACGGACAGACGG + Intergenic
975663940 4:76715377-76715399 GGGATCTAAGCGGGAAAGGAAGG - Intronic
976119420 4:81763106-81763128 TGGATCTAAGGGTGGACAGATGG + Intronic
976369603 4:84272154-84272176 GGGGTCTACTTGAGGACAGAGGG + Intergenic
977474513 4:97488942-97488964 GAGATTTGAGTGGGGACACAGGG - Intronic
978249266 4:106610607-106610629 AGGACCTAAGTGGGGACATGTGG + Intergenic
978555338 4:109973578-109973600 GGGAAGTAAGAGGGGAAAGAGGG - Intronic
979846296 4:125516771-125516793 GAGATTTAGGTGGGGACACAGGG + Intergenic
981360443 4:143839791-143839813 TGGTTCTAAGTGAGGACAGTAGG + Intergenic
981371215 4:143960856-143960878 TGGTTCTAAGTGAGGACAGTAGG + Intergenic
982702078 4:158668409-158668431 GGGCTATGAGAGGGGACAGATGG - Exonic
984053392 4:174895503-174895525 GGGAACTAAATGGGAACACATGG + Intronic
985168573 4:187124251-187124273 GGGATCTGAGGGGGGACAATGGG - Intergenic
987089968 5:14501787-14501809 GGAAACTAAGTGGGGAGAGGAGG + Intronic
987650568 5:20734635-20734657 GAGATTTGAGTGGGGACACAGGG + Intergenic
987697711 5:21354260-21354282 GAGATTTGGGTGGGGACAGAGGG + Intergenic
988754525 5:34232434-34232456 GAGATTTGGGTGGGGACAGAGGG - Intergenic
990276317 5:54201007-54201029 GGGATTTAATTGGAGACAAAGGG - Intronic
990814622 5:59769204-59769226 GGGTTCTAACTAGAGACAGAGGG - Intronic
991403413 5:66277688-66277710 GGGATCTATGTGGGCAGAGGGGG - Intergenic
991742733 5:69698128-69698150 GAGATTTGGGTGGGGACAGAGGG - Intergenic
991754961 5:69857076-69857098 GAGATTTGGGTGGGGACAGAGGG + Intergenic
991794306 5:70277866-70277888 GAGATTTGGGTGGGGACAGAGGG - Intergenic
991822123 5:70573441-70573463 GAGATTTGGGTGGGGACAGAGGG - Intergenic
991834288 5:70732224-70732246 GAGATTTGGGTGGGGACAGAGGG + Intergenic
991886686 5:71277408-71277430 GAGATTTGGGTGGGGACAGAGGG - Intergenic
992224845 5:74610508-74610530 GGGATCTCAGTGGGGCCCGCAGG - Intergenic
993263836 5:85695983-85696005 GAGATTTGAGTGGGGACACAGGG - Intergenic
993331049 5:86600278-86600300 GGCATCTAAGTTGGGAAAAATGG + Intergenic
995995079 5:118288297-118288319 GGCATCTAAGTAGGAAGAGAGGG - Intergenic
997174257 5:131757663-131757685 GGGAAGAAAGTGGGGACACAAGG + Intronic
997375987 5:133398048-133398070 GGAACCTCTGTGGGGACAGAGGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998939779 5:147268829-147268851 GGGATCTGAGTTGTGAGAGAGGG + Intronic
1000731410 5:164838698-164838720 GGGAAATAAGTAAGGACAGAAGG - Intergenic
1001568220 5:172714061-172714083 GGGACTTGAGTGGGCACAGAAGG - Intergenic
1003571282 6:7258177-7258199 GAATTCTAGGTGGGGACAGACGG - Intergenic
1004292720 6:14383035-14383057 GGGATGTAAGGAGGGAGAGAAGG - Intergenic
1004867749 6:19870624-19870646 GGGAGCTAAGGGGAGAGAGAAGG + Intergenic
1005553140 6:26944147-26944169 GAGATTTGGGTGGGGACAGAGGG - Intergenic
1005979336 6:30824424-30824446 AGGGACTGAGTGGGGACAGATGG + Intergenic
1007809898 6:44478322-44478344 TGGGACTAACTGGGGACAGAGGG + Intergenic
1008209401 6:48702368-48702390 GGGGTCTTAGTGGGGATGGAGGG + Intergenic
1010603703 6:77862750-77862772 GGGATCTGAGAACGGACAGACGG + Intronic
1011761798 6:90575394-90575416 GGGATCTAAGTGAGAAGAGAAGG - Intronic
1011841247 6:91501967-91501989 TAGATCTATGTGGAGACAGAGGG + Intergenic
1013296346 6:108761397-108761419 AGCATCTAAGTGGGTACAGAGGG - Intergenic
1015488228 6:133796130-133796152 GGCATCCAAGTAGGGAGAGAGGG - Intergenic
1015493384 6:133854434-133854456 GGGATCCCAGAGGGGAAAGATGG + Intergenic
1015502955 6:133952542-133952564 GGGAAGGAAGTGGGGAGAGATGG - Intronic
1016627802 6:146192860-146192882 GGGCTCTAGGTGGGCACAGCTGG + Intronic
1018432745 6:163735790-163735812 GGGATGCAAGTGGAGACAGCGGG + Intergenic
1019517964 7:1447947-1447969 GGGCTCTGAGTGGGGAGGGAAGG - Intronic
1021521273 7:21541856-21541878 GGAATATAAGAGGGGAGAGAAGG + Intergenic
1021561410 7:21972119-21972141 GGGACCTGAGTGGGGACTCATGG - Intergenic
1021886815 7:25147386-25147408 GAGATCTCAGTGGGAAGAGAAGG + Intronic
1023371762 7:39518892-39518914 GGGAATGGAGTGGGGACAGAAGG + Intergenic
1024391412 7:48816940-48816962 GAGGTCGGAGTGGGGACAGAGGG + Intergenic
1028631576 7:92940380-92940402 GGAATCTAAGTGGGTACCAAAGG + Intergenic
1028922142 7:96321313-96321335 GGTATCTAAGTGTTGTCAGATGG + Intronic
1029325008 7:99799331-99799353 GGGGCCTATGTGGGGGCAGAAGG + Intergenic
1029608497 7:101614235-101614257 GGGAGCTCAGTGGGCAAAGATGG + Intronic
1029933465 7:104398230-104398252 GGGATCTAAGTGTGAACAAGTGG - Intronic
1030222581 7:107111806-107111828 GGGGTGGAAGTGGGAACAGAGGG - Intronic
1031548329 7:123077838-123077860 GGGGTCTATGTGGTGAGAGATGG + Intergenic
1032458572 7:132092718-132092740 GGGGTCTAAGTGGGAACAAATGG - Intergenic
1032474491 7:132202872-132202894 GGAATGGCAGTGGGGACAGAAGG + Intronic
1034941011 7:155230306-155230328 GGGAGCTAAGTGAGGTCACAGGG - Intergenic
1038876074 8:31551151-31551173 GAGATTTAGGTGGGGACACAGGG - Intergenic
1041696798 8:60744385-60744407 AGGATCAAAGTGGGAGCAGAAGG + Intronic
1042180399 8:66081720-66081742 GGGAGCTTAGAGAGGACAGAAGG + Intronic
1042522923 8:69733536-69733558 GAGATTTGAGTGGGGACACAGGG - Intronic
1046392150 8:113588694-113588716 GGGAGCTAAGTGGTAACACACGG + Intergenic
1046709417 8:117493046-117493068 GGGGTCTACTTGAGGACAGAGGG - Intergenic
1047792720 8:128220976-128220998 GGAAACTAAGTAGAGACAGACGG - Intergenic
1051173040 9:14338844-14338866 GGGATCCAAGGGGGGAAGGAGGG - Intronic
1057817521 9:98306502-98306524 GGGCCACAAGTGGGGACAGATGG - Intronic
1057818021 9:98310016-98310038 GGCCTCTAAGTGGGGTCAAACGG + Intronic
1058275438 9:103035968-103035990 GAGATTTGTGTGGGGACAGAGGG + Intergenic
1059509166 9:114827977-114827999 AAGATCTAAGTGGGGAAGGAAGG - Intergenic
1062707443 9:137953317-137953339 GGGATCATAGTGAGGACAGAGGG - Intronic
1185497368 X:565684-565706 TGGATGGAAGTGTGGACAGACGG + Intergenic
1186925252 X:14326558-14326580 ATGAACTAAGTGGGGAGAGATGG + Intergenic
1188069415 X:25700667-25700689 GTGATATAAGTTGGGGCAGATGG + Intergenic
1188440249 X:30209128-30209150 GGACCCTAAGTGGGGACTGAAGG + Intergenic
1188442208 X:30223592-30223614 GGAATCTGAGTGGAGACTGATGG + Intergenic
1189317452 X:40066026-40066048 GTGTTCTAAGGGGGAACAGATGG + Intronic
1195131558 X:101858895-101858917 GGGGGTTAAGTGGAGACAGAGGG - Intergenic
1197094614 X:122578504-122578526 TGGATCAAAGTGTGGACAGAAGG - Intergenic
1198683611 X:139205492-139205514 CGGCTCTCAGTGGGGAGAGAAGG + Intronic