ID: 1145944314

View in Genome Browser
Species Human (GRCh38)
Location 17:28761488-28761510
Sequence GGCCACCTGAGGCCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145944314_1145944322 17 Left 1145944314 17:28761488-28761510 CCAGCTTGTGGCCTCAGGTGGCC 0: 1
1: 1
2: 1
3: 23
4: 273
Right 1145944322 17:28761528-28761550 CTATTCAAAGTCACATCACTGGG 0: 1
1: 0
2: 5
3: 19
4: 192
1145944314_1145944321 16 Left 1145944314 17:28761488-28761510 CCAGCTTGTGGCCTCAGGTGGCC 0: 1
1: 1
2: 1
3: 23
4: 273
Right 1145944321 17:28761527-28761549 TCTATTCAAAGTCACATCACTGG 0: 1
1: 0
2: 3
3: 20
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145944314 Original CRISPR GGCCACCTGAGGCCACAAGC TGG (reversed) Intronic
900119797 1:1043704-1043726 GTCCAGCTGAGGCCACGTGCAGG - Exonic
900414661 1:2529476-2529498 GGCCGCCAGAGGCCGCAGGCGGG + Exonic
900796971 1:4713841-4713863 GGCCTACCGAGCCCACAAGCTGG - Intronic
901464631 1:9413400-9413422 GGGCAGATGTGGCCACAAGCTGG + Intergenic
902067609 1:13700655-13700677 GGCCACCTGGGGCCCCACGTGGG + Intronic
903509955 1:23867762-23867784 GGCCGCAGGAGGCCACACGCGGG + Intronic
903544288 1:24113863-24113885 GGCCACCTGAGGTCGCAGGAAGG - Intergenic
903782474 1:25830082-25830104 AGCCACCTGAGGACAGAAGTTGG - Intronic
904339462 1:29824756-29824778 GGCCACCCCAGGCCAGAGGCAGG + Intergenic
905847030 1:41241986-41242008 GGCCGCCTGGGGCCAGAAGGCGG - Intronic
906196833 1:43934920-43934942 GGCTTCCTGTGGCCACAAGGGGG - Intronic
907368561 1:53982264-53982286 GGCCATCGGAGGCCATAACCAGG + Intergenic
910862699 1:91758295-91758317 GGGCTCCTGATGCCACAAGGGGG + Intronic
911126691 1:94347211-94347233 GGCCACCTGGGGCCACTGGAAGG - Intergenic
912966562 1:114242083-114242105 GATCACCTGAGGCCAGGAGCTGG - Intergenic
913345874 1:117810684-117810706 GGCCACCAGAGGCAGCTAGCGGG - Intergenic
915569023 1:156733933-156733955 GGCCACCTCAGGCCACAGGAAGG - Intronic
916528193 1:165631194-165631216 GGCTAGATGAGGCCAGAAGCAGG - Exonic
919350301 1:196443597-196443619 AGTCACCTGATTCCACAAGCTGG - Intronic
919737094 1:200959504-200959526 GGCCCCCTGGAGCCACAGGCAGG - Intergenic
920940132 1:210474375-210474397 GACCACCTGAGCCCAGAAGGTGG - Intronic
922165630 1:223113425-223113447 GGTCACTTGAGCCCACAAGTTGG - Intronic
922518311 1:226224143-226224165 GGGCTCCTGAGGCCACACCCGGG + Intronic
922947385 1:229528747-229528769 GATCACTTGAGGCCACAAGTTGG - Intronic
924268704 1:242309593-242309615 GATCACCTGAGGTCAGAAGCTGG - Intronic
1062848012 10:722722-722744 GGCCACCTGACGCAGCAACCAGG + Intergenic
1063214549 10:3912638-3912660 GGCCACCTGAGGTCAGGAGTTGG - Intergenic
1065531103 10:26671121-26671143 GGACACCTGAGGTCAGCAGCTGG - Intergenic
1065840857 10:29699801-29699823 GGGCACCTGAAGGCACCAGCGGG + Intronic
1066716202 10:38289171-38289193 GATCACCTGAGGTCAGAAGCTGG + Intergenic
1068633305 10:59320759-59320781 GGCCACCTTTGGCCACAACTTGG + Intronic
1069609950 10:69766323-69766345 GACCACCAGTGGCCACAACCAGG - Intergenic
1070752577 10:78972900-78972922 AGCCAGCTGTGGCCACACGCAGG - Intergenic
1071223019 10:83492006-83492028 GGCCACATGAAGACACAAGGAGG + Intergenic
1071534394 10:86415883-86415905 AGCCACCTGAGGTCACATGCAGG - Intergenic
1074677499 10:115868668-115868690 GGAGACCTGAGGTCACATGCTGG - Intronic
1077916708 11:6616309-6616331 GGTCACCTGAGGCGAAGAGCAGG + Exonic
1078855870 11:15206223-15206245 GGCCATCAGAGGCTATAAGCAGG + Intronic
1080545114 11:33309334-33309356 GATCACTTGAGGCCACAAGTTGG - Intronic
1083221273 11:61254417-61254439 GTCCACCTGAAGCCCCCAGCGGG - Intergenic
1083378231 11:62243603-62243625 GGTCACCTGGGGCCACAGGGTGG + Intronic
1084408755 11:68994020-68994042 GGCCTCATGAAGACACAAGCAGG + Intergenic
1084482522 11:69430149-69430171 GGCCGCCTGAGGGAACAGGCAGG - Intergenic
1086450317 11:86909190-86909212 GGCCACCTCAGGCCATATGGAGG - Intronic
1087515528 11:99154737-99154759 GGACATCTGAGGCTACAAGTGGG + Intronic
1087909417 11:103736057-103736079 TGCCCCATTAGGCCACAAGCTGG - Intergenic
1088247180 11:107830038-107830060 GATCACCTAAGGCCACAAGTTGG + Intronic
1088886776 11:114013894-114013916 GGTCACTTGAGCCCACAAGTTGG + Intergenic
1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG + Intronic
1090488781 11:127139533-127139555 CGCCACCTGAACCCACAATCGGG + Intergenic
1090594841 11:128310243-128310265 GGCCTGCTGAGGCCACATGAAGG - Intergenic
1090647290 11:128776427-128776449 GATCACCTGAGGCCAGAAGTTGG + Intronic
1091567527 12:1660028-1660050 GGCCACATGATTCCACCAGCTGG + Intergenic
1093556900 12:20486853-20486875 GGTCACTTGAGGCCAGAAGCTGG - Intronic
1094746774 12:33353753-33353775 GGCCACGTGAGGACACAGGGAGG + Intergenic
1096102540 12:48978470-48978492 GGCCGCCTCAGCCCACCAGCCGG + Intronic
1096163925 12:49404498-49404520 GATCACCTGAGGCCAGGAGCTGG - Intronic
1096531067 12:52243187-52243209 GGCCAGCTGAGGCCAAACTCAGG + Intronic
1101661922 12:106774097-106774119 GGCCGCCTGAGGCCAGCGGCGGG - Intronic
1102579692 12:113878504-113878526 GGCCATCGCAGGCCCCAAGCGGG + Intronic
1103762287 12:123259562-123259584 GGTCACCTGAGGTCAGAAGTTGG + Intergenic
1104569387 12:129911616-129911638 GGTCCACTGATGCCACAAGCAGG - Intergenic
1104762225 12:131304357-131304379 GGTCACATGAGGCCACAAGGAGG + Intergenic
1104817551 12:131656439-131656461 GGTCACATGAGGCCACAAGGAGG - Intergenic
1105436212 13:20380554-20380576 GGCCACCTGAAGACACAGGCAGG + Intergenic
1106642273 13:31597068-31597090 GTGCACCTGAGGGCCCAAGCTGG + Intergenic
1108282466 13:48873726-48873748 GGTCACCTGAGACCACCAACAGG + Intergenic
1108684384 13:52806260-52806282 GGACAGCTGTGGCCACCAGCTGG + Intergenic
1108753570 13:53473627-53473649 GGCAGCCTGAGGCCAGCAGCAGG - Intergenic
1112030869 13:95454963-95454985 GATCACTTGAGGCCACAAGTTGG + Intronic
1113794583 13:113049615-113049637 GGCCAGCCGAGCCCTCAAGCAGG + Intronic
1113882009 13:113632277-113632299 GGCCACCTGAGGTTCCTAGCTGG - Intronic
1116536742 14:46041297-46041319 GGCCACTTGAGGCCAAACACTGG + Intergenic
1117493477 14:56276337-56276359 GGGCGCCTAAGGCCACCAGCAGG - Intronic
1117603583 14:57400956-57400978 GATCACCTGAGGCCAGGAGCTGG - Intronic
1120337755 14:83179828-83179850 GGCTACCTGAGGCCTCTAACAGG + Intergenic
1121046460 14:90791731-90791753 GCCCATCTGAGACCACAAGCTGG + Intronic
1121112515 14:91322003-91322025 GGCCCCCTCCTGCCACAAGCAGG + Intronic
1121485939 14:94314390-94314412 GGGCACCTGTGGCCACACACGGG - Exonic
1121507238 14:94486437-94486459 GGCCGCCTGTGGCCACTAGAGGG - Intergenic
1122783699 14:104154417-104154439 GGCCTCCTGCGGCCACAGGTGGG + Intronic
1122834564 14:104424471-104424493 GGGCATCTGAGGCCACAGACGGG + Intergenic
1123628429 15:22243962-22243984 GGGGACCTGAGGTCACAGGCGGG - Intergenic
1124341928 15:28895257-28895279 AGCCACCGGAGGCCAGCAGCAGG - Intronic
1124722745 15:32124869-32124891 GGCCATCTGAGGACACAAGGAGG + Intronic
1125182927 15:36897834-36897856 GTCCACCTGGGGCCACAGGCAGG + Intronic
1126578673 15:50222208-50222230 GGCCACCTGAGGCAACTGGGAGG + Intronic
1127293806 15:57592271-57592293 GGCCCCCTGAAACCTCAAGCGGG - Intronic
1129206384 15:74039271-74039293 GGGCAGCAGAGGCCACAGGCTGG + Intronic
1129615809 15:77098159-77098181 GGCCAGCTGTGGCCACAAAATGG + Intergenic
1130316601 15:82801870-82801892 TGCCACCTGGGACCACAAACAGG + Intronic
1130893037 15:88149644-88149666 GACCACCTGAGGACACCACCTGG + Intronic
1132681267 16:1142991-1143013 GCCCTCCAGGGGCCACAAGCTGG + Intergenic
1132914700 16:2337605-2337627 GATCACTTGAGGCCACAAGTTGG - Intronic
1133055434 16:3143372-3143394 GGGGCCCTGAGGCCACTAGCAGG - Intergenic
1135964318 16:27023237-27023259 GGCAAGCTAAGGCCACCAGCTGG + Intergenic
1136568512 16:31083632-31083654 GGGCACCTGTGGCCCCAGGCAGG + Exonic
1137402633 16:48165620-48165642 GGCTACCTGAGGCTAGAAGCAGG - Intergenic
1138307139 16:55988666-55988688 GATCACCTGAGGCCAGGAGCTGG - Intergenic
1138608321 16:58103194-58103216 GGCCTCCTGAGGCCCCAACGTGG + Intergenic
1139259584 16:65578918-65578940 GGACAACAGAAGCCACAAGCTGG + Intergenic
1139557715 16:67723330-67723352 GGCAGCCAGAGGCCACAATCTGG + Exonic
1140706537 16:77635675-77635697 AGCCACATGGAGCCACAAGCAGG - Intergenic
1141670898 16:85491236-85491258 TGCCACCTGGGGCCACGAGAAGG + Intergenic
1141675919 16:85517262-85517284 GGTTACCTGAGGACACACGCAGG + Intergenic
1141975507 16:87513369-87513391 GGGGACCTGAGGTCACAGGCAGG + Intergenic
1142000303 16:87660486-87660508 CCCCACCAGAGGCCACAGGCTGG + Intronic
1142186970 16:88699240-88699262 GGCCTCCTGAGGACACACCCAGG + Intronic
1142337897 16:89502119-89502141 GGCCACCAGCAGCCACATGCTGG + Intronic
1142806129 17:2372173-2372195 GGCAACCTGTGGCAACAACCGGG - Exonic
1145944314 17:28761488-28761510 GGCCACCTGAGGCCACAAGCTGG - Intronic
1148286754 17:46400193-46400215 GGCCACTGGAGGCCACTAGATGG + Intergenic
1148308920 17:46617783-46617805 GGCCACTGGAGGCCACTAGATGG + Intronic
1149684252 17:58526442-58526464 TCCCATCTGAGGCCACCAGCTGG + Intronic
1149858423 17:60106025-60106047 GATCACCTGAGGCCAGGAGCTGG - Intergenic
1151586373 17:75011125-75011147 GGCCACCAGATGGCCCAAGCAGG + Intergenic
1152297005 17:79473641-79473663 GGCCACCTGCCGTCACCAGCGGG - Intronic
1154220764 18:12451685-12451707 GGCCAGCTCAAGCCTCAAGCTGG - Intronic
1156241525 18:35259276-35259298 GGTCACCTGAGCCCAGAAGGTGG - Intronic
1158562970 18:58530977-58530999 GGTCACCTGAGGCCAGGAGTTGG + Intronic
1160143495 18:76346845-76346867 AGCCACTGGAGGCCACACGCAGG + Intergenic
1161417396 19:4155074-4155096 GGCCAACTGAGGCCCCACGAAGG + Intronic
1161470416 19:4454243-4454265 GGCCACCTGCAGCCACCAGATGG + Intronic
1161483593 19:4523283-4523305 GGCCAACTTGAGCCACAAGCTGG - Exonic
1161755905 19:6134167-6134189 GATCACCTGAGGCCACGAGGTGG + Intronic
1161976604 19:7611119-7611141 GGCCACCAGATGACAGAAGCGGG - Exonic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1162931277 19:13959147-13959169 GGCCGCCTCAGGGCAGAAGCTGG - Exonic
1163103476 19:15110504-15110526 GGCACCCTGAGGACACAAGGGGG - Exonic
1163394878 19:17054061-17054083 GGCCACCAGCAGCCACCAGCAGG + Intronic
1163602000 19:18254960-18254982 GGCCATCTGTGGCCTCCAGCAGG + Intronic
1163777809 19:19228190-19228212 GGCCACCTGAGGGCTCAAGGTGG - Exonic
1165958896 19:39518590-39518612 GGCCACTGGAGGCCAAGAGCAGG - Exonic
1166087508 19:40486890-40486912 AGCCAACTGGGGTCACAAGCAGG + Intronic
1166566153 19:43766883-43766905 GCCCACCTGAGGCCCCAGGTGGG - Exonic
1166835052 19:45662267-45662289 GATCACCTGAGGTCACAAGTTGG - Intergenic
926121570 2:10243811-10243833 GGCCACGTGAGGCCTCCGGCGGG - Intergenic
926222004 2:10942442-10942464 GGCCAGCTGGGGCTACAGGCCGG - Intergenic
927693252 2:25223030-25223052 AGCCACCAGAGGCCACATGCAGG + Intergenic
927842984 2:26457068-26457090 GGCCACCAGAGGCCACTTGAAGG + Intergenic
927913258 2:26916323-26916345 AGCCACGTGCAGCCACAAGCAGG - Intronic
929573613 2:43038952-43038974 GGCCACCAGAGCCCCCAAGGGGG - Intergenic
929945563 2:46369210-46369232 GGGCACCTGAGGTCACAGGCAGG + Intronic
930189272 2:48441043-48441065 GGCAACCTGAGGCCGCAGGGCGG - Intronic
934773665 2:96923820-96923842 GGTCACCTGAGCCTACAGGCTGG + Intronic
935218852 2:100995043-100995065 TGGAACCTGAGGCCACATGCAGG - Intronic
935725157 2:106017668-106017690 TGCCAGCTGAGGCCACATGTTGG + Intergenic
937120550 2:119437511-119437533 CCCCACCAGAGGCCACATGCTGG - Exonic
937907578 2:127059688-127059710 GGCTGCTGGAGGCCACAAGCAGG + Intronic
943125952 2:183793126-183793148 GATCACCTGAGGCCAGGAGCTGG + Intergenic
945509738 2:210686519-210686541 GGCCACCTGAGGTCACACAGAGG + Intergenic
946157712 2:217818044-217818066 AGCCACCATAGGCCACATGCCGG + Exonic
946328279 2:218996182-218996204 GGCCACCAGAGGGCAGGAGCAGG + Intergenic
947270538 2:228328964-228328986 GGCCACCTGGGTTCACATGCAGG - Intergenic
948674949 2:239591749-239591771 GGAGACCTGAAGCCATAAGCAGG + Intergenic
948947725 2:241229634-241229656 AGCCACCTGAGCCCCAAAGCTGG + Exonic
949047030 2:241876974-241876996 GAACACCTGAGGCCCCAGGCAGG + Intergenic
1169068927 20:2709822-2709844 GGCCACCTGGGGCCTCACTCAGG - Intronic
1169422382 20:5471019-5471041 GGGTACCTGAGGCCAGAAACTGG + Intergenic
1170155128 20:13262245-13262267 GGCCACCAGTGGCCACCAGGGGG - Intronic
1170460473 20:16573082-16573104 GGCCCCCAGAGGCCACAGCCTGG + Intronic
1172165121 20:32894187-32894209 GGCCACCAGGGGCCCCATGCAGG + Intronic
1172281701 20:33712381-33712403 GGCCACCCAAGGGCAGAAGCAGG - Intronic
1174535248 20:51246441-51246463 GGCCACATGAGGACACAGGGAGG + Intergenic
1174682911 20:52425081-52425103 GGCCAACTGAAGCGACAATCAGG + Intergenic
1175093497 20:56523683-56523705 GGTCACCTGAGGTCAGGAGCTGG - Intronic
1175371760 20:58497123-58497145 GGACACCAGAGGTCACAAGATGG + Intronic
1175582651 20:60112520-60112542 GCCCACCTGCGGCCACGATCTGG - Intergenic
1178063626 21:28879169-28879191 GATCACCTGAGCCCACAAGGTGG - Intronic
1179126498 21:38595583-38595605 GGCCACCTCAGAGCAGAAGCAGG + Intronic
1179295618 21:40059758-40059780 GGCCCCATGTGGCCATAAGCTGG - Intronic
1179885859 21:44314037-44314059 GGACACCTGCGGCCCCCAGCAGG - Intronic
1180063847 21:45403232-45403254 GGCCAACTCAGGCCACAGGTGGG + Intergenic
1180845147 22:18976706-18976728 GGCCAGCTGTGGCCACAGGCTGG - Intergenic
1181056316 22:20262038-20262060 GGCCGGCTGTGGCCACAGGCCGG + Intronic
1181570169 22:23764137-23764159 GCCCACCTGAGGCAGAAAGCAGG + Exonic
1182319212 22:29467451-29467473 TGCCACTTTAGGCCAGAAGCTGG + Intergenic
1183606167 22:38867759-38867781 GGCCAGCTGAGGAGACAGGCTGG - Intronic
1183870167 22:40735693-40735715 GGTCTCCTGAGGCCACACCCAGG + Intergenic
1185067524 22:48639625-48639647 GCCCACCTGAAGCCACATGCAGG + Intronic
1185190987 22:49435913-49435935 AGCCAACTTAGGCAACAAGCAGG - Intronic
951190508 3:19764418-19764440 GGCCACCTGTGACCCCGAGCTGG - Intergenic
954120104 3:48492871-48492893 GGCCACGTGAGGACATAACCAGG + Intronic
954453099 3:50582260-50582282 GGGCAGCTGGGGCCACAAGCAGG + Exonic
955373697 3:58375760-58375782 GGCCACCTGAGACCCTAAACTGG + Intronic
956289038 3:67642381-67642403 GATCACTTGAGGCCACAAGTTGG + Intronic
956595581 3:70963254-70963276 GACCACCTGATGACACAACCAGG + Intronic
960305487 3:116055310-116055332 TGCCACCTGAAGCCAAAAGTGGG + Intronic
961346412 3:126266471-126266493 GGCCACCCGCGGCCAGGAGCAGG + Intergenic
961563469 3:127747007-127747029 AGCCACCTGAGGTCACAAGTGGG + Intronic
962418632 3:135207427-135207449 GTCAACATTAGGCCACAAGCTGG + Intronic
965999706 3:174932894-174932916 GGTCACCTGAGGTCAGAAGTTGG + Intronic
966550097 3:181195215-181195237 GATCACCTGAGGCCAGAAGCTGG - Intergenic
966802648 3:183778575-183778597 GATCACCTGAGGTCACGAGCTGG - Intronic
969318051 4:6393949-6393971 GGCAGCCTGAGGCCAGCAGCTGG + Intronic
969425646 4:7122334-7122356 GGTCGTCTGAGGCCACAGGCTGG - Intergenic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
971206773 4:24578287-24578309 AGTCACCTTAGGCCAGAAGCAGG - Intronic
971657496 4:29368724-29368746 GATCACCTGAGGTCACAAGTTGG + Intergenic
978527371 4:109679422-109679444 GATCACCTGAGGCCAGGAGCTGG + Intronic
979666427 4:123315999-123316021 GGTCACCTGAGGCCAGGAGTTGG - Exonic
981210679 4:142100412-142100434 TGTCACCAGAGGCCAAAAGCTGG - Intronic
982236364 4:153254517-153254539 GGCCACTTGAGGCCACAATATGG + Intronic
982365059 4:154568774-154568796 GATCACCTGAGCCCACAACCTGG + Intronic
982583398 4:157207442-157207464 AGCCACCTGGGGCAAAAAGCAGG - Intronic
982744266 4:159090306-159090328 GGTCACCTGAGCCCAGAAGGTGG - Intergenic
983794830 4:171849093-171849115 AGCCACCACAGGCCCCAAGCTGG - Intronic
984704633 4:182838836-182838858 TACCTCCTGAGGCCAGAAGCAGG + Intergenic
984903789 4:184608672-184608694 GATCACCTGAGGTCAGAAGCTGG - Intergenic
985866518 5:2518531-2518553 GGCCACCTCAGGTCACACACAGG - Intergenic
988532442 5:32039326-32039348 GATCACCTGAGGCCAGGAGCTGG - Intronic
990237361 5:53782524-53782546 GGCCATCTGTGTCCAGAAGCTGG + Intergenic
991204250 5:64031995-64032017 AGCCACCTGAGACCAAAAGAAGG + Intergenic
995332065 5:110956889-110956911 GGCCATCTGAGGCCTGAAGGTGG - Intergenic
997606106 5:135176844-135176866 GACCACCTGAGGGCAGAGGCTGG - Intronic
998136880 5:139678641-139678663 GGGAAACTGAGGCCCCAAGCGGG - Intronic
999285623 5:150392665-150392687 GGCCACCTGGGGCTACCAACAGG + Intronic
1001399818 5:171439756-171439778 GGCCAGCTGAGCCCACACGCAGG + Intronic
1002025139 5:176391735-176391757 GGCTACCAGAAGCCAGAAGCAGG + Intronic
1006392613 6:33767494-33767516 GGCCTCCTGAGGCCTCAGACCGG + Intergenic
1007163399 6:39810948-39810970 GCCCACCAGTGGCCACAAACTGG - Intronic
1007830446 6:44634394-44634416 GGTAAGCTGAGGCCACAAACGGG + Intergenic
1009869282 6:69433836-69433858 GATCACCTGAGGCCAGGAGCTGG + Intergenic
1012474213 6:99603390-99603412 GGCCACCTCAGGCCAAAATTCGG + Intergenic
1015434164 6:133166598-133166620 GACCACCTGAGGCCAGGAGTTGG - Intergenic
1016392550 6:143589563-143589585 GACCACCTGAGGATACAAGACGG - Intronic
1016422507 6:143900040-143900062 GGGTGCCTCAGGCCACAAGCTGG - Intronic
1016960382 6:149667211-149667233 GATCACTTGAGGCCAGAAGCTGG + Intronic
1018565514 6:165147035-165147057 GGCCTCCTGAGGCTCAAAGCAGG + Intergenic
1018687977 6:166318390-166318412 GGCCTCCGCAGCCCACAAGCTGG + Intergenic
1019256512 7:55918-55940 TCCCACCTGAGGCCACAGGAGGG - Intergenic
1019257542 7:61761-61783 GCCCAACAGAGGCCACAGGCCGG + Intergenic
1019525777 7:1479815-1479837 GGGCCCCTCAGGCCACAAGGTGG - Intronic
1019997144 7:4731933-4731955 GGAGACCTGAGGCCACACGGAGG + Intronic
1020115257 7:5472605-5472627 GGCCACACGAGGCCACATGGAGG + Intronic
1020692328 7:11371321-11371343 GGCCACCTGAGGGCAGGACCTGG + Exonic
1020792761 7:12646340-12646362 GGCCATGTGAGGACACAAGAAGG - Intronic
1023256466 7:38317723-38317745 GGCCACCTCAGACCACAAGGCGG + Intergenic
1024023100 7:45388490-45388512 GTCCACCTGAGGCCCCATACAGG - Intergenic
1024425496 7:49221004-49221026 GGCCAACTGTGGGCACATGCTGG - Intergenic
1024529826 7:50382686-50382708 GGCCACCTGAGGACGCACTCCGG + Exonic
1024910593 7:54443704-54443726 GACCACCCGAGGCCAGGAGCTGG - Intergenic
1025182854 7:56832433-56832455 GGCCACCTGGGGGCAGCAGCTGG + Intergenic
1025222869 7:57131339-57131361 GATCACCTGAGGCCAAAAGTTGG + Intronic
1025633663 7:63303012-63303034 GATCACCTGAGGCCAAAAGTTGG + Intergenic
1025649033 7:63445148-63445170 GATCACCTGAGGCCAAAAGTTGG - Intergenic
1025689072 7:63744541-63744563 GGCCACCTGGGGGCAGCAGCTGG - Intergenic
1025728170 7:64087203-64087225 GGCCCTCTGAGGCCCCATGCAGG - Intronic
1026925186 7:74187206-74187228 GACCACCTGAGGTCAGAAGTTGG + Intronic
1027202943 7:76074314-76074336 GGCCACCGCAAGGCACAAGCTGG + Intergenic
1029704166 7:102267091-102267113 GGTCACCTGAGGCTACCTGCAGG + Intronic
1030047753 7:105512679-105512701 GGCCACATGAGGCTACAAGGAGG + Intronic
1031066185 7:117107834-117107856 GGTCACCTGAGGTCAGAAGTTGG - Intronic
1034940838 7:155229139-155229161 GGCCAGGTGAGGACACAGGCAGG - Intergenic
1035519004 8:261440-261462 GATCACTTGAGGCCAGAAGCTGG + Intergenic
1035676284 8:1458654-1458676 TGCAACCTGAAGCCACACGCAGG - Intergenic
1035714968 8:1747036-1747058 GGCCACCGGAGGCCAGATCCAGG + Intergenic
1039349044 8:36741066-36741088 GGCCAGTTGAGGCCAGAAGGAGG + Intergenic
1040311781 8:46240585-46240607 GGCCACCTCAGGCGAAAACCCGG + Intergenic
1042618703 8:70679087-70679109 GGCCATGTGAGGACACAAGAAGG - Intronic
1043054278 8:75418170-75418192 GGCCACATGAGGACACCAGGAGG - Intronic
1045002939 8:97893892-97893914 CACCACCAGAGACCACAAGCTGG - Intronic
1045232680 8:100319749-100319771 GGCCACCTGAGGTCAGGAGATGG - Intronic
1047058801 8:121198479-121198501 GGCCACATGAAGCTACAAGGAGG - Intergenic
1047572177 8:126110913-126110935 GTTCACCAGAGGACACAAGCTGG - Intergenic
1048316113 8:133363535-133363557 AGCCAGCTGAGGCCACAGGATGG - Intergenic
1049745869 8:144263066-144263088 GGCCACCCAAGGCCACACCCAGG - Exonic
1051077782 9:13260726-13260748 GGCCACATGAGCACACAAGAAGG + Intronic
1051208239 9:14712915-14712937 GGAGACCAGAGGCCAGAAGCAGG + Intergenic
1051647259 9:19280825-19280847 GACCACCTGAGCCCAGAAGGCGG - Intronic
1052694084 9:31854090-31854112 AGGCACCTGAGGCTACAAGTGGG - Intergenic
1052985007 9:34480497-34480519 GCTCACCTGAGGTCACAAGTTGG - Intronic
1053250984 9:36573726-36573748 GATCACCTGAGGACACGAGCTGG - Intronic
1056739119 9:89237485-89237507 TGCCACGTGAGGACACAAGAAGG + Intergenic
1057266173 9:93619554-93619576 GGCCACCAGGGGCTACCAGCAGG - Intronic
1057266190 9:93619622-93619644 GGCTACCGGAAGCCACCAGCAGG - Intronic
1057291437 9:93809823-93809845 GGCCACCTGAGGCCACAAGTAGG - Intergenic
1057585882 9:96328335-96328357 GACCACCTGAGCCCAGAAGATGG - Intronic
1060176281 9:121499603-121499625 GGTCCCCGGAGGCCACGAGCAGG - Intergenic
1060577721 9:124712385-124712407 GACCACTTGAGGCCAGGAGCTGG + Intronic
1060758438 9:126229046-126229068 GTGCACCTGAGGCCACATGGTGG - Intergenic
1060940979 9:127542659-127542681 GGGCACCTGAGGCCAGCAGGGGG - Intronic
1061093219 9:128438797-128438819 GGCCACCAGAGGGCGCAAGGTGG + Intergenic
1061546358 9:131307021-131307043 GGTCACCTGAGGCCAGGAGTTGG + Intronic
1061623159 9:131824675-131824697 GGCCACCTGAGGGCAGAGACAGG - Intergenic
1061628242 9:131855150-131855172 AGGAAACTGAGGCCACAAGCTGG - Intergenic
1062162972 9:135089851-135089873 GGCAACTGGAGGCCACAGGCTGG - Intronic
1062234534 9:135501500-135501522 GGCCACCTGAGACCACAAGGCGG + Intronic
1062444157 9:136586439-136586461 GCTCACCTGAGTCCACACGCAGG + Intergenic
1186584668 X:10859896-10859918 TGCCACCTGAGACCCCTAGCAGG - Intergenic
1188081844 X:25852790-25852812 GGTGACCTGCGGCCACAGGCAGG + Intergenic
1190151495 X:47953890-47953912 GGTCACCTGTGGCCAGAAGTAGG + Intronic
1192504808 X:71675406-71675428 GATCACCCGAGGCCAGAAGCTGG - Intergenic
1192886040 X:75336082-75336104 GATCACCTGAGGCCAGGAGCTGG + Intergenic
1193821454 X:86170623-86170645 TGCCACCCTAGGCCACAAGGAGG + Intronic
1195742997 X:108085009-108085031 GGCCACCTTTGGCCACTTGCAGG + Exonic
1200569580 Y:4811762-4811784 GGTCACCTGAGGCCAGGAGTTGG - Intergenic
1200699332 Y:6388840-6388862 TTCCACCTGTGGCCACAAGGGGG - Intergenic
1201034779 Y:9775858-9775880 TTCCACCTGTGGCCACAAGGGGG + Intergenic